Functional and health promoting inherent attributes of Enterococcus hirae F2 as a novel probiotic isolated from the digestive tract of the freshwater fish Catla catla

Extraction and quantification of DNA

Genomic DNA of E. hirae F2 was extracted, using bacterial genomic DNA kit (GenElute™, Sigma-Aldrich, Bangalore, India) and quantification was done according to the described method (Sambrook, Fritch & Maniatis, 1982). 10 µL of extracted DNA was dissolved in 30 µl of Tris buffer (pH-8.0) and OD was taken at 260 and 280 nm (UV-1800 Shimadzu Spectrophotometer; Shmadzu, Kyoto, Japan). OD of the samples showed between 1.6-1.8, which affirms the purity and integrity of the samples. However, purity of extracted genomic DNA was also checked by agarose gel electrophoresis (0.8%).

PCR amplification of 16S rRNA gene

16S rRNA region of E. hirae F2 was amplified by using 1X (final concentration) ReadyMix™ Taq PCR Reaction Mix (Sigma-Aldrich, Bangalore, India) and template DNA (50 ng/ µL). The reaction was carried out in Thermal cycler (Applied Biosystems Veriti; Applied Biosystems, Foster City, CA, USA). Pair of universal primers 27f and 1492r was used to amplify 16S rRNA region. 27f 5′AGAGTTTGATCMT GGCTCAG3′ used as a forward and 1492r 5′CGGTTACCTTGTTACGACTT3′ was used as a reverse primer (Weisburgv et al., 1991). PCR reaction mixture contained 1 x reaction mixture (10 µL), forward primer (1 µL), reverse primer (1 µL), genomic DNA template (2 µL), nuclease free water (6 µL). PCR program was adjusted as: Initialization at 95 °C for 5 min, 30 cycles of denaturation at 95 °C for 1 min, annealing at 55 °C for 1 min, extension at 72 °C for 1 min; and a final elongation step at 72 °C for 3 min followed by hold at −4 °C for ∞ time. Amplified PCR products were detected on agarose gel (1%) by electrophoresis staining with ethidium bromide and visualizing under UV light. The gels were analyzed by using the software Image lab version 3.0 (Bio Rad, Hercules, CA, USA). Purification of amplified PCR product was done using GenElute™ PCR Clean-up kit (Sigma^®, India).

Cycle sequencing, analysis and sequence submission

Sequencing was carried out using Big Dye^® Terminator v 3.1 Cycle sequencing kit with 27f and 1492r primers according to manufacturers protocol. Nucleotide sequencing was carried out in house with an ABI Prism 3130 automatic sequencer (Applied Biosystems, USA). Sequence analysis was done using sequencing analysis software version 5.4 (Applied Biosystems, Foster City, CA, USA) and BioEdit 7.2.5. These sequences were subjected to sequence match analysis using Basic Local Alignment Search Tool (BLAST) on NCBI. The sequences were submitted to the NCBI GenBank datase under GenBank ID KF496213.1.

Bile salt tolerance

Ability of E. hirae F2 to grow in the presence of bile salt was determined by both tube as well as plate method containing different amount of bile salts. In the tube method, fresh culture (1%) was inoculated in to MRS broth containing different concentration of bile salts (Sigma-Aldrich, Bangalore, India) from 0.2 to 2%. Tubes were incubated anaerobically at 37 °C for 24 h, growth was confirmed by taking OD of the tubes at 560 nm after 24 h and then compared with a control tube (without bile salts) (Vinderola & Reinheimer, 2003). However, the ability of F2 culture to survive in bile salt was also assessed in terms of viable count by plating culture on MRS agar plates by withdrawing aliquots at 0, 30, 60, 90, 120 min time interval and incubated at 37 °C for 24 h. Counts of viable colonies evaluated bile salt tolerance.

Bsh activity

Bsh activity of E. hirae F2 was assessed by direct plate Bsh assay method (Kumar et al., 2010). 0.1 ml of overnight grown culture was streaked on MRS agar plates supplemented with 0.5% biles like sodium deoxycholate (DCA) and sodium glycocholate (GCA)(Hi-Media, Mumbai, India) and 0.04% CaCl₂. Plates were then incubated at 37 °C for 24 to 48 h. Bsh activity was confirmed by the presence of precipitated bile salts around colonies with a silver shining.

