Next Article in Journal
Horizontal and Vertical Comparison of Microbial Community Structures in a Low Permeability Reservoir at the Local Scale
Next Article in Special Issue
Identification of Fungicide Combinations for Overcoming Plasmopara viticola and Botrytis cinerea Fungicide Resistance
Previous Article in Journal
Arsenic Removal via the Biomineralization of Iron-Oxidizing Bacteria Pseudarthrobacter sp. Fe7
Previous Article in Special Issue
Molecular Characterization of Ciborinia camelliae Kohn Shows Intraspecific Variability and Suggests Transcontinental Movement of the Pathogen
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Microorganisms
Volume 11
Issue 12
10.3390/microorganisms11122861
microorganisms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The SIX5 Protein in Fusarium oxysporum f. sp. cepae Acts as an Avirulence Effector toward Shallot (Allium cepa L. Aggregatum Group)

by
Kosei Sakane
1,
Masaaki Kunimoto
2,
Kazuki Furumoto
2,
Masayoshi Shigyo
2,
Kazunori Sasaki
2,3,* and
Shin-ichi Ito
2,3,*
1
The United Graduate School of Agricultural Sciences, Tottori University, Tottori 680-8553, Japan
2
Graduate School of Sciences and Technology for Innovation, Yamaguchi University, Yamaguchi 753-8515, Japan
3
Research Center for Thermotolerant Microbial Resources (RCTMR), Yamaguchi University, Yamaguchi 753-8515, Japan
*
Authors to whom correspondence should be addressed.
Microorganisms 2023, 11(12), 2861; https://doi.org/10.3390/microorganisms11122861
Submission received: 27 September 2023 / Revised: 22 November 2023 / Accepted: 24 November 2023 / Published: 26 November 2023
(This article belongs to the Special Issue Plant-Pathogenic Fungi)
Browse Figures
Versions Notes

Abstract

:
Fusarium oxysporum f. sp. cepae (Foc) causes basal rot disease in Allium species, including onions (Allium cepa L.) and shallots (A. cepa L. Aggregatum group). Among Allium species, shallots can be crossbred with onions and are relatively more resistant to Foc than onions. Thus, shallots are considered a potential disease-resistant resource for onions. However, the mechanisms underlying the molecular interactions between shallots and Foc remain unclear. This study demonstrated that SIX5, an effector derived from Foc (FocSIX5), acts as an avirulence effector in shallots. We achieved this by generating a FocSIX5 gene knockout mutant in Foc, for which experiments which revealed that it caused more severe wilt symptoms in Foc-resistant shallots than the wild-type Foc and FocSIX5 gene complementation mutants. Moreover, we demonstrated that a single amino acid substitution (R67K) in FocSIX5 was insufficient to overcome shallot resistance to Foc.

1. Introduction

The Fusarium oxysporum species complex is a ubiquitous, soil-borne, and plant-pathogenic fungus with a wide host range comprising more than 120 species. Therefore, it has recently been recognized as the fifth most important plant pathogen [1,2]. Based on host specificity, F. oxysporum species are generally distinguished as “formae speciales” [3,4], among which F. oxysporum f. sp. cepae (Foc) has been identified as the causative agent of Fusarium basal rot in onions (Allium cepa L.). Globally, onion production is threatened by Foc [5,6,7,8]. Hence, understanding plant defense systems against Foc and Foc-infective mechanisms is important for achieving sustainable onion production. Moreover, durable genetic resources are desirable for breeding disease-resistant onions.
Shallot (A. cepa L. Aggregatum group) is an annual herbaceous plant belonging to the family Amaryllidaceae, which is widely used as a condiment in Southeast Asian countries. It contains antimicrobial compounds [9,10] and is highly resistant to pathogens, including F. oxysporum [11,12]. Shallots are genomically compatible and can be crossbred with onion plants [13]. Therefore, shallots are considered a versatile breeding resource for onions [14].
Plants have evolved multilayered barrier systems to protect themselves against pathogens. Plants recognize pathogen-associated molecular patterns (PAMPs) using plant cell-surface-localized pattern-recognition receptors (PRR) to induce pattern-triggered immunity (PTI). To impede the PTI response, pathogens secrete proteins with signal peptide motifs that translocate into the host tissue to manipulate the PTI response, known as effector-triggered susceptibility (ETS) [15,16]. Subsequently, plants recognize pathogenic effector molecules using resistance proteins to trigger a robust immune response called effector-triggered immunity (ETI) [17]. In F. oxysporum, the genetic concept of F. oxysporum is well characterized in tomato plants and F. oxysporum f. sp. lycopersici (Fol). Reportedly, Fol secretes the SIX (secreted in the xylem) effector protein into the xylem to facilitate colonization during infection. To date, 14 SIX proteins have been identified in Fol-infecting tomato xylem sap [18,19], of which SIX1(AVR3), SIX3 (AVR2), SIX5, and SIX6 are required for the virulence of tomato plants. Conversely, SIX1(AVR3), SIX3 (AVR2)-SIX5, and SIX4 (AVR1) are avirulence effectors that activate the immunity of tomato plants, mediated by I-3 (SRLK-type), I-2 (CC-type), and I genes, respectively [20,21,22,23,24,25]. These resistance genes have been introduced into commercial tomato cultivars for stable and effective production [26]. However, Fol adopts several strategies to evade the tomato immune system. The Fol race 2 strain completely lost the SIX4 (AVR1) gene to avoid the I gene-derived immunity [27], whereas the Fol race 3 strain had a single amino acid substitution in its SIX3 (AVR2) sequence to escape I-2-derived immunity [22].
In the Foc genome, the sequences of a few SIX genes (SIX3, SIX5, SIX7, SIX9, SIX10, SIX12, and SIX14) are conserved [8,28]. Among these SIX genes, SIX5 (FocSIX5) is the most highly upregulated during Foc infection in onions [28]; however, its virulence in Foc has not yet been elucidated. In this study, we generated FocSIX5 gene-modified mutants of Foc and conducted pathogenicity tests on both Foc-susceptible onions and Foc-resistant shallots using FocSIX5 gene-modified mutants to investigate the function of FocSIX5.

2. Materials and Methods

2.1. Plant Material and Fungal Strain

Shallots (A. cepa L. Aggregatum group) cv. Chiang Mai (SAMD00027216) [13] and onion cultivars “Kitamomiji 2000” (Shippou Co., Ltd., Kagawa, Japan) and “Tarzan” (Shippou Co., Ltd.) were used for this study. The Foc_TA isolate from the fungal strain F. oxysporum f. sp. cepae (Foc) was collected from a diseased onion bulb in Hokkaido, Japan [6].

