Isopropoxy Benzene Guanidine Ameliorates Streptococcus suis Infection In Vivo and In Vitro
Abstract
:1. Introduction
2. Result
2.1. IBG Is a Potential Antimicrobial Agent
2.2. IBG Disrupts S. suis Cell Membrane
2.3. Significant Anti-Hemolysis Activity of IBG against S. suis
2.4. In Vivo Efficacy
3. Discussion
4. Materials and Methods
4.1. Bacterial Strains and Chemicals
4.2. Antimicrobial Susceptibility Testing
4.3. Kill Kinetic Assay
4.4. Resistance Studies
4.5. Membrane Integrity Test
4.6. Membrane Potential Assay
4.7. ΔpH Assay
4.8. ATP Determination
4.9. ROS Detection
4.10. Safety Assessment
4.11. Evaluation of the Effect of IBG on the Hemolysis Activity of the Culture Supernatant of S. suis ATCC 43765
4.12. RT-qPCR
4.13. Molecular Docking
4.14. Establishment of a Mouse Model of Intraperitoneal Infection
4.15. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Lun, Z.-R.; Wang, Q.-P.; Chen, X.-G.; Li, A.-X.; Zhu, X.-Q. Streptococcus suis: An emerging zoonotic pathogen. Lancet Infect. Dis. 2007, 7, 201–209. [Google Scholar] [CrossRef]
- Wangsomboonsiri, W.; Luksananun, T.; Saksornchai, S.; Ketwong, K.; Sungkanuparph, S. Streptococcus suis infection and risk factors for mortality. J. Infect. 2008, 57, 392–396. [Google Scholar] [CrossRef] [PubMed]
- Xu, Z.; Chen, B.; Zhang, Q.; Liu, L.; Zhang, A.; Yang, Y.; Huang, K.; Yan, S.; Yu, J.; Sun, X.; et al. Streptococcus suis 2 Transcriptional Regulator TstS Stimulates Cytokine Production and Bacteremia to Promote Streptococcal Toxic Shock-Like Syndrome. Front. Microbiol. 2018, 9, 1309. [Google Scholar] [CrossRef] [PubMed]
- Goyette-Desjardins, G.; Auger, J.-P.; Xu, J.; Segura, M.; Gottschalk, M. Streptococcus suis, an important pig pathogen and emerging zoonotic agent-an update on the worldwide distribution based on serotyping and sequence typing. Emerg. Microbes Infect. 2014, 3, e45. [Google Scholar] [CrossRef] [PubMed]
- Heath, P.J.; Hunt, B.W. Streptococcus suis serotypes 3 to 28 associated with disease in pigs. Vet. Rec. 2001, 148, 207–208. [Google Scholar] [CrossRef] [PubMed]
- Higgins, R.; Gottschalk, M.; Boudreau, M.; Lebrun, A.; Henrichsen, J. Description of six new capsular types (29–34) of Streptococcus suis. J. Vet. Diagn. Investig. 1995, 7, 405–406. [Google Scholar] [CrossRef]
- Gottschalk, M.; Higgins, R.; Jacques, M.; Beaudoin, M.; Henrichsen, J. Characterization of six new capsular types (23 through 28) of Streptococcus suis. J. Clin. Microbiol. 1991, 29, 2590–2594. [Google Scholar] [CrossRef]
- Vecht, U.; Wisselink, H.J.; Jellema, M.L.; Smith, H.E. Identification of two proteins associated with virulence of Streptococcus suis type 2. Infect. Immun. 1991, 59, 3156–3162. [Google Scholar] [CrossRef]
- Pian, Y.; Gan, S.; Wang, S.; Guo, J.; Wang, P.; Zheng, Y.; Cai, X.; Jiang, Y.; Yuan, Y. Fhb, a novel factor H-binding surface protein, contributes to the antiphagocytic ability and virulence of Streptococcus suis. Infect. Immun. 2012, 80, 2402–2413. [Google Scholar] [CrossRef]