Lipolytic activity

Lipid (Fat & oil) catabolising ability of E. hirae F2 by its lipase enzyme was carried out on Spirit Blue Agar (SBA) (Hi-Media, Mumbai, India) plates. 6 mm wells were made on the SBA plates by using sterile cork borer. Wells were filled with 100 µl of fresh culture and incubated at 37 °C for 24–48 h. The presence of lipase was visualized as clear blue colour halos around the wells.

Acid tolerance

Survival percentage of E. hirae F2 under highly acidic environment was assessed by the described method with certain modifications (Erkkila & Petaja, 2000). Overnight grown culture of E. hirae F2 was inoculated in to fresh MRS broth and grown up to 0.6 to 0.7 OD at 600 nm. The cell culture was centrifuged at 8000 rpm for 10 min at 4 °C (5430R; Eppendorf, Hamburg, Germany). Cell pellet was then washed and resuspended in sterile phosphate buffer saline (pH-7.0). 1 ml of resuspended cells was added into another tube containing 10 ml phosphate buffer saline with different pH: 2, 3, 4 and 7, where, pH 7.0 was served as a control. All the tubes were incubated at 37 °C for 6 h. Calculation of viable cells was carried out by spreading 0.1 ml of culture on MRS agar plates with BCP at 0, 2, 4 and 6 h. All the plates were then incubated at 37 °C for 24 h. Survival percentage of culture at different pH was calculated by using following formula: ${\displaystyle \text{Survival \%}=\frac{\text{Final (CFU/ml)}}{\text{Control (CFU/ml)}}\times 100.}$

Survival and transit tolerance under simulated gastrointestinal tract conditions

Artificial gastrointestinal tract conditions were made up according to the prescribed and published protocol with modifications (Huang & Adams, 2004). Gastric juice was made up by mixing of 3 mg of pepsin (Sigma, Bangalore, India), 0.5 gm bile salt (Sigma, Bangalore, India), 1 ml of 0.7% of sodium chloride (Sigma, Bangalore, India) with pH 2–3. Overnight grown culture of E. hirae F2 was inoculated in to fresh MRS broth and grown up to 0.6–0.7 OD at 600 nm. The cell culture was centrifuged at 8,000 rpm for 10 min at 4 °C. Cell pellet was washed and resuspended in sterile phosphate buffer saline (pH-7.0). 0.5 ml of resuspended cells were added into 2.0 ml of gastric juice and incubated at 37 °C for 4 h. Survival cell count were calculated by spreading 0.1 ml of culture on MRS agar plates at 0, 2, 4 and 6 h. All the plates were incubated at 37°C for 24 h. Survival percentage under gastric juice was calculated by using following formula: ${\displaystyle \text{Survival \%}=\frac{\text{Final (CFU/ml)}}{\text{Control (CFU/ml)}}\times 100}$

Potentiality of E. hirae F2 as yoghurt culture

Curdling ability of E. hirae F2 from milk was carried out by using three different categories of milk available in the market (skimmed, semi-skimmed and whole). All the tubes were filled with 10 ml of milk and autoclaved. Autoclaved tubes filled with milk were inoculated with 1 ml of overnight grown culture of E. hirae F2 and incubated at 37°C for 24–48 h.

Homo/heterofermentative characterization of E. hirae F2

CO₂ production from glucose test was applied, in order to determine the homo/heterofermentative characterization of E. hirae F2. Citrate lacking MRS broth and inverted Durham tubes were prepared and inoculated with 1% overnight fresh culture. Test tubes were then incubated at 37 °C for 3 days. Gas occurrence in Durham tubes was observed during 3 days, which is the evidence for CO₂ production from glucose. This test was further checked out according to the method described by McDonald et al. (1987) on homofermentative-heterofermentative differential (HHD) medium. E. hirae F2 was streaked on HHD plates and incubate at 37 °C for 24–72 h. In the agar medium, homofermentative colonies were blue to green, while heterofermentative colonies remained white (Fig. 1E).

