The Risk of Exposure to Ticks and Tick-Borne Pathogens in a Spa Town in Northern Poland
Abstract
:1. Introduction
2. Results
2.1. Identified Tick Species
2.2. Prevalence and Diversity of Pathogens
2.2.1. Borrelia spp.
2.2.2. Babesia spp.
2.2.3. Rickettsia spp.
2.2.4. Borrelia spp., Babesia spp. and Rickettsia spp. Co-Infections
3. Discussion
4. Materials and Methods
4.1. Study Area and Tick Collection
4.2. DNA Extraction
4.3. Pathogenic DNA Detection
4.4. Identification of Pathogen Species
4.5. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Rubel, F.; Brugger, K.; Pfeffer, M.; Chitimia-Dobler, L.; Didyk, Y.M.; Leverenz, S.; Dautel, H.; Kahl, O. Geographical distribution of Dermacentor marginatus and Dermacentor reticulatus in Europe. Ticks Tick-Borne Dis. 2016, 7, 224–233. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Medlock, J.M.; Hansford, K.M.; Bormane, A.; Derdakova, M.; Estrada-Peña, A.; George, J.C.; Golovljova, I.; Jaenson, T.G.; Jensen, J.K.; Jensen, P.M.; et al. Driving forces for changes in geographical distribution of Ixodes ricinus ticks in Europe. Parasites Vectors 2013, 6, 1. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ruzek, D.; Avšič Županc, T.; Borde, J.; Chrdle, A.; Eyer, L.; Karganova, G.; Kholodilov, I.; Knap, N.; Kozlovskaya, L.; Matveev, A.; et al. Tick-borne encephalitis in Europe and Russia: Review of pathogenesis, clinical features, therapy, and vaccines. Antivir. Res. 2019, 164, 23–51. [Google Scholar] [CrossRef] [PubMed]
- Strnad, M.; Hönig, V.; Růžek, D.; Grubhoffer, L.; Rego, R.O.M. Europe-wide meta-analysis of Borrelia burgdorferi sensu lato prevalence in questing Ixodes ricinus ticks. Appl. Environ. Microbiol. 2017, 83, e0069-17. [Google Scholar] [CrossRef] [Green Version]
- Moniuszko-Malinowska, A.; Dunaj, J.; Andersson, M.O.; Chmielewski, T.; Czupryna, P.; Groth, M.; Grygorczuk, S.; Zajkowska, J.; Kondrusik, M.; Kruszewska, E.; et al. Anaplasmosis in Poland—Analysis of 120 patients. Ticks Tick-Borne Dis. 2021, 12, 101763. [Google Scholar] [CrossRef]
- Adamska, M. The role of different species of wild ungulates and Ixodes ricinus ticks in the circulation of genetic variants of Anaplasma phagocytophilum in a forest biotope in north-western Poland. Ticks Tick-Borne Dis. 2020, 11, 101465. [Google Scholar] [CrossRef]
- Piotrowski, M.; Rymaszewska, A. Expansion of tick-borne rickettsioses in the world. Microorganisms 2020, 8, 1906. [Google Scholar] [CrossRef]
- Hildebrandt, A.; Zintl, A.; Montero, E.; Hunfeld, K.P.; Gray, J. Human babesiosis in Europe. Pathogens 2021, 10, 1165. [Google Scholar] [CrossRef]
- Földvári, G.; Široký, P.; Szekeres, S.; Majoros, G.; Sprong, H. Dermacentor reticulatus: A vector on the rise. Parasites Vectors 2016, 9, 314. [Google Scholar] [CrossRef] [Green Version]
- Mierzejewska, E.J.; Pawełczyk, A.; Radkowski, M.; Welc-Falęciak, R.; Bajer, A. Pathogens vectored by the tick, Dermacentor reticulatus, in endemic regions and zones of expansion in Poland. Parasites Vectors 2015, 8, 490. [Google Scholar] [CrossRef] [Green Version]
- NIH-PZH. Infectious Diseases and Poisonings in Poland. Available online: http://www.pzh.gov.pl/oldpage/epimeld/index_p.htm (accessed on 1 March 2022).