2.2. Pathogenicity Test toward Onion and Shallot Plants

For the pathogenicity test on onion bulbs, onion cv. “Kitamomiji 2000” was used as the host. Foc_TA was grown on potato dextrose agar (PDA) medium, and the medium was incubated in a growth chamber with a temperature of 25 °C for 5 d. Onion bulbs were surface-sterilized with 0.05% NaOCl for 3 min; then, the central basal part of the sterilized onion bulbs was hollowed out with a 5 mm cork borer. The edge of the colony was then hollowed out with the 5 mm cork borer and embedded in the hollowed basal part of the sterilized onion bulbs. A plane PDA medium plug was embedded in the basal tissue of the hollowed-out onion as a control. The inoculated onion bulb was placed inside a plastic bag with a wet paper towel and incubated in a temperature-controlled room with a temperature of 25 °C. After 4 weeks, the symptoms of the inoculated onion bulb were observed. The symptomatic areas, including mycelia and brown discoloration, were manually captured and estimated from the photographs using ImageJ1 software [29]. All the tests were conducted with at least three samples per iteration. All experiments were repeated at least twice.
For the pathogenicity test of shallot and onion seedlings, shallot cv. Chiang Mai [13] and onion cv. “Tarzan” were used. Fungal isolates were cultured in potato dextrose broth for seven days in a growth chamber with a temperature of 25 °C, with shaking at 120 rpm, and the cultures were filtered through three layers of sterilized gauze to collect spores for inoculation. The spores were then collected and rinsed once with sterile water. The number of spores in the suspension was determined using a hemocytometer and adjusted to a concentration of 1 × 106 spores/mL. Shallot bulbs and onion seeds were sown in plastic pots filled with a mixture of sand and compost at a ratio of 4:1. The pots were incubated for seven days in a temperature-controlled room with a temperature of 25 °C and a 16:8 light–dark cycle, after which the seedlings were uprooted and the central portion of the root was excised. The cut portion of the root was dipped into the prepared spore suspension and sterilized water (as a control) for 1 h. Subsequently, the inoculated seedlings were transplanted into plastic pots containing the same soil mixture. The pots were then placed in a temperature-controlled room with a temperature of 25 °C and 16:8 light-dark cycle.
The shallot disease index was scored five weeks postinoculation, as described previously [30], with slight modifications: 0, no chlorosis; 1, necrosis on the tip of the leaf; 2, leaf curving with a pale green or yellowish color; 3, leaf curving and drying out; and 4, leaf death. The disease index was evaluated for each leaf, and an average disease index was calculated for each plant using the following equation: disease index = (4 × n [number of leaf deaths] + 3 × n [number of leaves curving and drying out] + 2 × n [number of leaves curving with a pale green or yellowish color] + 1 × n [number of necrosis on the tip of the leaf] + 0 × n [leaf number with no chlorosis])/total number of evaluated leaves. The biomass of all the shallot plants was also measured. The pathogenicity test was conducted at least twice with at least three seedlings per iteration.

2.3. RNA Extraction and Quantitative Reverse-Transcriptase Polymerase Chain Reaction (qRT-PCR)

To conduct the quantitative reverse-transcription polymerase chain reaction (qRT-PCR), RNA was extracted from onion and shallot roots inoculated with Foc_TA at 3, 7, and 14 days postinoculation (dpi). Total RNA was extracted from three independent onion and shallot root samples using Sepasol-RNA I Super G (Nacalai Tesque Inc., Kyoto, Japan). For reverse transcription, 500 ng of total RNA was used in a 10 µL reaction volume with the ReverTra Ace qPCR RT Master Mix with gDNA Remover (Toyobo), following the manufacturer’s instructions. The resulting cDNA was diluted (1:1), and 1 µL of the diluted cDNA was used as a template in a 20 µL total volume of THUNDERBIRD SYBR qPCR Mix (Toyobo). The relative amounts of FocSIX5 gene transcripts were calculated and normalized to that of the EF-1α gene. Real-time quantitative PCR was performed using a 7300 system (Applied Biosystems, Foster City, CA, USA).

2.4. Sequence Alignment and Prediction of Signal Peptide

Amino acid sequences were aligned using the Clustal 2.1 [31]. Signal peptides were predicted using SignalP-5.0 [32]. Sequence data of SIX5 were obtained from the NCBI database: (Fol4287 (XP_018257286), FUS2 (ALQ80804), Fus062 (QMX85381), Fus125 (QMX85382), Fus127 (QMX85383), Fus129 (QMX85384), A21 (ALQ80805), Fox129 (UVW62045), and AP117 (LC731005)).

2.5. Generation of Gene Knockout and Complementation Constructs

A fusion PCR strategy was used to generate a gene knockout construct [33]. The 5′ and 3′ flanking regions of the FocSIX5 gene were amplified using SIX5-split-F1/F2 and SIX5-split-F3/F4 primer sets, respectively (Table 1). The hph (Hygromycin B resistance) cassette was amplified from the pHRC vector using the M13F/M13R primer set. The three obtained amplicons were fused using fusion PCR using the SIX5-split-F1/F4 primer set.
To generate a gene complementation mutant, a DNA construct containing an open reading frame (ORF) upstream and downstream of the FocSIX5 gene was amplified using the SIX5-split-F1/F4 primer set. A geneticin-resistance gene cassette was amplified from the pII99 plasmid [36].

2.6. Protoplast Preparation

Fungal protoplasts were prepared as previously described [37] with slight modifications. The enzyme solution contained 10 mg/mL lysing enzymes (Sigma-Aldrich, St. Louis, MO, USA) and 4 mg/mL yatalase (Takara Bio, Shiga, Japan). The protoplast concentration was adjusted to 1.0 × 108 cells/mL in STC buffer (1.2 M sorbitol, 50 mM CaCl2, 10 mM Tris-HCl, pH 7.4).

2.7. Fungal Transformation

Polyethylene glycol (PEG)-mediated fungal transformation was performed to generate gene knockout and complementation mutants. For the gene knockout mutant, 20 µg of the gene knockout construct and 920 µL 60% PEG solution were added to the protoplast suspension [38]. Hygromycin B resistance mutants were selected as candidates for FocSIX5 gene knockout mutant and incubated on PDA-containing hygromycin B (100 µg/mL). The DNA of the candidate of the FocSIX5 gene knockout mutant was extracted using a simple extraction method described previously [39]. FocSIX5 knockout was verified via PCR using Quick Taq HS (Toyobo, Osaka, Japan), following the manufacturer’s instructions, with the SIX5-C-F/SIX5-C-R and SIX5-split-F1/SIX5-split-F4 primer sets. Furthermore, FocSIX5 knockout was verified using Southern blot analysis. In brief, the downstream region of the FocSIX5 gene was amplified using the SIX5-split-F3/SIX5-split-F4 primer set, and digoxigenin was labeled as a hybridization probe. The total DNA was extracted from the mycelia of wild-type Foc_TA and candidate FocSIX5 knockout mutants cultured for 5 days. Thereafter, 10 µg of total DNA of the wild-type Foc_TA and candidates for FocSIX5 gene knockout mutants was digested using the EcoRV restriction enzyme and, after blotting, hybridized using the hybridization probe. The digoxigenin-labeled probe was detected using a CDP-StarTM detection reagent (Roche Diagnostics Deutschland GmbH, Mannheim, Germany) according to the manufacturer’s instructions. Finally, two FocSIX5 gene knockout mutants (ΔSIX5-1 and ΔSIX5-2) were generated and used for further investigation.
To obtain the complementation mutants, 10 µg of the complementation construct and 10 µg of the geneticin-resistance cassette were co-transformed into fungal protoplasts. Geneticin-resistance mutants were selected as candidates of FocSIX5 gene complementation mutant and incubated on PDA-containing G418 (100 µg/mL). DNA of the candidate of FocSIX5 gene complementation mutant was extracted [39], and FocSIX5 gene complementation was verified through PCR using the SIX5-C-F/SIX5-C-R and SIX5-split-F1/SIX5-split-F4 primer sets. Consequently, two FocSIX5 gene complementation mutants (ΔSIX5-1 + SIX5 [Δ-1 + SIX5] and ΔSIX5-2 + SIX5 [Δ-2 + SIX5]) and two FocSIX5 gene complementation mutants with FocSIX5 gene variant G200A SNP (ΔSIX5-2 + SIX5R67K-1 [Δ-2 + SIX5R67K-1] and ΔSIX5-2 + SIX5R67K-2 [Δ-2 + SIX5R67K-2]) were generated and used for further investigation.