In vitro evaluation of antibacterial activity by E. hirae F2

Antibacterial activity of E. hirae F2 isolate was tested against different indicator organisms like Escherichia coli (MTCC 40), Staphylococcus aureus (MTCC 3160), Salmonella typhi (MTCC 3215) and Pseudomonas aeruginosa (MTCC 424) by using agar well diffusion method on Muller Hinton Agar (MHA) (Hi-Media, Mumbai, India). Overnight grown culture of E. hirae F2 was centrifuged at 8,000 rpm for 10 min at 4 °C. Supernatant was collected and adjusted to pH 6.7–7.0 and kept at 90 °C for 2 min in water bath. Neutralized supernatant was filter sterilized by 0.2 µm size syringe filter. 500 µl of overnight grown culture of indicator organisms in nutrient broth (Hi-Media, Mumbai, India) were spreaded evenly on to the MHA plates. Then, with the help of a sterile cork borer, wells of 5–6 mm diameter were made in to the plates. A total of 100 µl of supernatants were filled into each of the test wells. A total of 100 µg/ml chloramphenicol antibiotic solution was used as a positive control and sterile MRS broth was used as a negative control. All the plates were incubated at 37°C for 24 h. Diameter of the zone of inhibition was measured.

Antioxidative activity against α-Diphenyl- α-Picrylhydrazyl (DPPH)

Antioxidant activity of E. hirae F2 against DPPH was carried out according to the method described (Wu & Pan, 2004) with certain modifications. The same supernatant, which was used in antibacterial activity, was also used for antioxidant activity. Overnight grown cells were harvested by centrifugation at 6,000 rpm for 10 min at 4 °C. Cell pellet was washed three times and resuspended in phosphate buffer saline (pH-7.0). 100 µl of supernatant and intact cells were separately mixed with 2ml of 6 × 10⁻⁵M ethanolic solution of DPPH (Sigma, Bangalore, India) and incubated for 30 min in the dark. After 30 min, reduction of DPPH free radicals was measured at 517 nm. Ethanol was used as a blank and DPPH solution without any sample or standard was used as a control. Activity was carried out in triplicates. As a positive control L-ascorbic acid (1 mg/ml) (Sigma-Aldrich, Bangalore, India) was used (Ahn et al., 2004). Percentage inhibition of DPPH radical was calculated by using following formula: ${\displaystyle \text{\% Inhibition}=\frac{\text{(Absorbance of control – Absorbance of test)}}{\text{Absorbance of control}}\times 100}$

Antibiotic susceptibility test

Antibiotic sensitivity test was determined by using agar diffusion method of National Committee for Clinical Laboratory Standards (NCCLS, 1993). 100 µl of overnight grown culture of E. hirae F2 was spreaded on MRS supplemented with BCP agar plate and antibiotic discs were placed on the plate by using sterile forceps. Plates were incubated at 37 °C for 24 h. E. hirae F2 was checked for sensitivity or resistance against few antibiotics like, Ampicillin (10 µg), Gentamycin (30 µg), Cephalexin (30 µg), Streptomycin (10 µg), Chloramphenicol (30 µg), Co-Trimoxazole (25 µg) and Tetracycline (25 µg).

Determination of cell surface hydrophobicity

Cell surface hydrophobicity is the ability of bacterial cell to adhere hydrocarbon. E. hirae F2 adhesion to hydrocarbon was determined (Vinderola & Reinheimer, 2003). Overnight grown culture was centrifuged at 6,000 rpm for 10 min at 4 °C. Cell pellet was washed and resuspended in phosphate buffer saline (pH 7.0). Absorbance of cell pellet was adjusted to 0.6 OD at 600 nm. 2.0 ml of bacterial suspension with 1.0 ml of xylene (Sigma-Aldrich, Bangalore, India) and 1.0 ml of n-hexadecane (Sigma-Aldrich, Bangalore, India) was mixed altogether by vortexing and then incubated at 37 °C for 1 h. At the end of incubation, two phases were separated. Aqueous phase was taken out and absorbance was measured at 600 nm. Percentage cell hydrophobicity was calculated by using following formula: ${\displaystyle \text{Hydrophobicity (\%)}=\frac{\left[\text{OD (initial) – OD (final)}\right]}{\left[\text{OD (initial)}\right]}\times 100.}$

Prevalence of haemolytic and gelatinase activity

Pathogenicity of E. hirae F2 was checked by haemolysis and gelatinase activity. Haemolysis activity of F2 culture was investigated on blood agar (Hi-Media, Mumbai, India) plate supplemented with 5% human blood. Overnight grown culture was streaked on the blood agar plates and incubated at 37 °C for 48 h. After incubation, plates were observed for α-haemolysis (partial hydrolysis and greenish zone), β-haemolysis (clear zone around colony) or γ-haemolysis (No reaction).