- Hatrongjit, R.; Fittipaldi, N.; Gottschalk, M.; Kerdsin, A. Tools for Molecular Epidemiology of Streptococcus suis. Pathogens 2020, 9, 81. [Google Scholar] [CrossRef]
- Estrada, A.A.; Gottschalk, M.; Rossow, S.; Rendahl, A.; Gebhart, C.; Marthaler, D.G. Serotype and Genotype (Multilocus Sequence Type) of Streptococcus suis Isolates from the United States Serve as Predictors of Pathotype. J. Clin. Microbiol. 2019, 57, e00377-19. [Google Scholar] [CrossRef] [PubMed]
- Yongkiettrakul, S.; Wongsurawat, T.; Jenjaroenpun, P.; Acheampong, D.A.; Srimanote, P.; Maneerat, K.; Visessanguan, W.; Nookaew, I. Genome sequences of antibiotic-resistant Streptococcus suis strains isolated from human patients and diseased and asymptomatic pigs in Thailand. Infect. Genet. Evol. 2021, 87, 104674. [Google Scholar] [CrossRef]
- Weinert, L.A.; Chaudhuri, R.R.; Wang, J.; Peters, S.E.; Corander, J.; Jombart, T.; Baig, A.; Howell, K.J.; Vehkala, M.; Välimäki, N.; et al. Genomic signatures of human and animal disease in the zoonotic pathogen Streptococcus suis. Nat. Commun. 2015, 6, 6740. [Google Scholar] [CrossRef]
- Haenni, M.; Lupo, A.; Madec, J.-Y. Antimicrobial Resistance in Acinetobacter spp. and Pseudomonas spp. Microbiol. Spectr. 2018, 6, 6-3. [Google Scholar] [CrossRef] [PubMed]
- Wohlleben, W.; Mast, Y.; Stegmann, E.; Ziemert, N. Antibiotic drug discovery. Microb. Biotechnol. 2016, 9, 541–548. [Google Scholar] [CrossRef] [PubMed]
- Brown, E.D.; Wright, G.D. Antibacterial drug discovery in the resistance era. Nature 2016, 529, 336–343. [Google Scholar] [CrossRef]
- Chang, M.; Mahasenan, K.V.; Hermoso, J.A.; Mobashery, S. Unconventional Antibacterials and Adjuvants. Acc. Chem. Res. 2021, 54, 917–929. [Google Scholar] [CrossRef] [PubMed]
- Debono, M.; Barnhart, M.; Carrell, C.B.; Hoffmann, J.A.; Occolowitz, J.L.; Abbott, B.J.; Fukuda, D.S.; Hamill, R.L.; Biemann, K.; Herlihy, W.C. A21978C, a complex of new acidic peptide antibiotics: Isolation, chemistry, and mass spectral structure elucidation. J. Antibiot. (Tokyo) 1987, 40, 761–777. [Google Scholar] [CrossRef]
- Pujol, M.; Miró, J.-M.; Shaw, E.; Aguado, J.-M.; San-Juan, R.; Puig-Asensio, M.; Pigrau, C.; Calbo, E.; Montejo, M.; Rodriguez-Álvarez, R.; et al. Daptomycin Plus Fosfomycin Versus Daptomycin Alone for Methicillin-resistant Staphylococcus aureus Bacteremia and Endocarditis: A Randomized Clinical Trial. Clin. Infect. Dis. 2021, 72, 1517–1525. [Google Scholar] [CrossRef]
- Stefani, S.; Campanile, F.; Santagati, M.; Mezzatesta, M.L.; Cafiso, V.; Pacini, G. Insights and clinical perspectives of daptomycin resistance in Staphylococcus aureus: A review of the available evidence. Int. J. Antimicrob. Agents 2015, 46, 278–289. [Google Scholar] [CrossRef]