- Borawski, K.; Dunaj, J.; Czupryna, P.; Pancewicz, S.; Świerzbińska, R.; Żebrowska, A.; Moniuszko-Malinowska, A. Prevalence of spotted fever group Rickettsia in north-eastern Poland. Infect. Dis. 2019, 51, 810–814. [Google Scholar] [CrossRef] [PubMed]
- Welc-Falęciak, R.; Pawełczyk, A.; Radkowski, M.; Pancewicz, S.A.; Zajkowska, J.; Siński, E. First report of two asymptomatic cases of human infection with Babesia microti (Franca, 1910) in Poland. Ann. Agric. Environ. Med. 2015, 22, 51–54. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hansford, K.M.; Wheeler, B.W.; Tschirren, B.; Medlock, J.M. Questing Ixodes ricinus ticks and Borrelia spp. in urban green space across Europe: A review. Zoonoses Public Health 2022, 69, 153–166. [Google Scholar] [CrossRef] [PubMed]
- Kubiak, K.; Dziekońska-Rynko, J.; Szymańska, H.; Kubiak, D.; Dmitryjuk, M.; Dzika, E. Questing Ixodes ricinus ticks (Acari, Ixodidae) as a vector of Borrelia burgdorferi sensu lato and Borrelia miyamotoi in an urban area of north-eastern Poland. Exp. Appl. Acarol. 2019, 78, 113–126. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kowalec, M.; Szewczyk, T.; Welc-Falęciak, R.; Siński, E.; Karbowiak, G.; Bajer, A. Ticks and the city—Are there any differences between city parks and natural forests in terms of tick abundance and prevalence of spirochaetes? Parasites Vectors 2017, 10, 573. [Google Scholar] [CrossRef]
- Rizzoli, A.; Silaghi, C.; Obiegala, A.; Rudolf, I.; Hubálek, Z.; Földvári, G.; Plantard, O.; Vayssier-Taussat, M.; Bonnet, S.; Špitalská, E.; et al. Ixodes ricinus and its transmitted pathogens in urban and peri-urban areas in Europe: New hazards and relevance for public health. Front. Public Health 2014, 2, 251. [Google Scholar] [CrossRef]
- Estrada-Peña, A.; De La Fuente, J. The ecology of ticks and epidemiology of tick-borne viral diseases. Antivir. Res. 2014, 108, 104–128. [Google Scholar] [CrossRef]
- Hansford, K.M.; Wheeler, B.W.; Tshirren, B.; Medlock, J.M. Urban woodland habitat is important for tick presence and density in a city in England. Ticks Tick-Borne Dis. 2022, 13, 101857. [Google Scholar] [CrossRef]
- Hansford, K.M.; Fonville, M.; Gillingham, E.L.; Coipan, E.C.; Pietzsch, M.E.; Krawczyk, A.I.; Vaux, A.G.C.; Cull, B.; Sprong, H.; Medlock, J.M. Ticks and Borrelia in urban and peri-urban green space habitats in a city in southern England. Ticks Tick-Borne Dis. 2017, 8, 353–361. [Google Scholar] [CrossRef]
- Uspensky, I. Tick pests and vectors (Acari: Ixodoidea) in European towns: Introduction, persistence and management. Ticks Tick-Borne Dis. 2014, 5, 41–47. [Google Scholar] [CrossRef]
- Dobson, A.D.M.; Taylor, J.L.; Randolph, S.E. Tick (Ixodes ricinus) abundance and seasonality at recreational sites in the UK: Hazards in relation to fine-scale habitat types revealed by complementary sampling methods. Ticks Tick-Borne Dis. 2011, 2, 67–74. [Google Scholar] [CrossRef] [PubMed]
- Kubiak, K.; Dziekońska-Rynko, J. seasonal activity of the common European tick, Ixodes ricinus (Linnaeus, 1758), in the forested areas of the city of Olsztyn and its surroundings. Wiadomości Parazytol. 2006, 52, 59–64. [Google Scholar]