Gelatinase activity was carried out on the nutrient gelatin agar plate. Fresh culture was streaked on to the nutrient gelatin agar plate and incubated at 37 °C for 48 h. After incubation, plates were flooded with the solution of saturated ammonium sulphate. A clear zone around the colonies confirmed presence of gelatinase.

Statistical analysis

All the experiments were carried out in triplicate. The results are presented as mean values and error bars represent standard deviations (SD) of the mean values of results from three replicate experiments.

Bile salt tolerance

As a potential and possible probiotic, bacteria have to survive in the presence of bile salt in gut. Therefore, whenever probiotics is concerned, bile salt tolerance is the most important criterion for bacteria as a probiotics. Estimated concentration of bile salt in gut is between 0.2 and 2% (Gunn, 2000). In this study, bile salt tolerance of E. hirae F2 was checked from 0.2 to 2% concentration of bile salts. Results of bile salt tolerance are represented in Table 2. Results showed that E. hirae F2 was able to survive under the concentration of 0.2–1.0% of bile salts (Fig. 4). However, viability of E. hirae F2 cells were started to decrease after 120 min under 0.6% of bile salt. Under 0.8% of bile salt concentration, cell viability was started to decrease after 90 min, whereas cell viability was gradually decreased in 1.0% concentration of bile salts after 30, 60, 90 and 120 min.

Screening of Bsh and lipolytic activity

E. hirae F2 was also screened for the presence of Bsh enzyme. Growth of E. hirae F2 on MRS agar plate supplemented with DCA and GCA and the presence of precipitated bile salts around the colony with a shine confirmed that, E. hirae F2 was able to hydrolyse DCA and GCA via the production of Bsh enzyme (Fig. 1C). As a part of normal human metabolism, lipase is an essential enzyme which hydrolyse fat into small components that are readily absorbed by the intestines (Somboon, Mukkharin & Suwimon, 2015). The ability of E. hirae F2 to produce lipolytic enzyme was examined on spirit blue agar medium containing emulsified lipid with the spirit blue dye. Lipolytic activity of E. hirae F2 is shown with blue colour halos around the well indicating lipolysis i.e., metabolizing the lipid in the medium (Fig. 1D).

Acid tolerance response and survival under artificial gastrointestinal tract conditions

Due to the high acidic condition in gut, bacteria to work as a probiotics must have to survive under such kind of conditions. Therefore, after confirmation of bile salt tolerance, E. hirae F2 was further tested to prove its ability to survive/tolerate under highly acidic environment. E. hirae F2 was tested at pH 2.0, 3.0, 4.0 and 7.0 as a control. Number of E. hirae F2 cells survived after 2, 4, and 6 h of exposure at different pH of 2, 3 and 4 are presented in Fig. 5. E. hirae F2 had no viability after 6 h but shown lower viability after 2 and 4 h at pH 2. A good viability with gradually decreased number of colonies was recorded after 2, 4 and 6 h at pH 3. Whereas, good growth and viability was seen even after 6 h of incubation at pH 4. E. hirae F2 had highest viability at pH 7 and lowest viability at pH 2. Endurance of E. hirae F2 under artificial gastrointestinal tract conditions was carried out according to (Huang & Adams, 2004) with modifications with pH between 2 and 3 at 37 °C for 6 h and is presented in Fig. 6. E. hirae F2 survived under such type of conditions up to 2 h without a higher loss in cell viability. Whereas, viability started decreasing after 4 and 6 h. This result indicates that E. hirae F2 is able to survive efficiently up to 2 h under gastrointestinal tract conditions without loss in cell viability.

