Single-Droplet Microsensor for Ultra-Short Circulating EFGR Mutation Detection in Lung Cancer Based on Multiplex EFIRM Liquid Biopsy
Abstract
:1. Introduction
1.1. Liquid Biopsy and Early-Stage Lung Cancer
1.2. Ultra-Short Circulating Tumor DNA in Lung Cancer
1.3. Multiplexing Point-of-Care Device for Lung Cancer Monitor
1.4. Single-Droplet Microarray-Based Multiplexing EFIRM Platform for usctDNA
2. Results
2.1. m-eLB Sensor for Multiple EGFR Mutations
2.2. Multiplexing DNA Measurement for Three EGFR Mutations in a Single Droplet
2.3. Acurracy of m-eLB Platform for usctDNA
3. Materials and Methods
3.1. m-eLB Sensor Fabrication
3.2. m-eLB Platform with Multi-Channel Potentiostat
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Sung, H.; Ferlay, J.; Siegel, R.L.; Laversanne, M.; Soerjomataram, I.; Jemal, A.; Bray, F. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J. Clin. 2021, 71, 209–249. [Google Scholar] [CrossRef] [PubMed]
- Rafiemanesh, H.; Mehtarpour, M.; Khani, F.; Hesami, S.M.; Shamlou, R.; Towhidi, F.; Salehiniya, H.; Makhsosi, B.R.; Moini, A. Epidemiology, incidence and mortality of lung cancer and their relationship with the development index in the world. J. Thorac. Dis. 2016, 8, 1094–1102, Erratum in J. Thorac. Dis. 2019, 11, E24. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Paez, J.G.; Janne, P.A.; Lee, J.C.; Tracy, S.; Greulich, H.; Gabriel, S.; Herman, P.; Kaye, F.J.; Lindeman, N.; Boggon, T.J.; et al. EGFR mutations in lung cancer: Correlation with clinical response to gefitinib therapy. Science 2004, 304, 1497–1500. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lynch, T.J.; Bell, D.W.; Sordella, R.; Gurubhagavatula, S.; Okimoto, R.A.; Brannigan, B.W.; Harris, P.L.; Haserlat, S.M.; Supko, J.G.; Haluska, F.G.; et al. Activating mutations in the epidermal growth factor receptor underlying responsiveness of non-small-cell lung cancer to gefitinib. N. Engl. J. Med. 2004, 350, 2129–2139. [Google Scholar] [CrossRef]
- Merker, J.D.; Oxnard, G.R.; Compton, C.; Diehn, M.; Hurley, P.; Lazar, A.J.; Lindeman, N.; Lockwood, C.M.; Rai, A.J.; Schilsky, R.L.; et al. Circulating Tumor DNA Analysis in Patients with Cancer: American Society of Clinical Oncology and College of American Pathologists Joint Review. J. Clin. Oncol. 2018, 36, 1631–1641. [Google Scholar] [CrossRef]
- The National Lung Screening Trial Research Team. Reduced lung-cancer mortality with low-dose computed tomographic screening. N. Engl. J. Med. 2011, 365, 395–409. [Google Scholar] [CrossRef] [Green Version]
- Qiu, M.; Wang, J.; Xu, Y.; Ding, X.; Li, M.; Jiang, F.; Xu, L.; Yin, R. Circulating tumor DNA is effective for the detection of EGFR mutation in non-small cell lung cancer: A meta-analysis. Cancer Epidemiol. Biomark. Prev. 2015, 24, 206–212. [Google Scholar] [CrossRef] [Green Version]
- Cabanero, M.; Tsao, M.S. Circulating tumour DNA in EGFR-mutant non-small-cell lung cancer. Curr. Oncol. 2018, 25 (Suppl. 1), S38–S44. [Google Scholar] [CrossRef] [Green Version]
- Cristofanilli, M.; Budd, G.T.; Ellis, M.J.; Stopeck, A.; Matera, J.; Miller, M.C.; Reuben, J.M.; Doyle, G.V.; Allard, W.J.; Terstappen, L.W.; et al. Circulating tumor cells, disease progression, and survival in metastatic breast cancer. N. Engl. J. Med. 2004, 351, 781–791. [Google Scholar] [CrossRef] [Green Version]