- Audino, T.; Pautasso, A.; Bellavia, V.; Carta, V.; Ferrari, A.; Verna, F.; Grattarola, C.; Iulini, B.; Pintore, M.D.; Bardelli, M.; et al. ticks infesting humans and associated pathogens: A cross-sectional study in a 3-year period (2017–2019) in northwest Italy. Parasites Vectors 2021, 14, 136. [Google Scholar] [CrossRef] [PubMed]
- Pawełczyk, A.; Bednarska, M.; Hamera, A.; Religa, E.; Poryszewska, M.; Mierzejewska, E.J.; Welc-Falęciak, R. Long-term study of Borrelia and Babesia prevalence and co-infection in Ixodes ricinus and Dermacentor recticulatus ticks removed from humans in Poland, 2016–2019. Parasites Vectors 2021, 14, 348. [Google Scholar] [CrossRef]
- Lernout, T.; De Regge, N.; Tersago, K.; Fonville, M.; Suin, V.; Sprong, H. Prevalence of pathogens in ticks collected from humans through citizen science in Belgium. Parasites Vectors 2019, 12, 550. [Google Scholar] [CrossRef]
- Strnad, M.; Rego, R.O.M. The need to unravel the twisted nature of the Borrelia burgdorferi sensu lato complex across Europe. Microbiology 2020, 166, 428–435. [Google Scholar] [CrossRef]
- Michalski, M.M.; Kubiak, K.; Szczotko, M.; Dmitryjuk, M. Tick-borne pathogens in ticks collected from wild ungulates in north-eastern Poland. Pathogens 2021, 10, 587. [Google Scholar] [CrossRef]
- Michalski, M.M.; Kubiak, K.; Szczotko, M.; Chajęcka, M.; Dmitryjuk, M. Molecular detection of Borrelia burgdorferi sensu lato and Anaplasma phagocytophilum in ticks collected from dogs in urban areas of north-eastern Poland. Pathogens 2020, 9, 455. [Google Scholar] [CrossRef]
- Zając, V.; Wójcik-Fatla, A.; Sawczyn, A.; Cisak, E.; Sroka, J.; Kloc, A.; Zając, Z.; Buczek, A.; Dutkiewicz, J.; Bartosik, K. Prevalence of infections and co-infections with 6 pathogens in Dermacentor reticulatus ticks collected in eastern Poland. Ann. Agric. Environ. Med. 2017, 24, 26–32. [Google Scholar] [CrossRef]
- Asman, M.; Witecka, J.; Korbecki, J.; Solarz, K. The potential risk of exposure to Borrelia garinii, Anaplasma phagocytophilum and Babesia microti in the Wolinski National Park (north-western Poland). Sci. Rep. 2021, 11, 4860. [Google Scholar] [CrossRef]
- Karbowiak, G.; Biernat, B.; Stańczak, J.; Werszko, J.; Szewczyk, T.; Sytykiewicz, H. The role of particular ticks developmental stages in the circulation of tick-borne pathogens in central Europe. 5. Borreliaceae. Ann. Parasitol. 2018, 64, 151–171. [Google Scholar] [CrossRef] [PubMed]
- Didyk, Y.M.; Blaňárová, L.; Pogrebnyak, S.; Akimov, I.; Peťko, B.; Víchová, B. Emergence of tick-borne pathogens (Borrelia burgdorferi sensu lato, Anaplasma phagocytophilum, Ricketsia raoultii and Babesia microti) in the Kyiv urban parks, Ukraine. Ticks Tick-Borne Dis. 2017, 8, 219–225. [Google Scholar] [CrossRef] [PubMed]
- Reye, A.L.; Hübschen, J.M.; Sausy, A.; Muller, C.P. Prevalence and seasonality of tick-borne pathogens in questing Ixodes ricinus ticks from Luxembourg. Appl. Environ. Microbiol. 2010, 76, 2923–2931. [Google Scholar] [CrossRef] [Green Version]
- Tappe, J.; Jordan, D.; Janecek, E.; Fingerle, V.; Strube, C. Revisited: Borrelia burgdorferi sensu lato infections in hard ticks (Ixodes ricinus) in the city of Hanover (Germany). Parasites Vectors 2014, 7, 441. [Google Scholar] [CrossRef] [Green Version]