2.8. Vegetative Growth Assays

Wild-type Foc_TA and the gene knockout and gene complementation mutants were cultured on PDA in a growth chamber with a temperature of 25 °C for five days. The colony edge was collected using a 5 mm cork bore, and the mycelia plug were placed in the center of PDA plates and incubated in a growth chamber with a temperature of 25 °C for five days. The colony diameters were measured. All the tests were conducted with at least three samples per iteration. All experiments were repeated at least twice.

2.9. Statistical Analysis

The experimental data are presented as the mean and standard error. The statistical significance of the differences between the mean values was determined using the Student’s t-test or one-way analysis of variance with post hoc ANOVA and post hoc Tukey HSD test.

3. Results

3.1. Confirmation of Pathogenicity of Foc_TA toward Onion and Shallot Plants

Inoculation tests were performed to confirm the pathogenicity of Foc_TA on onion and shallot plants. These results showed that Foc_TA caused severe basal rot disease in onion bulbs. However, shallot seedlings inoculated with Foc_TA exhibited only slight necrosis of the leaf tip. (Figure 1). All onion seedlings inoculated with Foc_TA exhibited severe leaf-death symptoms.

3.2. Expression of FocSIX5 Gene in Onion and Shallot Plants during Infection

FocSIX5 is drastically upregulated during onion infection [28]. Therefore, qRT-PCR was performed to examine the expression of FocSIX5 in Foc_TA during onion and shallot infections. qRT-PCR showed that the FocSIX5 gene was expressed in shallot and onion roots inoculated with Foc_TA (Figure S1).

3.3. Characterization of FocSIX5

We compared the amino acid sequences of FocSIX5 and SIX5 in FoL 4287 (FolSIX5, Accession no. XP_018257286). FocSIX5 was predicted to be a secretory peptide harboring seven cysteine residues, encoding 122 amino acids with 13.4 a (Accession of. LC730887). According to the BLAST analysis, FocSIX5 was 74% similar to FolSIX5, and the signal peptide of FocSIX5/FolSIX5 was predicted to be cleaved at the alanine residue. The cysteine residues were conserved between FocSIX5 and FolSIX5 (Figure 2).

3.4. Generation of a FocSIX5 Gene-Modified Mutant

To clarify the involvement of FocSIX5 in pathogenicity, we generated a FocSIX5 knockout mutant via marker-exchange homologous recombination with a hygromycin B resistance gene (hph) cassette (Figure S2). FocSIX5 knockout mutants were complemented by reintroducing the FocSIX5 construct and a geneticin-resistance cassette. Subsequently, gene modification was verified using a polymerase chain reaction (PCR) using the designated primer set and using Southern blot analysis (Figures S3 and S4).

3.5. Mycelial Growth of FocSIX5 Gene-Modified Mutant

To investigate the effects of FocSIX5 modification on phenotypic traits, the fungal development in wild-type Foc_TA, FocSIX5 knockout, and FocSIX5 complementation mutants was evaluated. No marked differences were observed in mycelial growth among the wild-type Foc_TA, FocSIX5 knockout, or FocSIX5 complementation mutants (Figure S5).

3.6. Effect of the FocSIX5 Gene Modification on Pathogenicity toward Onion and Shallot

FolSIX5 acts as both a virulence and an avirulence gene in the Fol–tomato pathosystem [23]. Thus, onion bulbs were inoculated with FocSIX5 gene knockout (ΔSIX5-1 and ΔSIX5-2) and FocSIX5 gene complementation mutants (ΔSIX5-1 + SIX5 [Δ-1 + SIX5] and ΔSIX5-2 + SIX5 [Δ-2 + SIX5]) to investigate whether FocSIX5 gene is related to pathogenicity toward onion. FocSIX5 knockout mutants did not remarkably compromise virulence but slightly decreased the symptom area on the onion bulb compared to the wild-type Foc_TA and FocSIX5 complementation mutants (Figure S6). Pathogenicity tests for shallots were performed using wild-type Foc_TA, FocSIX5 knockout, and FocSIX5 complementation mutants. The shallot plants used in this study exhibited a highly Foc-resistant phenotype; therefore, shallot plants inoculated with wild-type Foc_TA did not exhibit severe wilting symptoms. However, shallot plants inoculated with the FocSIX5 knockout mutant showed more severe wilting than those inoculated with the wild-type Foc_TA, and the biomass of shallot plants inoculated with FocSIX5 knockout mutant was consistently lower than that of shallot plants inoculated with the wild-type Foc_TA and FocSIX5 knockout mutants (Figure S7). Moreover, no severe wilt symptoms were observed in shallot plants inoculated with the FocSIX5 complementation mutants, demonstrating that FocSIX5 acts as an intact avirulence effector in shallots (Figure 3).

3.7. Effect of G200A Mutation on the Pathogenicity toward Shallot

To evade plant immunity, pathogens mutate the nucleotide sequences of their avirulence effectors, resulting in nonsynonymous substitutions. Therefore, we used BLAST to investigate whether there were sequence variations in FocSIX5 among different isolates. Notably, a single-nucleotide polymorphism (G200A) was detected in the FocSIX5 nucleotide sequence of the Foc_A21 strain isolated from the United Kingdom [8] and the Fox129 strain isolated from Finland [5], leading to a nonsynonymous substitution (R67K) (Figure 4a). Additionally, the same nonsynonymous substitution (R67K) was found in the Australian AP117 strain as in our Foc collection (Accession No. LC731005). Thus, we speculate that this nonsynonymous substitution may be a strategy used by Foc to avoid recognition by the host. To test this hypothesis, we generated a gene complementation mutant with the FocSIX5 gene construct, including the G200A SNP (ΔSIX5-2 + SIX5R67K-1 [Δ-2 + SIX5R67K-1] and ΔSIX5-2 + SIX5R67K-2 [Δ-2 + SIX5R67K-2]) (Figure S5), and performed pathogenicity tests on shallots. Contrary to our hypothesis, shallot plants inoculated with mutants expressing SIX5 protein variants carrying the R67K substitution exhibited a highly resistant phenotype, suggesting that host plant immunity was not related to a single amino acid mutation (R67K) in FocSIX5 (Figure 4b,c).