- Zamay, T.N.; Zamay, G.S.; Kolovskaya, O.S.; Zukov, R.A.; Petrova, M.M.; Gargaun, A.; Berezovski, M.V.; Kichkailo, A.S. Current and Prospective Protein Biomarkers of Lung Cancer. Cancers 2017, 9, 155. [Google Scholar] [CrossRef] [Green Version]
- Zvereva, M.; Roberti, G.; Durand, G.; Voegele, C.; Nguyen, M.D.; Delhomme, T.M.; Chopard, P.; Fabianova, E.; Adamcakova, Z.; Holcatova, I.; et al. Circulating tumour-derived KRAS mutations in pancreatic cancer cases are predominantly carried by very short fragments of cell-free DNA. EBioMedicine 2020, 55, 102462. [Google Scholar] [CrossRef]
- Liu, X.; Liu, L.; Ji, Y.; Li, C.; Wei, T.; Yang, X.; Zhang, Y.; Cai, X.; Gao, Y.; Xu, W.; et al. Enrichment of short mutant cell-free DNA fragments enhanced detection of pancreatic cancer. EBioMedicine 2019, 41, 345–356. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hudecova, I.; Smith, C.G.; Hänsel-Hertsch, R.; Chilamakuri, C.S.; Morris, J.A.; Vijayaraghavan, A.; Heider, K.; Chandrananda, D.; Cooper, W.N.; Gale, D.; et al. Characteristics, origin, and potential for cancer diagnostics of ultrashort plasma cell-free DNA. Genome Res. 2022, 32, 215–227. [Google Scholar] [CrossRef]
- Li, F.; Wei, F.; Huang, W.L.; Lin, C.C.; Li, L.; Shen, M.M.; Yan, Q.; Liao, W.; Chia, D.; Tu, M.; et al. Ultra-Short Circulating Tumor DNA (usctDNA) in Plasma and Saliva of Non-Small Cell Lung Cancer (NSCLC) Patients. Cancers 2020, 12, 2041. [Google Scholar] [CrossRef]
- Padegimas, L.S.; Reichert, N.A. Adaptor ligation-based polymerase chain reaction-mediated walking. Anal. Biochem. 1998, 260, 149–153. [Google Scholar] [CrossRef]
- Nayak, S.; Sridhara, A.; Melo, R.; Richer, L.; Chee, N.H.; Kim, J.; Linder, V.; Steinmiller, D.; Sia, S.K.; Gomes-Solecki, M. Microfluidics-based point-of-care test for serodiagnosis of Lyme Disease. Sci. Rep. 2016, 6, 35069. [Google Scholar] [CrossRef] [Green Version]
- Oliveira-Rodríguez, M.; Serrano-Pertierra, E.; García, A.C.; López-Martín, S.; Yañez-Mo, M.; Cernuda-Morollón, E.; Blanco-López, M. Point-of-care detection of extracellular vesicles: Sensitivity optimization and multiple-target detection. Biosens. Bioelectron. 2017, 87, 38–45. [Google Scholar] [CrossRef]
- Wei, F.; Lin, C.C.; Joon, A.; Feng, Z.; Troche, G.; Lira, M.E.; Chia, D.; Mao, M.; Ho, C.L.; Su, W.C.; et al. Noninvasive saliva-based EGFR gene mutation detection in patients with lung cancer. Am. J. Respir. Crit. Care Med. 2014, 190, 1117–1126. [Google Scholar] [CrossRef] [Green Version]
- Kim, C.; Xi, L.; Cultraro, C.M.; Wei, F.; Jones, G.; Cheng, J.; Shafiei, A.; Pham, T.H.T.; Roper, N.; Akoth, E.; et al. Longitudinal Circulating Tumor DNA Analysis in Blood and Saliva for Prediction of Response to Osimertinib and Disease Progression in EGFR-Mutant Lung Adenocarcinoma. Cancers 2021, 13, 3342. [Google Scholar] [CrossRef] [PubMed]
- Oxnard, G.R.; Paweletz, C.P.; Kuang, Y.; Mach, S.L.; O'Connell, A.; Messineo, M.M.; Luke, J.J.; Butaney, M.; Kirschmeier, P.; Jackman, D.M.; et al. Noninvasive detection of response and resistance in EGFR-mutant lung cancer using quantitative next-generation genotyping of cell-free plasma DNA. Clin. Cancer Res. 2014, 20, 1698–1705. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liang, W.; Zhao, Y.; Huang, W.; Gao, Y.; Xu, W.; Tao, J.; Yang, M.; Li, L.; Ping, W.; Shen, H.; et al. Non-invasive diagnosis of early-stage lung cancer using high-throughput targeted DNA methylation sequencing of circulating tumor DNA (ctDNA). Theranostics 2019, 9, 2056–2070. [Google Scholar] [CrossRef]
- Halvorsen, A.R.; Bjaanæs, M.; LeBlanc, M.; Holm, A.M.; Bolstad, N.; Rubio, L.; Peñalver, J.C.; Cervera, J.; Mojarrieta, J.C.; López-Guerrero, J.A.; et al. A unique set of 6 circulating microRNAs for early detection of non-small cell lung cancer. Oncotarget 2016, 7, 37250–37259. [Google Scholar] [CrossRef] [Green Version]
- Engelman, J.A.; Janne, P.A. Mechanisms of acquired resistance to epidermal growth factor receptor tyrosine kinase inhibitors in non-small cell lung cancer. Clin. Cancer Res. 2008, 14, 2895–2899. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gandara, D.R.; Li, T.; Lara, P.N.; Kelly, K.; Riess, J.W.; Redman, M.W.; Mack, P.C. Acquired resistance to targeted therapies against oncogene-driven non-small-cell lung cancer: Approach to subtyping progressive disease and clinical implications. Clin. Lung Cancer 2014, 15, 1–6. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Engelman, J.A.; Zejnullahu, K.; Mitsudomi, T.; Song, Y.; Hyland, C.; Park, J.O.; Lindeman, N.; Gale, C.M.; Zhao, X.; Christensen, J.; et al. MET amplification leads to gefitinib resistance in lung cancer by activating ERBB3 signaling. Science 2007, 316, 1039–1043. [Google Scholar] [CrossRef]
- Pillai, R.N.; Behera, M.; Berry, L.D.; Rossi, M.R.; Kris, M.G.; Johnson, B.E.; Bunn, P.A.; Ramalingam, S.S.; Khuri, F.R. HER2 mutations in lung adenocarcinomas: A report from the Lung Cancer Mutation Consortium. Cancer 2017, 123, 4099–4105. [Google Scholar] [CrossRef] [Green Version]
- Li, N.; Guha, U.; Kim, C.; Ye, L.; Cheng, J.; Li, F.; Chia, D.; Wei, F.; Wong, D.T. Longitudinal Monitoring of EGFR and PIK3CA Mutations by Saliva-Based EFIRM in Advanced NSCLC Patients With Local Ablative Therapy and Osimertinib Treatment: Two Case Reports. Front. Oncol. 2020, 10, 1240. [Google Scholar] [CrossRef] [PubMed]
- Tu, M.; Cheng, J.; Chen, Y.L.; Jea, W.C.; Chen, W.L.; Chen, C.J.; Ho, C.L.; Huang, W.L.; Lin, C.C.; Su, W.C.; et al. Electric Field-Induced Release and Measurement (EFIRM): Characterization and Technical Validation of a Novel Liquid Biopsy Platform in Plasma and Saliva. J. Mol. Diagn. 2020, 22, 1050–1062. [Google Scholar] [CrossRef]
- Tu, M.; Wei, F.; Yang, J.; Wong, D. Detection of exosomal biomarker by electric field-induced release and measurement (EFIRM). J. Vis. Exp. 2015, 95, e52439. [Google Scholar]
- Wei, F.; Yang, J.; Wong, D.T. Detection of exosomal biomarker by electric field-induced release and measurement (EFIRM). Biosens. Bioelectron. 2013, 44, 115–121. [Google Scholar] [CrossRef] [Green Version]
- Zheng, Q.; Ji, C.; Liu, R.; Xu, J.; Wang, Y.; Yang, A.; Zheng, W.; Cao, J. Detection of soybean transgenic event GTS-40-3-2 using electric field-induced release and measurement (EFIRM). Anal. Bioanal. Chem. 2021, 413, 6671–6676. [Google Scholar] [CrossRef] [PubMed]
- Cheng, J.; Morselli, M.; Huang, W.L.; Heo, Y.J.; Pinheiro-Ferreira, T.; Li, F.; Wei, F.; Chia, D.; Kim, Y.; He, H.J.; et al. Plasma contains ultrashort single-stranded DNA in addition to nucleosomal cell-free DNA. iScience 2022, 25, 104554. [Google Scholar] [CrossRef] [PubMed]
- Wei, F.; Patel, P.; Liao, W.; Chaudhry, K.; Zhang, L.; Arellano-Garcia, M.; Hu, S.; Elashoff, D.; Zhou, H.; Shukla, S.; et al. Electrochemical sensor for multiplex biomarkers detection. Clin. Cancer Res. 2009, 15, 4446–4452. [Google Scholar] [CrossRef] [Green Version]
- Chiang, S.H.; Tu, M.; Cheng, J.; Wei, F.; Li, F.; Chia, D.; Garner, O.; Chandrasekaran, S.; Bender, R.; Strom, C.M.; et al. Development and validation of a quantitative, non-invasive, highly sensitive and specific, electrochemical assay for anti-SARS-CoV-2 IgG antibodies in saliva. PLoS ONE 2021, 16, e0251342. [Google Scholar] [CrossRef] [PubMed]
- Chiang, S.H.; Thomas, G.A.; Liao, W.; Grogan, T.; Buck, R.L.; Fuentes, L.; Yakob, M.; Laughlin, M.J.; Schafer, C.; Nazmul-Hossain, A.; et al. RNAPro•SAL: A device for rapid and standardized collection of saliva RNA and proteins. BioTechniques 2015, 58, 69–76. [Google Scholar] [CrossRef]
- Lau, C.; Kim, Y.; Chia, D.; Spielmann, N.; Eibl, G.; Elashoff, D.; Wei, F.; Lin, Y.L.; Moro, A.; Grogan, T.; et al. Role of pancreatic cancer-derived exosomes in salivary biomarker development. J. Biol. Chem. 2013, 288, 26888–26897. [Google Scholar] [CrossRef] [Green Version]
- Wei, F.; Liao, W.; Xu, Z.; Yang, Y.; Wong, D.T.; Ho, C.M. Bio/abiotic interface constructed from nanoscale DNA dendrimer and conducting polymer for ultrasensitive biomolecular diagnosis. Small 2009, 5, 1784–1790. [Google Scholar] [CrossRef] [Green Version]
EGFR Mutation | Oligo Type | Sequence (5′-3′) |
---|---|---|
L858R | Capture probe | AAAAAAAAAAGAAATAAACAAATAAAACAATAACAAATAAAAAAAAACAAATAAACAATAAAAAAAAACAA GTTTGACCCGCCCA |
Detector probe | AAAATCTGTGATCTTGACATGCTGCGGTGTTTTCACCAG-/biotin/ | |
Ultra-short target | CTGGTGAAAACACCGCAGCATGTCAAGATCACAGATTTTGGGCGGGCCAAACTG (54 bp) | |
Ex19 deletion | Capture probe | AAAAAAAAAAAATAAAAAAAAAAAAATAAAAAAAAAAAAATAAAAAAAAAAAAATAAAAAAAAACGCTTTCGGAGATGTTTTGATAGC |
Detector probe | GACGGGAATTTTAACTTTCTCACCTTC-/biotin/ | |
Ultra-short target | GAAGGTGAGAAAGTTAAAATTCCCGTCGCTATCAAAACATCTCCGAAAGC (50 bp) | |
T790M | Capture probe | AAAAAAAAAAGAAATAAACAAATAAAACAATAACAAATAAAAAAAAACAAATAAACAATAAAAAAAAACAA GAGCGGCATGATGA |
Detector probe | GCTGCACGGTGGAGGTGAGGCAGATGCCCAGC-/biotin/ | |
Ultra-short target | GCTGGGCATCTGCCTCACCTCCACCGTGCAGCTCATCATGCAGCTCATGCCC (52 bp) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wei, F.; Yu, P.; Cheng, J.; Li, F.; Chia, D.; Wong, D.T.W. Single-Droplet Microsensor for Ultra-Short Circulating EFGR Mutation Detection in Lung Cancer Based on Multiplex EFIRM Liquid Biopsy. Int. J. Mol. Sci. 2023, 24, 10387. https://doi.org/10.3390/ijms241210387
Wei F, Yu P, Cheng J, Li F, Chia D, Wong DTW. Single-Droplet Microsensor for Ultra-Short Circulating EFGR Mutation Detection in Lung Cancer Based on Multiplex EFIRM Liquid Biopsy. International Journal of Molecular Sciences. 2023; 24(12):10387. https://doi.org/10.3390/ijms241210387
Chicago/Turabian StyleWei, Fang, Peter Yu, Jordan Cheng, Feng Li, David Chia, and David T. W. Wong. 2023. "Single-Droplet Microsensor for Ultra-Short Circulating EFGR Mutation Detection in Lung Cancer Based on Multiplex EFIRM Liquid Biopsy" International Journal of Molecular Sciences 24, no. 12: 10387. https://doi.org/10.3390/ijms241210387