RNA interference as a gene silencing tool to control Tuta absoluta in tomato (Solanum lycopersicum)
- Published
- Accepted
- Subject Areas
- Agricultural Science, Molecular Biology, Plant Science
- Keywords
- Pest Control, Gene Silencing, RNAi, dsRNA delivery, Transgenic, dsRNA uptake, Micro-Tom, Tuta absoluta, Agro-infiltration
- Copyright
- © 2016 Camargo et al.
- Licence
- This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, reproduction and adaptation in any medium and for any purpose provided that it is properly attributed. For attribution, the original author(s), title, publication source (PeerJ Preprints) and either DOI or URL of the article must be cited.
- Cite this article
- 2016. RNA interference as a gene silencing tool to control Tuta absoluta in tomato (Solanum lycopersicum) PeerJ Preprints 4:e2406v1 https://doi.org/10.7287/peerj.preprints.2406v1
Abstract
RNA interference (RNAi), a gene-silencing mechanism that involves providing double-stranded RNA molecules that match a specific target gene sequence, is now widely used in functional genetic studies. The potential application of RNAi-mediated control of agricultural insect pests has rapidly become evident. The production of transgenic plants expressing dsRNA molecules that target essential insect genes could provide a means of specific gene silencing in larvae that feed on these plants, resulting in larval phenotypes that range from loss of appetite to death. In this report, we show that the tomato leafminer (Tuta absoluta), a major threat to commercial tomato production, can be targeted by RNAi. We selected two target genes [Vacuolar ATPase-A and Arginine kinase] based on the RNAi response reported for these genes in other pest species. In view of the lack of an artificial diet for T. absoluta, we used two approaches to deliver dsRNA into tomato leaflets. The first approach was based on the uptake of dsRNA by leaflets and the second was based on “in planta-induced transient gene silencing” (PITGS), a well-established method for silencing plant genes, used here for the first time to deliver in planta-transcribed dsRNA to target insect genes. Tuta absoluta larvae that fed on leaves containing dsRNA of the target genes showed an ~60% reduction in target gene transcript accumulation, an increase in larval mortality and less leaf damage. We then generated transgenic ‘Micro-Tom’ tomato plants that expressed hairpin sequences for both genes and observed a reduction in foliar damage by T. absoluta in these plants. Our results demonstrate the feasibility of RNAi as an alternative method for controlling this critical tomato pest.
Author Comment
This is a submission to PeerJ for review.
Supplemental Information
Multiple alignment of translated cloned sequences from Tuta absoluta and homologues from other insect species
For Vacuolar ATPase subunit-A: Aedes aegypti (XP_001659520.1); Drosophila melanogaster (NP_652004.2); Tribolium castaneum (XP_976188.1); Manduca sexta (P31400.1); Bombyx mori (NP_001091829.1); Tuta absoluta (KM591219). Arginine Kinase: Spodoptera litura (ADW94627.1); Helicoverpa armigera (ADD22718.1); Bombyx mori (NP_001037402.1); Tribolium castaneum (EFA11419.1); Homalodisca vitripennis (AAT01074.1); Drosophila melanogaster (AAA68172.1); Tuta absoluta (KM591220).
High magnification of the trajectory of Cy3-labeled dsRNA molecules through the tomato leaflets
Detail of various regions on the treated leaf, indicating the dsRNA distribution over leaf areas (bar = 200 μm).
Agroinfiltration experiments with Agrobacterium expressing eGFP or eGFP plus GFPi
(A) Expression of eGFP in tomato leaf infiltrated with Agrobacterium suspension containing plasmid with eGFP, visualized under a confocal fluorescent microscope. (B) Infiltration of tomato leaf with two Agrobacterium clones, expressing eGFP together with a construct expressing GFPi, indicating reduction in GFP expression visualized under confocal fluorescent microscope. (C) tomato leaf tissues at a distance away from the area infiltrated with Agrobacterium suspension containing plasmid with eGFP (bar = 100 μm).
RNAi effects on larval development.
Tuta absoluta individuals after feeding for 11 days in tomato leaflets, after absorbing 500 ng dsRNA of the GFP control (a) and the target genes V-ATPase (b) or AK (c). Total amount of individuals at pupal stage, resultant from the larvae feeding on GFP control (d) and the target genes V-ATPase (e) or AK (f)
Amplification detection of expressed sequences (cDNA; siRNA and microRNA) from various transgenic events
(A) Detection of amplification products from cDNA (RT-PCR) extracted from various transgenic ‘Micro-tom’ events and non-transformed control (WT) using primers specific for insect V-ATPase (top panel; 139 bp) or AK (bottom panel;190 bp), and tomato ubiquitin (108 bp). (B). Detection of amplification products derived from stem loop pulsed RT-PCR for potential siRNA derived from target genes (V-ATPase or AK, both 60 bp), plus the microRNA156 (MIR156; 60 bp) control ran at 3% agarose gel electrophoresis. Numbers represent events (1st number) or plants within events (2nd number).
List of degenerated primers
Degenerated primers used to amplify and clone respective candidate gene targets for RNAi, with expected amplicon size for each reaction. Numbers refer to primer order used in amplification reactions.
List of primers for Gateway construct
Primers used to amplify target gene fragments with Gateway recombination borders attL1 and attL2 (underlined), with expected amplicon size (bp).
Summary of three transformation experiments using construct containing repetitive and inverted gene fragments
Specific primers designed for transcriptional analysis of gene-targets for silencing, with expected amplicon size in base pairs
List of primers to detect siRNA in transgenic plants
Gene-specific and the universal primer sequences used to detect the predicted small interfering RNAs (siRNA) derived from the target genes V-ATPase (siRNA AATACATGCGCGCTCTAGATGAC) and AK (siRNA AAGTATCGTCCACACTGTCTGGC) and the control microRNA156 (UGACAGAAGAGAGUGAGCAC) in transgenic plants.