4. Discussion

Plant-pathogenic fungi secrete effectors that manipulate the host immunity to induce infections. However, some effectors are recognized as avirulent by innate plant immune receptors, which cause robust plant resistance responses [15,40,41]. In F. oxysporum, avirulence effectors such as SIX1 (AVR3), SIX3 (AVR2), SIX5, and SIX4 (AVR1) in Fol and SIX6 in F. oxysporum f. sp. niveum (which infects watermelons) have been identified [22,23,42]. Among the SIX effectors in Fol, SIX5 is required for full virulence in susceptible tomato lines, and a SIX5 homolog is present in Foc [6,23]. Therefore, we investigated whether SIX5 in Foc is related to pathogenicity in onion and shallot plants, as has been reported for SIX5 in Fol-tomato pathosystem [23]. In the present study, we confirmed that FocSIX5 in Foc_TA was expressed in both onion and shallot roots during the Foc-infection process. The FocSIX5 gene was expressed in shallot and onion roots inoculated with Foc_TA (Figure S3), suggesting that FocSIX5 may play an important role in the pathogenicity of Foc in onion and shallot infections. To investigate the relationship between the FocSIX5 gene and pathogenicity during Foc infection in onions and shallots, we generated FocSIX5 gene-modified mutants. Upon conducting a pathogenicity test, onion bulbs inoculated with the wild-type Foc_TA strain, FocSIX5 knockout mutants, or FocSIX5 complementation mutants exhibited typical symptoms of Fusarium basal rot disease, and the symptom areas were not considerably different between the wild-type Foc_TA and FocSIX5 gene-modified mutants. However, the symptom area in onions inoculated with FocSIX5 knockout mutants was slightly decreased compared to that in wild-type Foc_TA or FocSIX5 complementation mutants. Given that FocSIX5 gene knockout mutants showed the same colony-formation capability as wild-type Foc_TA and FocSIX5 gene complementation mutants (Figure S5), the FocSIX5 gene was specifically upregulated during Foc infection of susceptible onion, suggesting that FocSIX5 plays a role in the colonization of host plants rather than growth in onion. Similarly, SIX5 of Fol is related to virulence; thus, we speculate that FocSIX5 gene is related to virulence in onions. Nevertheless, shallot plants inoculated with the FocSIX5 knockout mutant showed more severe wilt symptoms than those inoculated with the wild-type Foc_TA, indicating that FocSIX5 secreted by Foc acts as an avirulence effector in shallots. Although the mechanism underlying the severe disease symptoms in shallot plants inoculated with the FocSIX5 gene knockout mutants is not clear from the present study, it has been reported that host plants inoculated with avirulence gene knockout F. oxysporum mutants showed more severe wilting than those inoculated with wild-type F. oxysporum [22,23,42]. To the best of our knowledge, this is the first report of an avirulence effector in Foc toward Allium species.
This study confirmed that FocSIX5 in Foc_TA was expressed in both onion and shallot roots during the Foc-infection process. The FocSIX5 gene was expressed in shallot and onion roots inoculated with Foc_TA (Figure S3), suggesting that FocSIX5 may play an important role in the pathogenicity of Foc in onion and shallot infections. To investigate the relationship between the FocSIX5 gene and pathogenicity during Foc infection in onions and shallots, we generated FocSIX5 gene-modified mutants. Upon conducting a pathogenicity test, onion bulbs inoculated with the wild-type Foc_TA strain, FocSIX5 knockout mutants, or FocSIX5 complementation mutants exhibited typical symptoms of Fusarium basal rot disease, and the symptom areas were not considerably different between the wild-type Foc_TA and FocSIX5 gene-modified mutants. However, the symptom area in onions inoculated with FocSIX5 knockout mutants was slightly decreased compared to that in wild-type Foc_TA or FocSIX5 complementation mutants. Given that FocSIX5 gene knockout mutants showed the same colony-formation capability as wild-type Foc_TA and FocSIX5 gene complementation mutants (Figure S5), the FocSIX5 gene is specifically upregulated during Foc infection of susceptible onion, suggesting that FocSIX5 plays a role in the colonization of host plants rather than growth in onion. Similarly, SIX5 of Fol is related to virulence; thus, we speculate that the FocSIX5 gene is related to virulence in onions. Nevertheless, shallot plants inoculated with the FocSIX5 knockout mutant showed more severe wilt symptoms than those inoculated with the wild-type Foc_TA, indicating that FocSIX5 secreted by Foc acts as an avirulence effector in shallots. To the best of our knowledge, this is the first report of an avirulence effector in Foc toward Allium species.
Pathogens undergo mutations in the avirulence effector that avert host recognition and promote infection [43,44]. The Fol race 3 strain has three different patterns of single amino acid substitutions in its AVR2 sequence (V41M, R45H, and R46P) to escape from I-2-derived immunity [22]. FocSIX5 is widely expressed in aggressive Foc [5,6,8]. Therefore, we speculate that there are variations in the FocSIX5 sequence. As expected, FocSIX5 had a single amino acid substitution, R67K, when sequence variants from different Foc strains were compared. To determine whether the R67K substitution affected avirulence, we complemented FocSIX5 gene construct with an allelic variant carrying the G200A mutation. Shallot plants inoculated with mutants expressing SIX5 protein variants carrying the R67K substitution exhibited a highly resistant phenotype, suggesting that the single amino acid substitution R67K in FocSIX5 is not sufficient to overcome shallot resistance to Foc.
The SIX5 protein is conserved only within Fol and Foc in the F. oxysporum species complex with 74% identity and harbors cysteine residues at precisely the same positions. Interestingly, AVR2 (SIX3) and SIX5 share promoter regions in the Fol genome, and their encoded proteins physically interact with each other and are necessary for triggering I-2-derived immunity in tomato plants [23]. In Foc, FocSIX3 and FocSIX5 are located on the same scaffold, sharing both promoter regions with the reference genome of the Foc_FUS2 strain [28], and the nucleotide sequence of FocSIX3 is 91.4% similar to that of FolSIX3 [45]. Thus, FocSIX3-FocSIX5 may physically interact with each other and play a role similar to that of AVR2-SIX5, as reported by Fol [23]. However, shallot plants inoculated with the FocSIX3 knockout mutant did not show the same wilt symptoms as those inoculated with wild-type Foc_TA, suggesting that FocSIX3 is not an avirulence effector recognized by the shallot, in contrast to the AVR2-SIX5 pair in Fol. Thus, it is possible that the putative immune receptor of shallots that recognizes FocSIX5 is unlikely to resemble but is partially similar to the I-2 receptor of tomatoes. The I-2 gene encodes a nucleotide-binding and leucine-rich repeats (NB-LRR) at the N- and C-termini, respectively [25]. Further studies are required to explore the NB-LRR proteins that recognize SIX5 in shallots.
Some plant immune receptor proteins specifically interact with avirulent effectors secreted by the causative agents of the disease. For example, the immune receptor protein L6 in flax (Linum usitatissimum) interacts with the Avr567 avirulence protein in flax rust (Melampsora lini), causing a hypersensitivity reaction [46]. In addition, the resistance protein Pi-ta in rice and the avirulence effector AVR-Pi-ta in the rice blast fungus Pyricularia oryzae bind directly to each other to confer rice blast resistance [47]. Foc-resistance-related loci/genes in shallots are gradually being investigated; however, the specific loci and genes involved in disease resistance remain unclear [11,12]. Thus, FocSIX5 may be a useful tool for identifying Foc-resistant loci or genes in shallot. In this study, only one shallot genotype exhibiting high resistance to Foc was used. However, other shallot genotypes resistant to Foc have also been reported [48]. Hence, comparative genome analysis of these shallot genotypes and those used in this study could reveal Foc-resistant loci or genes, leading to an understanding of the resistance mechanism of shallots to Foc and the acquisition of a promising breeding resource for onion disease resistance.
Collectively, our results indicate that the high-Foc-resistance shallot cv. Chiang Mai and shallot immunity-recognizing FocSIX5 are promising breeding resources for disease resistance in onions against Foc.