- May, K.; Jordan, D.; Fingerle, V.; Strube, C. Borrelia burgdorferi sensu lato and co-infections with Anaplasma phagocytophilum and Rickettsia spp. in Ixodes ricinus in Hamburg, Germany. Med. Vet. Entomol. 2015, 29, 425–429. [Google Scholar] [CrossRef]
- Stańczak, J. Detection of spotted fever group (SFG) Rickettsiae in Dermacentor reticulatus (Acari: Ixodidae) in Poland. Int. J. Med. Microbiol. 2006, 296, 144–148. [Google Scholar] [CrossRef]
- Stańczak, J.; Biernat, B.; Racewicz, M.; Zalewska, M.; Matyjasek, A. Prevalence of different Rickettsia spp. in Ixodes ricinus and Dermacentor reticulatus ticks (Acari: Ixodidae) in north-eastern Poland. Ticks Tick-Borne Dis. 2018, 9, 427–434. [Google Scholar] [CrossRef] [PubMed]
- Biernat, B.; Stańczak, J.; Michalik, J.; Sikora, B.; Wierzbicka, A. Prevalence of infection with Rickettsia helvetica in Ixodes ricinus ticks feeding on non-rickettsiemic rodent hosts in sylvatic habitats of west-central Poland. Ticks Tick-Borne Dis. 2016, 7, 135–141. [Google Scholar] [CrossRef]
- Răileanu, C.; Tauchmann, O.; Silaghi, C. Sympatric occurrence of Ixodes ricinus with Dermacentor reticulatus and Haemaphysalis concinna and the associated tick-borne pathogens near the German Baltic Coast. Parasites Vectors 2022, 15, 65. [Google Scholar] [CrossRef]
- Obiegala, A.; Król, N.; Oltersdorf, C.; Nader, J.; Pfeffer, M. The Enzootic life-cycle of Borrelia burgdorferi (sensu lato) and tick-borne Rickettsiae: An epidemiological study on wild-living small mammals and their ticks from Saxony, Germany. Parasites Vectors 2017, 10, 115. [Google Scholar] [CrossRef] [Green Version]
- Stanko, M.; Derdáková, M.; Špitalská, E.; Kazimírová, M. Ticks and Their epidemiological role in Slovakia: From the past till present. Biologia 2021, 17, 1–36. [Google Scholar] [CrossRef] [PubMed]
- Kowalec, M.; Szewczyk, T.; Welc-Falęciak, R.; Siński, E.; Karbowiak, G.; Bajer, A. Rickettsiales occurrence and co-occurrence in Ixodes ricinus ticks in natural and urban areas. Microb. Ecol. 2019, 77, 890–904. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kirczuk, L.; Piotrowski, M.; Rymaszewska, A. Detection of tick-borne pathogens of the genera Rickettsia, Anaplasma and Francisella in Ixodes ricinus ticks in Pomerania (Poland). Pathogens 2021, 10, 901. [Google Scholar] [CrossRef] [PubMed]
- Welc-Falęciak, R.; Kowalec, M.; Karbowiak, G.; Bajer, A.; Behnke, J.M.; Siński, E. Rickettsiaceae and Anaplasmataceae infections in Ixodes ricinus ticks from urban and natural forested areas of Poland. Parasites Vectors 2014, 7, 121. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Matei, I.A.; Estrada-Peña, A.; Cutler, S.J.; Vayssier-Taussat, M.; Varela-Castro, L.; Potkonjak, A.; Zeller, H.; Mihalca, A.D. A Review on the eco-epidemiology and clinical management of human granulocytic anaplasmosis and its agent in Europe. Parasites Vectors 2019, 12, 1–19. [Google Scholar] [CrossRef] [PubMed]