Potentiality test of E. hirae F2 as starter culture for yoghurt formation and identification of homo/heterofermentation

Curd formation ability of E. hirae F2 is represented in Table 3. It showed excellent curd formation after 72 h in all three kinds of milk. This test indicates that E. hirae F2 might be used as a starter culture for the production of probiotic yoghurts or other dairy products. Two tests were performed for the identification of homo/heterofermentation, production of CO₂ from glucose and streaked on fructose + bromocresol green plates. On the basis of this test E. hirae F2 was considered as a homofermentative. The results of the homo/heterofermentation behaviour of E. hirae F2 are represented in Table 4.

Antibacterial activity

Lactic acid bacteria can inhibit growth of diverse pathogenic bacteria with different mechanisms. Therefore, E. hirae F2 was studied for its antagonistic effect against several pathogenic bacteria like E. coli, S. aureus, S. typhi and Pseudomonas spp. Results of the antibacterial activity of E. hirae F2 are represented in Fig. 7 in the form of zone of inhibition. E. hirae F2 had significant antagonistic effect against all tested strains.

Antioxidative activity against DPPH

DPPH is generally used as a substrate to assess the antioxidant activity of medicinally important constituents. It is also a well-known free radical and a scavenger. DPPH has a deep purple colour in ethanolic solution and has a strong absorption at 517 nm (Sharma & Bhat, 2009). Principle of this assay is based on the changing of DPPH radical colour from purple to yellow in the presence of antioxidant component. Whenever, antioxidant molecule reacts with DPPH radicals, antioxidant molecule donates hydrogen atoms in solution, which leads to the formation of non-radical form of DPPH-H. This formation results in the scavenging of the radicals from 2,2-Diphenyl-1-picrylhydrazyl (purple colour) to diphenylpicrylhydrazine (yellow colour) (Mohammad et al., 2009). Results of the antioxidant activity of intact cells and cell free extract of E. hirae F2 are represented in the Fig. 8. However, antioxidant activity of intact cells of E. hirae F2 was higher than the supernatants (cell free extracts). Scavenging ability of intact cells against DPPH radical was 47.43% compared to 30.45% for cell free extracts (Fig. 8).

Antibiotic susceptibility test

Usually the antibiotic susceptibility test is carried out to evaluate the potentiality of particular antibiotic for the treatment of bacterial infection successfully. In the context of probiotics, antibiotic susceptibility test is carried out to find sensitivity and resistance of probiotic strain against particular antibiotics taken in to the gut. The antibiotic susceptibility profile of E. hirae F2 is shown in Table 5. The profile of the antibiotic susceptibility of E. hirae F2 indicates that strain was resistant to Ampicillin and Cephalexin. Sensitive to Gentamycin, Streptomycin, Chloramphenicol, Co-Trimoxazole and Tetracycline. Resistance of E. hirae F2 against specific antibiotic indicates that, it can be used as a probiotic at the same time when that antibiotic is present in to the gut or treatment with those antibiotics is required.

Cell surface hydrophobicity and cell aggregation assay

Cell surface hydrophobicity and cell aggregation are two important phenotypic characteristics of a potential probiotic strain (Tamang et al., 2009). In bacterial cells, variety of mechanisms plays an important role in adhesion of bacterial cells to the intestinal cells. Out of this, bacterial cell surface hydrophobicity and cell aggregation are most important. Bacterial attachment to the host cells is due to the hydrophobic surface of bacteria and the activity of aggregation. Cell surface hydrophobicity and aggregation are considered as an important factor for the maintenance of probiotic bacteria in the gastrointestinal tract of humans (Kiely & Olson, 2000). Figure 9 shows percent cell surface hydrophobicity of E. hirae F2 against xylene, n-hexadecane and cell auto aggregation. Cell surface hydrophobicity of E. hirae F2 in the presence of xylene was 38.7%, which is higher than the n-hexadecane i.e., 34.4%. Cell auto aggregation of E. hirae F2 was calculated 28.4%.

Prevalence of haemolytic and gelatinase activity

E. hirae F2 had no positive activity for haemolysis as well as for gelatinase activity which is considered as gamma-haemolysis on blood agar plate and non-pathogenic (Fig. 1F).