5. Conclusions

Understanding the relationship between pathogens and plants is important for breeding disease-resistant varieties. In the present study, we demonstrated that FocSIX5 acts as an avirulent effector of Foc in shallots. Moreover, we demonstrated that a single amino acid substitution (R67K) in the FocSIX5 sequence was not associated with the ability to overcome shallot resistance. The insights gained from this study could be useful for the development of onion cultivars that are resistant to Foc.

Supplementary Materials

The following supporting information can be downloaded from https://www.mdpi.com/article/10.3390/microorganisms11122861/s1. Figure S1: Relative gene expression of FocSIX5 in Foc_TA during infection in onion and shallot; Figure S2: Schematic of the marker-exchange homologous recombination between FocSIX5 gene and the hygromycin B resistant (hph) cassette; Figure S3: Verification of FocSIX5 knockout mutant through Southern blotting analysis; Figure S4: Confirmation of transformation via polymerase chain reaction (PCR) in mutants with modifications in the FocSIX5 gene; Figure S5: Confirmation of colony-formation capability in FocSIX5 gene-modified mutants; Figure S6: Results of the pathogenicity test toward onion bulb with FocSIX5 gene knockout and gene complementation mutant; Figure S7: Biomass of shallot plant inoculated with wild-type Foc_TA, SIX5 gene knockout, and complementation mutants.

Author Contributions

Conceptualization, K.S. (Kosei Sakane), K.S. (Kazunori Sasaki), and S.-i.I.; Methodology, K.S. (Kosei Sakane) and K.S. (Kazunori Sasaki); Validation, K.S. (Kosei Sakane) and K.S. (Kazunori Sasaki); Formal Analysis, K.S. (Kosei Sakane); Investigation, K.S. (Kosei Sakane), M.K., K.F. and K.S. (Kazunori Sasaki); Resources, M.S., K.S. (Kazunori Sasaki) and S.-i.I.; Writing—Original Draft Preparation, K.S. (Kosei Sakane); Writing—Review and Editing, K.S. (Kosei Sakane), M.S., K.S. (Kazunori Sasaki) and S.-i.I.; Visualization, K.S. (Kosei Sakane), M.K. and K.F.; Supervision, K.S. (Kazunori Sasaki) and S.-i.I.; Project Administration, S.-i.I. Funding Acquisition, K.S. (Kazunori Sasaki). All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by JSPS KAKENHI (grant number 21K14857).

Data Availability Statement

Sequence data for FocSIX5 from the TA and AP117 strains were deposited in the DNA Data Bank of Japan under accession numbers LC730887 and LC731005, respectively.