- Liu, Y.; Tong, Z.; Shi, J.; Li, R.; Upton, M.; Wang, Z. Drug repurposing for next-generation combination therapies against multidrug-resistant bacteria. Theranostics 2021, 11, 4910–4928. [Google Scholar] [CrossRef]
- Dittmar, M.; Lee, J.S.; Whig, K.; Segrist, E.; Li, M.; Kamalia, B.; Castellana, L.; Ayyanathan, K.; Cardenas-Diaz, F.L.; Morrisey, E.E.; et al. Drug repurposing screens reveal cell-type-specific entry pathways and FDA-approved drugs active against SARS-Cov-2. Cell. Rep. 2021, 35, 108959. [Google Scholar] [CrossRef] [PubMed]
- Miró-Canturri, A.; Ayerbe-Algaba, R.; Smani, Y. Drug Repurposing for the Treatment of Bacterial and Fungal Infections. Front. Microbiol. 2019, 10, 41. [Google Scholar] [CrossRef]
- Farha, M.A.; Leung, A.; Sewell, E.W.; D’Elia, M.A.; Allison, S.E.; Ejim, L.; Pereira, P.M.; Pinho, M.G.; Wright, G.D.; Brown, E.D. Inhibition of WTA synthesis blocks the cooperative action of PBPs and sensitizes MRSA to β-lactams. ACS Chem. Biol. 2013, 8, 226–233. [Google Scholar] [CrossRef] [PubMed]
- Quartararo, A.J.; Gates, Z.P.; Somsen, B.A.; Hartrampf, N.; Ye, X.; Shimada, A.; Kajihara, Y.; Ottmann, C.; Pentelute, B.L. Ultra-large chemical libraries for the discovery of high-affinity peptide binders. Nat. Commun. 2020, 11, 3183. [Google Scholar] [CrossRef]
- Song, X.; Yuan, G.; Li, P.; Cao, S. Guanidine-Containing Polyhydroxyl Macrolides: Chemistry, Biology, and Structure-Activity Relationship. Molecules 2019, 24, 3913. [Google Scholar] [CrossRef]
- Zhang, X.; Han, D.; Pei, P.; Hao, J.; Lu, Y.; Wan, P.; Peng, X.; Lv, W.; Xiong, W.; Zeng, Z. In vitro Antibacterial Activity of Isopropoxy Benzene Guanidine Against Multidrug-Resistant. Infect. Drug. Resist. 2019, 12, 3943–3953. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Xiong, W.; Peng, X.; Lu, Y.; Hao, J.; Qin, Z.; Zeng, Z. Isopropoxy Benzene Guanidine Kills Without Detectable Resistance. Front. Microbiol. 2021, 12, 633467. [Google Scholar] [CrossRef]
- Tamma, P.D.; Avdic, E.; Li, D.X.; Dzintars, K.; Cosgrove, S.E. Association of Adverse Events With Antibiotic Use in Hospitalized Patients. JAMA Intern. Med. 2017, 177, 1308–1315. [Google Scholar] [CrossRef]
- Chen, M.-T.; Lo, C.-J. Using Biophysics to Monitor the Essential Protonmotive Force in Bacteria. Adv. Exp. Med. Biol. 2016, 915, 69–79. [Google Scholar]
- Vahidi, S.; Bi, Y.; Dunn, S.D.; Konermann, L. Load-dependent destabilization of the γ-rotor shaft in FOF1 ATP synthase revealed by hydrogen/deuterium-exchange mass spectrometry. Proc. Natl. Acad. Sci. USA 2016, 113, 2412–2417. [Google Scholar] [CrossRef] [PubMed]
- Van Acker, H.; Coenye, T. The Role of Reactive Oxygen Species in Antibiotic-Mediated Killing of Bacteria. Trends Microbiol. 2017, 25, 456–466. [Google Scholar] [CrossRef]
- Giddings, K.S.; Zhao, J.; Sims, P.J.; Tweten, R.K. Human CD59 is a receptor for the cholesterol-dependent cytolysin intermedilysin. Nat. Struct. Mol. Biol. 2004, 11, 1173–1178. [Google Scholar] [CrossRef]