- Dunaj, J.; Moniuszko-Malinowska, A.; Swiecicka, I.; Andersson, M.; Czupryna, P.; Rutkowski, K.; Zambrowski, G.; Zajkowska, J.; Grygorczuk, S.; Kondrusik, M.; et al. Tick-borne infections and co-infections in patients with non-specific symptoms in Poland: Tick-borne infections and co-infections. Adv. Med. Sci. 2018, 63, 167–172. [Google Scholar] [CrossRef] [PubMed]
- Karshima, S.N.; Ahmed, M.I.; Kogi, C.A.; Iliya, P.S. Anaplasma phagocytophilum infection rates in questing and host-attached ticks: A global systematic review and meta-analysis. Acta Trop. 2022, 228, 106299. [Google Scholar] [CrossRef]
- Bajer, A.; Dwużnik-Szarek, D. The Specificity of Babesia-tick vector interactions: Recent advances and pitfalls in molecular and field studies. Parasites Vectors 2021, 14, 507. [Google Scholar] [CrossRef]
- Herwaldt, B.L.; Cacciò, S.; Gherlinzoni, F.; Aspöck, H.; Slemenda, S.B.; Piccaluga, P.P.; Martinelli, G.; Edelhofer, R.; Hollenstein, U.; Poletti, G.; et al. Molecular characterization of a non-Babesia divergens organism causing zoonotic babesiosis in Europe. Emerg. Infect. Dis. 2003, 9, 942–948. [Google Scholar] [CrossRef]
- Cieniuch, S.; Stańczak, J.; Ruczaj, A. The first detection of Babesia EU1 and Babesia canis canis in Ixodes ricinus Ticks (Acari, Ixodidae) collected in urban and rural areas in northern Poland. Pol. J. Microbiol. 2009, 58, 231–236. [Google Scholar]
- Wójcik-Fatla, A.; Zając, V.; Sawczyn, A.; Cisak, E.; Dutkiewicz, J. Babesia spp. in questing ticks from eastern Poland: Prevalence and species diversity. Parasitol. Res. 2015, 114, 3111–3116. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liberska, J.; Michalik, J.; Pers-Kamczyc, E.; Wierzbicka, A.; Lane, R.S.; Rączka, G.; Opalińska, P.; Skorupski, M.; Dabert, M. Prevalence of Babesia canis DNA in Ixodes ricinus ticks collected in forest and urban ecosystems in west-central Poland. Ticks Tick-Borne Dis. 2021, 12, 101786. [Google Scholar] [CrossRef] [PubMed]
- Radzijevskaja, J.; Mardosaite-Busaitiene, D.; Aleksandravičiene, A.; Paulauskas, A. Investigation of Babesia spp. in sympatric populations of Dermacentor reticulatus and Ixodes ricinus ticks in Lithuania and Latvia. Ticks Tick-Borne Dis. 2019, 9, 270–274. [Google Scholar] [CrossRef] [PubMed]
- Andersson, M.O.; Bergvall, U.A.; Chirico, J.; Christensson, M.; Lindgren, P.E.; Nordström, J.; Kjellander, P. Molecular detection of Babesia capreoli and Babesia venatorum in wild Swedish roe deer, Capreolus capreolus. Parasites Vectors 2016, 9, 221. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Stensvold, C.R.; Al Marai, D.; Andersen, L.O.B.; Krogfelt, K.A.; Jensen, J.S.; Larsen, K.S.; Nielsen, H.V. Babesia spp. and other pathogens in ticks recovered from domestic dogs in Denmark. Parasites Vectors 2015, 8, 262. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Stańczak, J.; Cieniuch, S.; Lass, A.; Biernat, B.; Racewicz, M. Detection and quantification of Anaplasma phagocytophilum and Babesia spp. in Ixodes ricinus ticks from urban and rural environment, northern Poland, by Real-Time Polymerase Chain Reaction. Exp. Appl. Acarol. 2015, 66, 63–81. [Google Scholar] [CrossRef] [Green Version]