Acknowledgments

The authors thank Mathieu Pel (Enza Zaden, The Netherlands) for kindly providing the Fusarium oxysporum f. sp. cepae AP117 strain.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Dean, R.; Van Kan, J.A.; Pretorius, Z.A.; Hammond-Kosack, K.E.; Di Pietro, A.; Spanu, P.D.; Rudd, J.J.; Dickman, M.; Kahmann, R.; Ellis, J.; et al. The Top 10 fungal pathogens in molecular plant pathology. Mol. Plant Pathol. 2012, 13, 414–430. [Google Scholar] [CrossRef]
  2. Leslie, J.F.; Summerell, B.A. Fusarium laboratory workshops-A recent history. Mycotoxin Res. 2006, 22, 73–74. [Google Scholar] [CrossRef]
  3. Laurence, M.H.; Burgess, L.W.; Summerell, B.A.; Liew, E.C. High levels of diversity in Fusarium oxysporum from non-cultivated ecosystems in Australia. Fungal Biol. 2012, 116, 289–297. [Google Scholar] [CrossRef] [PubMed]
  4. Michielse, C.B.; Rep, M. Pathogen profile update: Fusarium oxysporum. Mol. Plant Pathol. 2009, 10, 311–324. [Google Scholar] [CrossRef]
  5. Haapalainen, M.; Laitala, E.; Rämö, S.; Latvala, S. Pathogenicity and toxin production of different Fusarium oxysporum isolates infecting onion (Allium cepa L.). Ann. Appl. Biol. 2022, 180, 348–360. [Google Scholar] [CrossRef]
  6. Sasaki, K.; Nakahara, K.; Tanaka, S.; Shigyo, M.; Ito, S. Genetic and pathogenic variability of Fusarium oxysporum f. sp. cepae isolated from onion and Welsh onion in Japan. Phytopathology 2015, 105, 525–532. [Google Scholar] [CrossRef]
  7. Southwood, M.J.; Viljoen, A.; McLeod, A. Inoculum sources of Fusarium oxysporum f. sp. cepae on onion in the Western Cape Province of South Africa. Crop Prot. 2015, 75, 88–95. [Google Scholar] [CrossRef]
  8. Taylor, A.; Vágány, V.; Jackson, A.C.; Harrison, R.J.; Rainoni, A.; Clarkson, J.P. Identification of pathogenicity-related genes in Fusarium oxysporum f. sp. cepae. Mol. Plant Pathol. 2016, 17, 1032–1047. [Google Scholar] [CrossRef] [PubMed]
  9. Teshima, Y.; Ikeda, T.; Imada, K.; Sasaki, K.; El-Sayed, M.A.; Shigyo, M.; Tanaka, S.; Ito, S. Identification and biological activity of antifungal saponins from Shallot (Allium cepa L. aggregatum Group). J. Agric. Food Chem. 2013, 61, 7440–7445. [Google Scholar] [CrossRef]
  10. Yin, M.-C.; Hsu, P.-C.; Chang, H.-H. In vitro antioxidant and antibacterial activities of Shallot and Scallion. Food Sci. 2003, 68, 281–284. [Google Scholar] [CrossRef]
  11. Herlina, L.; Reflinur, R.; Sobir, S.; Maharijaya, A.; Wiyono, S. The genetic diversity and population structure of shallots (Allium cepa var. aggregatum) in Indonesia based on R gene-derived markers. Biodivers. J. Biol. Divers. 2019, 20, 696–703. [Google Scholar] [CrossRef]
  12. Vu, H.Q.; El-Sayed, M.A.; Ito, S.I.; Yamauchi, N.; Shigyo, M. Discovery of a new source of resistance to Fusarium oxysporum, cause of Fusarium wilt in Allium fistulosum, located on chromosome 2 of Allium cepa Aggregatum group. Genome 2012, 55, 797–807. [Google Scholar] [CrossRef]
  13. Abdelrahman, M.; Sawada, Y.; Nakabayashi, R.; Sato, S.; Hirakawa, H.; El-Sayed, M.; Hirai, M.Y.; Saito, K.; Yamauchi, N.; Shigyo, M. Integrating transcriptome and target metabolome variability in doubled haploids of Allium cepa for abiotic stress protection. Mol. Breed. 2015, 35, 195. [Google Scholar] [CrossRef]
  14. Astley, D.; Innes, N.L.; Van der Meer, Q.P. Genetic Resources of Allium Species: A Global Report; IBPGR: Rome, Italy, 1982. [Google Scholar]
  15. Jones, J.D.G.; Dangl, J.L. The plant immune system. Nature 2006, 444, 323–329. [Google Scholar] [CrossRef] [PubMed]
  16. Rovenich, H.; Boshoven, J.C.; Thomma, B.P. Filamentous pathogen effector functions: Of pathogens, hosts and microbiomes. Curr. Opin. Plant Biol. 2014, 20, 96–103. [Google Scholar] [CrossRef] [PubMed]
  17. Yuan, M.; Ngou, B.P.M.; Ding, P.; Xin, X.F. PTI-ETI crosstalk: An integrative view of plant immunity. Curr. Opin. Plant Biol. 2021, 62, 102030. [Google Scholar] [CrossRef] [PubMed]
  18. Houterman, P.M.; Speijer, D.; Dekker, H.L.; De Koster, C.G.; Cornelissen, B.J.C.; Rep, M. The mixed xylem sap proteome of Fusarium oxysporum-infected tomato plants. Mol. Plant Pathol. 2007, 8, 215–221. [Google Scholar] [CrossRef] [PubMed]
  19. Schmidt, S.M.; Houterman, P.M.; Schreiver, I.; Ma, L.; Amyotte, S.; Chellappan, B.; Boeren, S.; Takken, F.L.W.; Rep, M. MITEs in the promoters of effector genes allow prediction of novel virulence genes in Fusarium Oxysporum. BMC Genom. 2013, 14, 119. [Google Scholar] [CrossRef]
  20. Catanzariti, A.M.; Lim, G.T.T.; Jones, D.A. The tomato I-3 gene: A novel gene for resistance to Fusarium wilt disease. New Phytol. 2015, 207, 106–118. [Google Scholar] [CrossRef]
  21. Gawehns, F.; Houterman, P.M.; Ichou, F.A.; Michielse, C.B.; Hijdra, M.; Cornelissen, B.J.C.; Rep, M.; Takken, F.L. The Fusarium oxysporum effector Six6 contributes to virulence and suppresses I-2-mediated cell death. Mol. Plant Microbe Interact. 2014, 27, 336–348. [Google Scholar] [CrossRef]
  22. Houterman, P.M.; Ma, L.; van Ooijen, G.; de Vroomen, M.J.; Cornelissen, B.J.C.; Takken, F.L.W.; Rep, M. The effector protein Avr2 of the xylem-colonizing fungus Fusarium oxysporum activates the tomato resistance protein I-2 intracellularly. Plant J. 2009, 58, 970–978. [Google Scholar] [CrossRef]
  23. Ma, L.; Houterman, P.M.; Gawehns, F.; Cao, L.; Sillo, F.; Richter, H.; Clavijo-Ortiz, M.J.; Schmidt, S.M.; Boeren, S.; Vervoort, J.; et al. The AVR 2–SIX 5 gene pair is required to activate I-2-mediated immunity in tomato. New Phytol. 2015, 208, 507–518. [Google Scholar] [CrossRef]
  24. Rep, M.; Van Der Does, H.C.; Meijer, M.; Van Wijk, R.; Houterman, P.M.; Dekker, H.L.; De Koster, C.G.; Cornelissen, B.J.C. A small, cysteine-rich protein secreted by Fusarium oxysporum during colonization of xylem vessels is required for I-3-mediated resistance in tomato. Mol. Microbiol. 2004, 53, 1373–1383. [Google Scholar] [CrossRef]
  25. Takken, F.; Rep, M. The arms race between tomato and Fusarium Oxysporum. Mol. Plant Pathol. 2010, 11, 309–314. [Google Scholar] [CrossRef] [PubMed]
  26. Huang, C.C.; Huang, C.; Lindhout, P. Screening for resistance in wild Lycopersicon species to Fusarium oxysporum f. sp. lycopersici race 1 and race 2. Euphytica 1997, 93, 145–153. [Google Scholar] [CrossRef]
  27. Lievens, B.; Houterman, P.M.; Rep, M. Effector gene screening allows unambiguous identification of Fusarium oxysporum f. sp. lycopersici races and discrimination from other formae speciales. FEMS Microbiol. Lett. 2009, 300, 201–215. [Google Scholar] [CrossRef]