- Laws, M.; Shaaban, A.; Rahman, K.M. Antibiotic resistance breakers: Current approaches and future directions. FEMS Microbiol. Rev. 2019, 43, 490–516. [Google Scholar] [CrossRef] [PubMed]
- Sączewski, F.; Balewski, Ł. Biological activities of guanidine compounds, 2008–2012 update. Expert. Opin. Ther. Pat. 2013, 23, 965–995. [Google Scholar] [CrossRef]
- Salama, A.; Hasanin, M.; Hesemann, P. Synthesis and antimicrobial properties of new chitosan derivatives containing guanidinium groups. Carbohydr. Polym. 2020, 241, 116363. [Google Scholar] [CrossRef]
- Li, J.; Zhong, W.; Zhang, K.; Wang, D.; Hu, J.; Chan-Park, M.B. Biguanide-Derived Polymeric Nanoparticles Kill MRSA Biofilm and Suppress Infection. ACS Appl. Mater. Interfaces 2020, 12, 21231–21241. [Google Scholar] [CrossRef]
- Viljoen, A.; Foster, S.J.; Fantner, G.E.; Hobbs, J.K.; Dufrêne, Y.F. Scratching the Surface: Bacterial Cell Envelopes at the Nanoscale. MBio 2020, 11, e03020-19. [Google Scholar] [CrossRef] [PubMed]
- Peng, X. Application of Diaminoguanidine Derivatives and Their Feed Compositions to the Manufacture of Veterinary Medicaments. CN201980005962.7, 22 July 2019. [Google Scholar]
- DeFronzo, R.; Fleming, G.A.; Chen, K.; Bicsak, T.A. Metformin-associated lactic acidosis: Current perspectives on causes and risk. Metabolism 2016, 65, 20–29. [Google Scholar] [CrossRef]
- Bailey, C.J.; Turner, R.C. Metformin. N. Engl. J. Med. 1996, 334, 574–579. [Google Scholar] [CrossRef] [PubMed]
- Haas, B.; Grenier, D. Understanding the virulence of Streptococcus suis: A veterinary, medical, and economic challenge. Med. Mal. Infect. 2018, 48, 159–166. [Google Scholar] [CrossRef]
- Roodsant, T.J.; Van Der Putten, B.C.L.; Tamminga, S.M.; Schultsz, C.; Van Der Ark, K.C.H. Identification of putative zoonotic virulence factors: A systematic review and genomic meta-analysis. Virulence 2021, 12, 2787–2797. [Google Scholar] [CrossRef]
- Zhang, Y.; Zong, B.; Wang, X.; Zhu, Y.; Hu, L.; Li, P.; Zhang, A.; Chen, H.; Liu, M.; Tan, C. Fisetin Lowers serotype 2 Pathogenicity in Mice by Inhibiting the Heamolysis Activity of Suilysin. Front. Microbiol. 2018, 9, 1723. [Google Scholar] [CrossRef]
- Lecours, M.-P.; Gottschalk, M.; Houde, M.; Lemire, P.; Fittipaldi, N.; Segura, M. Critical role for Streptococcus suis cell wall modifications and suilysin in resistance to complement-dependent killing by dendritic cells. J. Infect. Dis. 2011, 204, 919–929. [Google Scholar] [CrossRef]
- Lu, H.; Li, X.; Wang, G.; Wang, C.; Feng, J.; Lu, W.; Wang, X.; Chen, H.; Liu, M.; Tan, C. Baicalein Ameliorates Streptococcus suis-Induced Infection In Vitro and In Vivo. Int. J. Mol. Sci. 2021, 22, 5829. [Google Scholar] [CrossRef] [PubMed]
- Wang, G.; Gao, Y.; Wu, X.; Gao, X.; Zhang, M.; Liu, H.; Fang, T. Inhibitory Effect of Piceatannol on Infection Both and. Front. Microbiol. 2020, 11, 593588. [Google Scholar] [CrossRef]