- Rybarova, M.; Honsova, M.; Papousek, I.; Siroky, P. Variability of Species of Babesia starcovici, 1893 in three sympatric ticks (Ixodes ricinus, Dermacentor reticulatus and Haemaphysalis concinna) at the edge of Pannonia in the Czech Republic and Slovakia. Folia Parasitol. 2017, 64, 28. [Google Scholar] [CrossRef]
- Hamšíková, Z.; Coipan, C.; Mahríková, L.; Minichová, L.; Sprong, H.; Kazimírová, M. Borrelia miyamotoi and co-infection with Borrelia afzelii in Ixodes ricinus ticks and rodents from Slovakia. Microb. Ecol. 2017, 73, 1000–1008. [Google Scholar] [CrossRef]
- Dwużnik, D.; Mierzejewska, E.J.; Drabik, P.; Kloch, A.; Alsarraf, M.; Behnke, J.M.; Bajer, A. The role of juvenile Dermacentor reticulatus ticks as vectors of microorganisms and the problem of ‘meal contamination’. Exp. Appl. Acarol. 2019, 78, 181–202. [Google Scholar] [CrossRef] [Green Version]
- Moutailler, S.; Valiente Moro, C.; Vaumourin, E.; Michelet, L.; Tran, F.H.; Devillers, E.; Cosson, J.-F.; Gasqui, P.; Van, V.T.; Mavingui, P.; et al. Co-infection of ticks: The rule rather than the exception. PLoS Negl. Trop. Dis. 2016, 10, e0004539. [Google Scholar] [CrossRef] [Green Version]
- Bermúdez, C.S.; Greco-Mastelari, V.; Zaldívar, Y.; Hernández, M.; Domínguez, A.L.; Montenegro, H.V.M.; Venzal, J.M. Description of human infestations by ticks in Panama and Costa Rica. Microbes Infect. Chemother. 2021, 1, e1241. [Google Scholar] [CrossRef]
- Nowak-Chmura, M. Fauna Kleszczy (Ixodida) Europy Środkowej; Wydawnictwo Naukowe Uniwersytetu Pedagogicznego: Kraków, Poland, 2013. [Google Scholar]
- Siuda, K. Ticks (Acari: Ixodida) of Poland. Part II: Taxonomy and Distribution; Polskie Towarzystwo Parazytologiczne: Warszawa, Poland, 1993. [Google Scholar]
- Demaerschalck, I.; Ben Messaoud, A.; De Kesel, M.; Hoyois, B.; Lobet, Y.; Hoet, P.; Bigaignon, G.; Bollen, A.; Godfroid, E. Simultaneous presence of different Borrelia burgdorferi genospecies in biological fluids of Lyme disease patients. J. Clin. Microbiol. 1995, 33, 602–608. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Strzelczyk, J.K.; Gaździcka, J.; Cuber, P.; Asman, M.; Trapp, G.; Gołąbek, K.; Zalewska-Ziob, M.; Nowak-Chmura, M.; Siuda, K.; Wiczkowski, A.; et al. Prevalence of Borrelia burgdorferi sensu lato in Ixodes ricinus ticks collected from southern Poland. Acta Parasitol. 2015, 60, 666–674. [Google Scholar] [CrossRef] [PubMed]
- Pancholi, P.; Kolbert, C.P.; Mitchell, P.D.; Reed, K.D.; Dumler, J.S.; Bakken, J.S.; Telford, S.R.; Persing, D.H. Ixodes dammini as a potential vector of human granulocytic ehrlichiosis. J. Infect. Dis. 1995, 172, 1007–1012. [Google Scholar] [CrossRef] [PubMed]
- Casati, S.; Sager, H.; Gern, L.; Piffaretti, J.C. Presence of potentially pathogenic Babesia sp. for human in Ixodes ricinus in Switzerland. Ann. Agric. Environ. Med. 2006, 13, 65–70. [Google Scholar]
- Roux, V.; Rydkina, E.; Eremeeva, M.; Raoult, D. Citrate synthase gene comparison, a new tool for phylogenetic analysis, and its application for the Rickettsiae. Int. J. Syst. Bacteriol. 1997, 47, 252–261. [Google Scholar] [CrossRef] [Green Version]
Tick Species and Developmental Stage | No. of Tested Ticks | No. of Infected Ticks n/% (95% CI) | |||||||
---|---|---|---|---|---|---|---|---|---|
Borrelia | Babesia | Rickettsia | Anaplasma | ||||||
I. ricinus | F | 51 | 11/21.6 | p = 0.419 * | 4/7.8 | p = 0.003 * | 4/7.8 | p = 0.456 * | 0/0 |
(11.3–35.3) | (2.2–18.9) | (2.2–18.9) | |||||||
M | 39 | 9/23.1 | 0/0 | 6/15.4 | 0/0 | ||||
(11.1–39.3) | (5.9–30.5) | ||||||||
N | 14 | 1/7.1 | 4/28.6 | 1/7.1 | 0/0 | ||||
(0.2–33.9) | (8.4–58.1) | (0.2–33.9) | |||||||
Subtotal | 104 | 21/20.2 | 8/7.7 | 11/10.6 | 0/0 | ||||
(13.0–29.2) | (3.4–14.6) | (5.4–18.1) | |||||||
D. reticulatus | F | 24 | 0/0 | 3/12.5 | p = 0.213 * | 11/45.8 | p = 0.288 * | 0/0 | |
(2.7–32.4) | (25.6–67.2) | ||||||||
M | 13 | 0/0 | 4/30.8 | 3/23.1 | 0/0 | ||||
(9.1–61.4) | (5.0–53.8) | ||||||||
Subtotal | 37 | 0/0 | 7/18.9 | 14/37.8 | 0/0 | ||||
(8.0–35.2) | (22.5–55.2) | ||||||||
p = 0.003 * | p = 0.057 * | p < 0.001 * |
Pathogen Species | I. ricinus (n/%) | D. reticulatus (n/%) | |
---|---|---|---|
Borrelia * | B. afzelii | 11/52.4 | 0/0 |
B. garinii | 8/42.1 | 0/0 | |
B. afzelii/B. garinii | 1/4.8 | 0/0 | |
B. afzelii/B. burgdorferi s.s. | 1/4.8 | 0/0 | |
Babesia ** | B. venatorum | 1/14.3 | 1/33.3 |
B. canis | 6/85.7 | 1/33.3 | |
B. microti | 0/0 | 1/33.3 | |
Rickettsia *** | R. helvetica | 7/100 | 0/0 |
R. raoultii | 0/0 | 8/100 |
Tick Species | Tick Stage | No. of Specimens | Pathogen Species |
---|---|---|---|
I. ricinus | F | 1 | Borrelia afzelii/Babesia canis |
F | 1 | Borrelia afzelii/Borrelia garinii/Rickettsia helvatica | |
M | 1 | Borrelia afzelii/Borrelia burgdorferi s.s./Rickettsia helvatica | |
N | 1 | Babesia venetorum/Rickettsia helvatica | |
D. reliculatus | F | 2 | Babesia spp./Rickettsia raoultii |
M | 1 | Babesia spp./Rickettsia spp. |
Pathogen | Primer Name | Primer sequence 5′–3′ | Product Size [bp] | Gene Target | Reference |
---|---|---|---|---|---|
Borrelia spp. | SL1 | AATAGGTCTAATAATAGCCTTAATAGC | 307 | ospA1 | [65] |
SL2 | CTAGTGTTTTGCCATCTTCTTTGAAAA | ||||
BFL1 | GCTCAATATAACCAAATGCACATG | 422 | flab2 | [66] | |
BFL2 | CAAGTCTATTTTGGAAAGCACCTAA | ||||
A. phagocytophilum | EHR521 | TGTAGGCGGTTCGGTAAGTTAAAG | 247 | 16S rRNA | [67] |
EHR747 | GCACTCATCGTTTACAGCGTG | ||||
Babesia spp. | BJ1 | GTCTTGTAATTGGAATGATGG | ~490 | 18S rRNA | [68] |
BN2 | TAGTTTATGGTTAGGACTACG | ||||
Rickettsia spp. | CS409 | CCTATGGCTATTATGCTTGC | 769 | gltA3 | [69] |
Rp1258 | ATTGCAAAAAGTACAGTGAACA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kubiak, K.; Dmitryjuk, M.; Dziekońska-Rynko, J.; Siejwa, P.; Dzika, E. The Risk of Exposure to Ticks and Tick-Borne Pathogens in a Spa Town in Northern Poland. Pathogens 2022, 11, 542. https://doi.org/10.3390/pathogens11050542
Kubiak K, Dmitryjuk M, Dziekońska-Rynko J, Siejwa P, Dzika E. The Risk of Exposure to Ticks and Tick-Borne Pathogens in a Spa Town in Northern Poland. Pathogens. 2022; 11(5):542. https://doi.org/10.3390/pathogens11050542
Chicago/Turabian StyleKubiak, Katarzyna, Małgorzata Dmitryjuk, Janina Dziekońska-Rynko, Patryk Siejwa, and Ewa Dzika. 2022. "The Risk of Exposure to Ticks and Tick-Borne Pathogens in a Spa Town in Northern Poland" Pathogens 11, no. 5: 542. https://doi.org/10.3390/pathogens11050542