  28. Armitage, A.D.; Taylor, A.; Sobczyk, M.K.; Baxter, L.; Greenfield, B.P.J.; Bates, H.J.; Wilson, F.; Jackson, A.C.; Ott, S.; Harrison, R.J.; et al. Characterisation of pathogen-specific regions and novel effector candidates in Fusarium oxysporum f. sp. cepae. Sci. Rep. 2018, 8, 13530. [Google Scholar] [CrossRef] [PubMed]
  29. Schneider, C.A.; Rasband, W.S.; Eliceiri, K.W. NIH Image to ImageJ: 25 years of image analysis. Nat. Methods 2012, 9, 671–675. [Google Scholar] [CrossRef]
  30. Herlina, L.; Istiaji, B.; Wiyono, S. The causal agent of Fusarium disease infested Shallots in Java islands of Indonesia. E3S Web Conf. 2021, 232, 03003. [Google Scholar] [CrossRef]
  31. Thompson, J.D.; Higgins, D.G.; Gibson, T.J. Clustal W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994, 22, 4673–4680. [Google Scholar] [CrossRef]
  32. Almagro Armenteros, J.J.; Tsirigos, K.D.; Sønderby, C.K.; Petersen, T.N.; Winther, O.; Brunak, S.; von Heijne, G.; Nielsen, H.; Signal, P. SignalP 5.0 improves signal peptide predictions using deep neural networks. Nat. Biotechnol. 2019, 37, 420–423. [Google Scholar] [CrossRef] [PubMed]
  33. Kuwayama, H.; Obara, S.; Morio, T.; Katoh, M.; Urushihara, H.; Tanaka, Y. PCR-mediated generation of a gene disruption construct without the use of DNA ligase and plasmid vectors. Nucleic Acids Res. 2002, 30, E2. [Google Scholar] [CrossRef] [PubMed]
  34. van der Does, H.C.; Duyvesteijn, R.G.; Goltstein, P.M.; van Schie, C.C.; Manders, E.M.; Cornelissen, B.J.; Rep, M. Expression of effector gene SIX1 of Fusarium oxysporum requires living plant cells. Fungal Genet. Biol. 2008, 45, 1257–1264. [Google Scholar] [CrossRef] [PubMed]
  35. Catlett, N.L.; Lee, B.-N.; Yoder, O.C.; Turgeon, B.G. Split-marker recombination for efficient targeted deletion of fungal genes. Fungal Genet. Rep. 2003, 50, 9–11. [Google Scholar] [CrossRef]
  36. Namiki, F.; Matsunaga, M.; Okuda, M.; Inoue, I.; Nishi, K.; Fujita, Y.; Tsuge, T. Mutation of an arginine biosynthesis gene causes reduced pathogenicity in Fusarium oxysporum f. sp. melonis. Mol. Plant Microbe Interact. 2001, 14, 580–584. [Google Scholar] [CrossRef]
  37. Akamatsu, H.; Taga, M.; Kodama, M.; Johnson, R.; Otani, H.; Kohmoto, K. Molecular karyotypes for Alternaria plant pathogens known to produce host-specific toxins. Curr. Genet. 1999, 35, 647–656. [Google Scholar] [CrossRef]
  38. Kawabe, M.; Mizutani, K.; Yoshida, T.; Teraoka, T.; Yoneyama, K.; Yamaguchi, I.; Arie, T. Cloning of the pathogenicity-related gene FPD1 in Fusarium oxysporum f. sp. lycopersici. J. Gen. Plant Pathol. 2004, 70, 16–20. [Google Scholar] [CrossRef]
  39. Saitoh, K.I.; Togashi, K.; Arie, T.; Teraoka, T. A simple method for a mini-preparation of fungal DNA. J. Gen. Plant Pathol. 2006, 72, 348–350. [Google Scholar] [CrossRef]
  40. Hammond-Kosack, K.E.; Jones, J.D.G. Plant disease resistance genes. Annu. Rev. Plant Physiol. Plant Mol. Biol. 1997, 48, 575–607. [Google Scholar] [CrossRef]
  41. Martin, G.B.; Bogdanove, A.J.; Sessa, G. Understanding the functions of plant disease resistance proteins. Annu. Rev. Plant Biol. 2003, 54, 23–61. [Google Scholar] [CrossRef]
  42. Niu, X.; Zhao, X.; Ling, K.S.; Levi, A.; Sun, Y.; Fan, M. The FonSIX6 gene acts as an avirulence effector in the Fusarium oxysporum f. sp. niveum—Watermelon pathosystem. Sci. Rep. 2016, 6, 28146. [Google Scholar] [CrossRef]
  43. Rouxel, T.; Balesdent, M.H. Avirulence genes. In Encyclopedia of Life Sciences (ELS); John Wiley & Sons, Ltd.: Chichester, UK, 2010. [Google Scholar] [CrossRef]
  44. Stephens, C.; Ölmez, F.; Blyth, H.; McDonald, M.; Bansal, A.; Turgay, E.B.; Hahn, F.; Saintenac, C.; Nekrasov, V.; Solomon, P.; et al. Remarkable recent changes in the genetic diversity of the avirulence gene AvrStb6 in global populations of the wheat pathogen Zymoseptoria tritici. Mol. Plant Pathol. 2021, 22, 1121–1133. [Google Scholar] [CrossRef]
  45. Sasaki, K.; Nakahara, K.; Shigyo, M.; Tanaka, S.; Ito, S. Detection and quantification of onion isolates of Fusarium oxysporum f. sp. cepae in onion plant. J. Gen. Plant Pathol. 2015, 81, 232–236. [Google Scholar] [CrossRef]
  46. Ellis, J.G.; Dodds, P.N.; Lawrence, G.J. Flax rust resistance gene specificity is based on direct resistance-avirulence protein interactions. Annu. Rev. Phytopathol. 2007, 45, 289–306. [Google Scholar] [CrossRef] [PubMed]
  47. Jia, Y.; McAdams, S.A.; Bryan, G.T.; Hershey, H.P.; Valent, B. Direct interaction of resistance gene and avirulence gene products confers rice blast resistance. EMBO J. 2000, 19, 4004–4014. [Google Scholar] [CrossRef] [PubMed]
  48. Sintayehu, A.; Fininsa, C.; Ahmed, S.; Sakhuja, P.K. Evaluations of shallot genotypes for resistance against fusarium basal rot (Fusarium oxysporum f. sp. cepae) disease. Crop Prot. 2011, 30, 1210–1215. [Google Scholar] [CrossRef]
Disclaimer/Publisher’s Note: The statements, opinions, and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of the MDPI and/or editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions, or products referred to in the content.
Microorganisms 11 02861 g001
Figure 1. Results of the pathogenicity test of Foc_TA toward onion and shallot plants. (a) Symptoms of non-inoculated and Foc_TA-inoculated onions. (b) Symptom area on inoculated onion bulb. n represents sample size. Asterisks indicate a significant difference (** p < 0.01) compared to the control using a Student’s t-test. (c) Symptoms of non-inoculated and Foc_TA–inoculated shallots. (d) Average disease index of shallot plants inoculated with wild-type Foc_TA five weeks after inoculation. n represents the sample size. n.s. denotes “not significant” compared to control using a Student’s t-test. All data are presented as mean and standard error.
Figure 1. Results of the pathogenicity test of Foc_TA toward onion and shallot plants. (a) Symptoms of non-inoculated and Foc_TA-inoculated onions. (b) Symptom area on inoculated onion bulb. n represents sample size. Asterisks indicate a significant difference (** p < 0.01) compared to the control using a Student’s t-test. (c) Symptoms of non-inoculated and Foc_TA–inoculated shallots. (d) Average disease index of shallot plants inoculated with wild-type Foc_TA five weeks after inoculation. n represents the sample size. n.s. denotes “not significant” compared to control using a Student’s t-test. All data are presented as mean and standard error.
Microorganisms 11 02861 g001
Microorganisms 11 02861 g002