- Li, G.; Shen, X.; Wei, Y.; Si, X.; Deng, X.; Wang, J. Quercetin reduces Streptococcus suis virulence by inhibiting suilysin activity and inflammation. Int. Immunopharmacol. 2019, 69, 71–78. [Google Scholar] [CrossRef]
- Khazandi, M.; Pi, H.; Chan, W.Y.; Ogunniyi, A.D.; Sim, J.X.F.; Venter, H.; Garg, S.; Page, S.W.; Hill, P.B.; McCluskey, A.; et al. Antimicrobial Activity of Robenidine, Ethylenediaminetetraacetic Acid and Polymyxin B Nonapeptide Against Important Human and Veterinary Pathogens. Front. Microbiol. 2019, 10, 837. [Google Scholar] [CrossRef]
- Abraham, R.J.; Stevens, A.J.; Young, K.A.; Russell, C.; Qvist, A.; Khazandi, M.; Wong, H.S.; Abraham, S.; Ogunniyi, A.D.; Page, S.W.; et al. Robenidine Analogues as Gram-Positive Antibacterial Agents. J. Med. Chem. 2016, 59, 2126–2138. [Google Scholar] [CrossRef] [PubMed]
- Krollenbrock, A.; Li, Y.; Kelly, J.X.; Riscoe, M.K. Robenidine Analogues Are Potent Antimalarials in Drug-Resistant. ACS Infect. Dis. 2021, 7, 1956–1968. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Gong, S.; Dong, X.; Li, J.; Grenier, D.; Yi, L. Mixed Biofilm of and Impacts Antibiotic Susceptibility and Modulates Virulence Factor Gene Expression. Front. Microbiol. 2020, 11, 507. [Google Scholar] [CrossRef] [PubMed]
Isolate | MLST | MIC (mg/L) | ARGs |
---|---|---|---|
S. suis ATCC 43765 | / | 8 | / |
SS3 | 7 | 8 | msr(D), tet(O) |
SS12 | 850 | 8 | ant(6)-la, aac(6′)-aph(2″), erm(B), lsa€ |
SS14 | 27 | 8 | / |
SS16 | 243 | 8 | tet(O) |
SS23 | 1 | 8 | tet(O) |
SS24 | 242 | 8 | erm(B), tet(40), tet(O) |
SS25 | 308 | 8 | ant(6)-la, tet(32) |
SS26 | 839 | 8 | tet(O) |
SS28 | 25 | 8 | erm(B), tet(O) |
SS32 | 28 | 8 | erm(B), tet(O) |
SS36 | 94 | 8 | tet(O) |
SS40 | 87 | 8 | erm(B), tet(O) |
Primer | Forward Primer | Reverse Primer |
---|---|---|
16S rRNA | GTTGCGAACGGGTGAGTAA | TCTCAGGTCGGCTATGTATCG |
Sly | TCATTCAGGTGCTTATGTTGCG | GAAGATTGCGAGCATTTCCTGG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Han, N.; Li, J.; Zhao, F.; Li, Y.; Wang, J.; Dai, X.; Zeng, D.; Xiong, W.; Zeng, Z. Isopropoxy Benzene Guanidine Ameliorates Streptococcus suis Infection In Vivo and In Vitro. Int. J. Mol. Sci. 2023, 24, 7354. https://doi.org/10.3390/ijms24087354
Han N, Li J, Zhao F, Li Y, Wang J, Dai X, Zeng D, Xiong W, Zeng Z. Isopropoxy Benzene Guanidine Ameliorates Streptococcus suis Infection In Vivo and In Vitro. International Journal of Molecular Sciences. 2023; 24(8):7354. https://doi.org/10.3390/ijms24087354
Chicago/Turabian StyleHan, Ning, Jie Li, Feifei Zhao, Yangyang Li, Jun Wang, Xiaolan Dai, Dongping Zeng, Wenguang Xiong, and Zhenling Zeng. 2023. "Isopropoxy Benzene Guanidine Ameliorates Streptococcus suis Infection In Vivo and In Vitro" International Journal of Molecular Sciences 24, no. 8: 7354. https://doi.org/10.3390/ijms24087354