Figure 2. Alignment of the amino acid sequences of FocSIX5 and FolSIX5. The underline in the sequence alignment shows the signal peptides predicted using SignalP5.0. The yellow boxes indicate cysteine residues in the amino acid sequences. The asterisks (*) indicate identical amino acids.
Figure 2. Alignment of the amino acid sequences of FocSIX5 and FolSIX5. The underline in the sequence alignment shows the signal peptides predicted using SignalP5.0. The yellow boxes indicate cysteine residues in the amino acid sequences. The asterisks (*) indicate identical amino acids.
Microorganisms 11 02861 g002
Microorganisms 11 02861 g003
Figure 3. Results of the pathogenicity test toward shallot plants with FocSIX5 gene knockout and gene complementation mutant. (a) Photographs of representative shallot plants inoculated with wild-type Foc_TA, FocSIX5 gene knockout (ΔSIX5-1 and ΔSIX5-2), and FocSIX5 gene complementation mutants (ΔSIX5-1 + SIX5 [Δ-1 + SIX5] and ΔSIX5-2 + SIX5 [Δ-2 + SIX5]) five weeks after inoculation. (b) Average disease index of shallot plants inoculated with wild-type Foc_TA, FocSIX5 gene knockout (ΔSIX5-1 and ΔSIX5-2), and FocSIX5 gene complementation mutants (ΔSIX5-1 + SIX5 [Δ-1 + SIX5] and ΔSIX5-2 + SIX5 [Δ-2 + SIX5]) five weeks after inoculation. Results of at least two experiments were combined. Asterisks indicate a significant difference (** p < 0.01, * p < 0.05) evaluated using a Student’s t-test. n represents sample size. Data are presented as mean and standard error.
Figure 3. Results of the pathogenicity test toward shallot plants with FocSIX5 gene knockout and gene complementation mutant. (a) Photographs of representative shallot plants inoculated with wild-type Foc_TA, FocSIX5 gene knockout (ΔSIX5-1 and ΔSIX5-2), and FocSIX5 gene complementation mutants (ΔSIX5-1 + SIX5 [Δ-1 + SIX5] and ΔSIX5-2 + SIX5 [Δ-2 + SIX5]) five weeks after inoculation. (b) Average disease index of shallot plants inoculated with wild-type Foc_TA, FocSIX5 gene knockout (ΔSIX5-1 and ΔSIX5-2), and FocSIX5 gene complementation mutants (ΔSIX5-1 + SIX5 [Δ-1 + SIX5] and ΔSIX5-2 + SIX5 [Δ-2 + SIX5]) five weeks after inoculation. Results of at least two experiments were combined. Asterisks indicate a significant difference (** p < 0.01, * p < 0.05) evaluated using a Student’s t-test. n represents sample size. Data are presented as mean and standard error.
Microorganisms 11 02861 g003
Microorganisms 11 02861 g004
Figure 4. Results of the pathogenicity test after single amino acid substitution R67K in the FocSIX5 sequences. (a) Alignment of amino acid sequences of FocSIX5. The gray box shows sequence variation in FocSIX5 among Foc strains. (b) Photographs of representative shallot plants inoculated via FocSIX5 gene knockout (ΔSIX5-2) and gene complementation mutant with FocSIX5 gene variant G200A SNP (ΔSIX5-2 + SIX5R67K-1 [Δ-2 + SIX5R67K-1] and ΔSIX5-2 + SIX5R67K-2 [Δ-2 + SIX5R67K-2]) five weeks after inoculation. (c) Average disease index of shallot plants inoculated withthe FocSIX5 gene knockout mutant (ΔSIX5-2) and gene complementation mutant with FocSIX5 gene variant G200A SNP (ΔSIX5-2 + SIX5R67K-1 [Δ-2 + SIX5R67K-1] and ΔSIX5-2 + SIX5R67K-2 [Δ-2 + SIX5R67K-2]) five weeks after inoculation. Results of at least two experiments were combined. Asterisks indicate a significant difference (** p < 0.01, * p < 0.05) evaluated using a Student’s t-test. n represents sample size. Data are presented as mean and standard error.
Figure 4. Results of the pathogenicity test after single amino acid substitution R67K in the FocSIX5 sequences. (a) Alignment of amino acid sequences of FocSIX5. The gray box shows sequence variation in FocSIX5 among Foc strains. (b) Photographs of representative shallot plants inoculated via FocSIX5 gene knockout (ΔSIX5-2) and gene complementation mutant with FocSIX5 gene variant G200A SNP (ΔSIX5-2 + SIX5R67K-1 [Δ-2 + SIX5R67K-1] and ΔSIX5-2 + SIX5R67K-2 [Δ-2 + SIX5R67K-2]) five weeks after inoculation. (c) Average disease index of shallot plants inoculated withthe FocSIX5 gene knockout mutant (ΔSIX5-2) and gene complementation mutant with FocSIX5 gene variant G200A SNP (ΔSIX5-2 + SIX5R67K-1 [Δ-2 + SIX5R67K-1] and ΔSIX5-2 + SIX5R67K-2 [Δ-2 + SIX5R67K-2]) five weeks after inoculation. Results of at least two experiments were combined. Asterisks indicate a significant difference (** p < 0.01, * p < 0.05) evaluated using a Student’s t-test. n represents sample size. Data are presented as mean and standard error.
Microorganisms 11 02861 g004
Table 1. Primers used in this study.
Table 1. Primers used in this study.
Primer NameSequence (5′–3′)PurposeReference
SIX5-C-FGCGCTTCGAGTACATCTCTGDetection of FocSIX5This study
SIX5-C-RCTAGGATGCATCACAATAGADetection of FocSIX5This study
SIX5-Q-FTGCCACCACTCAGCTTCAGAQuantification of FocSIX5This study
SIX5-Q-RTGAAATGTGGACCAAGTGCTCTAQuantification of FocSIX5This study
SIX5-split-F1GGGATAGGTAAGCAAGCAGCTTGDisruption and complementation of FocSIX5This study
SIX5-split-F2GTCGTGACTGGGAAAACCCTGG
CGGTGATGAAGAGTAGTAGAG		Disruption of FocSIX5This study
SIX5-split-F3TCCTGTGTGAAATTGTTATCCG
CTTCTGTCATTGTGACCAGTG		Disruption of FocSIX5
Verification of FocSIX5 gene knockout		This study
SIX5-split-F4ATGTCAAGAGCGCGCGAAGCTCDisruption and complementation of FocSIX5
Verification of FocSIX5 gene knockout		This study
FoTEF-Q2-FCATCGGCCACGTCGACTCTQuantification of EF-1α[34]
FoTEF-Q2-RAGAACCCAGGCGTACTTGAAQuantification of EF-1α[34]
M13FCGCCAGGGTTTTCCCAGTCACGACCreation of hph construct[35]
M13RAGCGGATAACAATTCACACAGGACreation of hph construct[35]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Sakane, K.; Kunimoto, M.; Furumoto, K.; Shigyo, M.; Sasaki, K.; Ito, S.-i. The SIX5 Protein in Fusarium oxysporum f. sp. cepae Acts as an Avirulence Effector toward Shallot (Allium cepa L. Aggregatum Group). Microorganisms 2023, 11, 2861. https://doi.org/10.3390/microorganisms11122861

AMA Style

Sakane K, Kunimoto M, Furumoto K, Shigyo M, Sasaki K, Ito S-i. The SIX5 Protein in Fusarium oxysporum f. sp. cepae Acts as an Avirulence Effector toward Shallot (Allium cepa L. Aggregatum Group). Microorganisms. 2023; 11(12):2861. https://doi.org/10.3390/microorganisms11122861

Chicago/Turabian Style

Sakane, Kosei, Masaaki Kunimoto, Kazuki Furumoto, Masayoshi Shigyo, Kazunori Sasaki, and Shin-ichi Ito. 2023. "The SIX5 Protein in Fusarium oxysporum f. sp. cepae Acts as an Avirulence Effector toward Shallot (Allium cepa L. Aggregatum Group)" Microorganisms 11, no. 12: 2861. https://doi.org/10.3390/microorganisms11122861

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop