Lonicera caerulea Pomace Alleviates DSS-Induced Colitis via Intestinal Barrier Improvement and Gut Microbiota Modulation
Abstract
:1. Introduction
2. Materials and Methods
2.1. Chemical and Reagents
2.2. LCP Preparation and Supplemental Dose Evidence
2.3. Animal Experimental Design
2.4. Myeloperoxidase (MPO) and Enzyme-Linked Immunosorbent Assay (ELISA)
2.5. Alcian Blue and Periodic Acid–Schiff (AB-PAS) Staining
2.6. Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)
2.7. Determination of SCFAs in the Intestinal Contents
2.8. Fecal Microbial Gene Sequencing and Analysis
2.9. Statistical Analysis
3. Results
3.1. LCP-Ameliorated Colitis Symptoms
3.2. LCP Restored Damage to Colon Tissues and Modulated the Inflammatory Response Associated with Colitis
3.3. Protective Effects of LCP on the Intestinal Barrier
3.4. Modulation of LCP on Gut Microbiota
3.5. Effect of LCP on SCFAs in Intestinal Contents of Colitis Mice
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Ng, S.C.; Shi, H.Y.; Hamidi, N.; Underwood, F.E.; Tang, W.; Benchimol, E.I.; Panaccione, R.; Ghosh, S.; Wu, J.C.Y.; Chan, F.K.L.; et al. Worldwide incidence and prevalence of inflammatory bowel disease in the 21st century: A systematic review of population-based studies. Lancet 2017, 390, 2769–2778. [Google Scholar] [CrossRef]
- Chang, J.T. Pathophysiology of Inflammatory Bowel Diseases. N. Engl. J. Med. 2020, 383, 2652–2664. [Google Scholar] [CrossRef]
- Eom, T.; Kim, Y.S.; Choi, C.H.; Sadowsky, M.J.; Unno, T. Current understanding of microbiota- and dietary-therapies for treating inflammatory bowel disease. J. Microbiol. 2018, 56, 189–198. [Google Scholar] [CrossRef] [PubMed]
- Sehgal, P.; Colombel, J.F.; Aboubakr, A.; Narula, N. Systematic review: Safety of mesalazine in ulcerative colitis. Aliment. Pharmacol. Ther. 2018, 47, 1597–1609. [Google Scholar] [CrossRef]
- Lewis, J.D.; Abreu, M.T. Diet as a Trigger or Therapy for Inflammatory Bowel Diseases. Gastroenterology 2017, 152, 398–414.e6. [Google Scholar] [CrossRef] [PubMed]
- Llewellyn, S.R.; Britton, G.J.; Contijoch, E.J.; Vennaro, O.H.; Mortha, A.; Colombel, J.F.; Grinspan, A.; Clemente, J.C.; Merad, M.; Faith, J.J. Interactions Between Diet and the Intestinal Microbiota Alter Intestinal Permeability and Colitis Severity in Mice. Gastroenterology 2018, 154, 1037–1046.e2. [Google Scholar] [CrossRef] [PubMed]
- Ananthakrishnan, A.N. Epidemiology and risk factors for IBD. Nat. Rev. Gastroenterol. Hepatol. 2015, 12, 205–217. [Google Scholar] [CrossRef] [PubMed]
- Han, Y.; Song, M.; Gu, M.; Ren, D.; Zhu, X.; Cao, X.; Li, F.; Wang, W.; Cai, X.; Yuan, B.; et al. Dietary Intake of Whole Strawberry Inhibited Colonic Inflammation in Dextran-Sulfate-Sodium-Treated Mice via Restoring Immune Homeostasis and Alleviating Gut Microbiota Dysbiosis. J. Agric. Food Chem. 2019, 67, 9168–9177. [Google Scholar] [CrossRef]
- Machado, A.; Geraldi, M.V.; do Nascimento, R.P.; Moya, A.; Vezza, T.; Diez-Echave, P.; Galvez, J.J.; Cazarin, C.B.B.; Marostica Junior, M.R. Polyphenols from food by-products: An alternative or complementary therapy to IBD conventional treatments. Food Res. Int. 2021, 140, 110018. [Google Scholar] [CrossRef]
- Scheppach, W.; Luehrs, H.; Melcher, R.; Gostner, A.; Schauber, J.; Kudlich, T.; Weiler, F.; Menzel, T. Antiinflammatory and anticarcinogenic effects of dietary fibre. Clin. Nutr. Suppl. 2004, 1, 51–58. [Google Scholar] [CrossRef]
- Kaulmann, A.; Bohn, T. Bioactivity of Polyphenols: Preventive and Adjuvant Strategies toward Reducing Inflammatory Bowel Diseases-Promises, Perspectives, and Pitfalls. Oxidative Med. Cell. Longev. 2016, 2016, 9346470. [Google Scholar] [CrossRef] [PubMed]
- Williamson, G.; Clifford, M.N. Role of the small intestine, colon and microbiota in determining the metabolic fate of polyphenols. Biochem. Pharmacol. 2017, 139, 24–39. [Google Scholar] [CrossRef]
- Goni, I.; Serrano, J. The intake of dietary fiber from grape seeds modifies the antioxidant status in rat cecum. J. Sci. Food Agric. 2005, 85, 1877–1881. [Google Scholar] [CrossRef]
- Koh, A.; De Vadder, F.; Kovatcheva-Datchary, P.; Backhed, F. From Dietary Fiber to Host Physiology: Short-Chain Fatty Acids as Key Bacterial Metabolites. Cell 2016, 165, 1332–1345. [Google Scholar] [CrossRef]
- Wang, W.; Kou, F.; Wang, J.; Quan, Z.; Zhao, S.; Wang, Y.; Hu, X.; Sun, H.; Cao, L. Pretreatment with millet-derived selenylated soluble dietary fiber ameliorates dextran sulfate sodium-induced colitis in mice by regulating inflammation and maintaining gut microbiota balance. Front. Nutr. 2022, 9, 928601. [Google Scholar] [CrossRef] [PubMed]
- Maurer, L.H.; Cazarin, C.B.B.; Quatrin, A.; Minuzzi, N.M.; Costa, E.L.; Morari, J.; Velloso, L.A.; Leal, R.F.; Rodrigues, E.; Bochi, V.C.; et al. Grape peel powder promotes intestinal barrier homeostasis in acute TNBS-colitis: A major role for dietary fiber and fiber-bound polyphenols. Food Res. Int. 2019, 123, 425–439. [Google Scholar] [CrossRef] [PubMed]
- Golba, M.; Sokol-Letowska, A.; Kucharska, A.Z. Health Properties and Composition of Honeysuckle Berry Lonicera caerulea L. An Update on Recent Studies. Molecules 2020, 25, 749. [Google Scholar] [CrossRef]
- Cesoniene, L.; Labokas, J.; Jasutiene, I.; Sarkinas, A.; Kaskoniene, V.; Kaskonas, P.; Kazernaviciute, R.; Pazereckaite, A.; Daubaras, R. Bioactive Compounds, Antioxidant, and Antibacterial Properties of Lonicera caerulea Berries: Evaluation of 11 Cultivars. Plants 2021, 10, 624. [Google Scholar] [CrossRef]
- Oszmiański, J.; Wojdyło, A.; Lachowicz, S. Effect of dried powder preparation process on polyphenolic content and antioxidant activity of blue honeysuckle berries (Lonicera caerulea L. var. kamtschatica). LWT—Food Sci. Technol. 2016, 67, 214–222. [Google Scholar] [CrossRef]
- Kim, J.Y.; Lee, Y.S.; Park, E.J.; Lee, H.J. Honeysuckle Berry (Lonicera caerulea L.) Inhibits Lipase Activity and Modulates the Gut Microbiota in High-Fat Diet-Fed Mice. Molecules 2022, 27, 4731. [Google Scholar] [CrossRef]
- Lee, Y.S.; Park, E.J.; Kim, S.M.; Kim, J.Y.; Lee, H.J. Anti-Sarcopenic Obesity Effects of Lonicera caerulea Extract in High-Fat Diet-Fed Mice. Antioxidants 2021, 10, 1633. [Google Scholar] [CrossRef] [PubMed]
- Wu, S.; Hu, R.; Nakano, H.; Chen, K.; Liu, M.; He, X.; Zhang, H.; He, J.; Hou, D.X. Modulation of Gut Microbiota by Lonicera caerulea L. Berry Polyphenols in a Mouse Model of Fatty Liver Induced by High Fat Diet. Molecules 2018, 23, 3213. [Google Scholar] [CrossRef] [PubMed]
- Li, B.; Cheng, Z.; Sun, X.; Si, X.; Gong, E.; Wang, Y.; Tian, J.; Shu, C.; Ma, F.; Li, D.; et al. Lonicera caerulea L. Polyphenols Alleviate Oxidative Stress-Induced Intestinal Environment Imbalance and Lipopolysaccharide-Induced Liver Injury in HFD-Fed Rats by Regulating the Nrf2/HO-1/NQO1 and MAPK Pathways. Mol. Nutr. Food Res. 2020, 64, e1901315. [Google Scholar] [CrossRef] [PubMed]
- González-Sarrías, A.; Espín, J.C.; Tomás-Barberán, F.A. Non-extractable polyphenols produce gut microbiota metabolites that persist in circulation and show anti-inflammatory and free radical-scavenging effects. Trends Food Sci. Technol. 2017, 69, 281–288. [Google Scholar] [CrossRef]
- McCleary, B.V.; DeVries, J.W.; Rader, J.I.; Cohen, G.; Prosky, L.; Mugford, D.C.; Champ, M.; Okuma, K. Determination of Insoluble, Soluble, and Total Dietary Fiber (CODEX Definition) by Enzymatic-Gravimetric Method and Liquid Chromatography: Collaborative Study. J. AOAC Int. 2019, 95, 824–844. [Google Scholar] [CrossRef]
- House, S.D.; Collaborators. Determination of Total, Saturated, and Monounsaturated Fats In Foodstuffs by Hydrolytic Extraction and Gas Chromatographic Quantitation: Collaborative Study. J. AOAC Int. 2020, 80, 555–563. [Google Scholar] [CrossRef]
- Lynch, J.M.; Barbano, D.M. Kjeldahl Nitrogen Analysis as a Reference Method for Protein Determination in Dairy Products. J. AOAC Int. 2020, 82, 1389–1398. [Google Scholar] [CrossRef]
- Latimer, G.W. Official Methods of Analysis of AOAC International; Oxford University Press: Oxford, UK, 2023. [Google Scholar]
- BeMiller, J.N. Carbohydrate Analysis. In Food Analysis; Nielsen, S.S., Ed.; Springer International Publishing: Cham, Switzerland, 2017; pp. 333–360. [Google Scholar]
- Kawabata, A.; Van Hung, T.; Nagata, Y.; Fukuda, N.; Suzuki, T. Citrus kawachiensis Peel Powder Reduces Intestinal Barrier Defects and Inflammation in Colitic Mice. J. Agric. Food Chem. 2018, 66, 10991–10999. [Google Scholar] [CrossRef]
- Tinh, N.T.T.; Sitolo, G.C.; Yamamoto, Y.; Suzuki, T. Citrus limon Peel Powder Reduces Intestinal Barrier Defects and Inflammation in a Colitic Murine Experimental Model. Foods 2021, 10, 240. [Google Scholar] [CrossRef]
- Reagan-Shaw, S.; Nihal, M.; Ahmad, N. Dose translation from animal to human studies revisited. FASEB J. 2008, 22, 659–661. [Google Scholar] [CrossRef]
- Wirtz, S.; Popp, V.; Kindermann, M.; Gerlach, K.; Weigmann, B.; Fichtner-Feigl, S.; Neurath, M.F. Chemically induced mouse models of acute and chronic intestinal inflammation. Nat. Protoc. 2017, 12, 1295–1309. [Google Scholar] [CrossRef] [PubMed]
- Steedman, H.F. Alcian Blue 8GS: A New Stain for Mucin. J. Cell Sci. 1950, s3-91, 477–479. [Google Scholar] [CrossRef]
- Zeisel, M.B.; Dhawan, P.; Baumert, T.F. Tight junction proteins in gastrointestinal and liver disease. Gut 2019, 68, 547–561. [Google Scholar] [CrossRef] [PubMed]
- Aratani, Y. Myeloperoxidase: Its role for host defense, inflammation, and neutrophil function. Arch. Biochem. Biophys. 2018, 640, 47–52. [Google Scholar] [CrossRef] [PubMed]
- Bramhall, M.; Florez-Vargas, O.; Stevens, R.; Brass, A.; Cruickshank, S. Quality of methods reporting in animal models of colitis. Inflamm. Bowel Dis. 2015, 21, 1248–1259. [Google Scholar] [CrossRef]
- Wu, S.; Yano, S.; Chen, J.; Hisanaga, A.; Sakao, K.; He, X.; He, J.; Hou, D.X. Polyphenols from Lonicera caerulea L. Berry Inhibit LPS-Induced Inflammation through Dual Modulation of Inflammatory and Antioxidant Mediators. J. Agric. Food Chem. 2017, 65, 5133–5141. [Google Scholar] [CrossRef]
- Bhutia, Y.D.; Ganapathy, V. Short, but Smart: SCFAs Train T Cells in the Gut to Fight Autoimmunity in the Brain. Immunity 2015, 43, 629–631. [Google Scholar] [CrossRef] [PubMed]
- Tan, J.; McKenzie, C.; Potamitis, M.; Thorburn, A.N.; Mackay, C.R.; Macia, L. The role of short-chain fatty acids in health and disease. Adv. Immunol. 2014, 121, 91–119. [Google Scholar] [CrossRef]
- Yao, Y.; Cai, X.; Fei, W.; Ye, Y.; Zhao, M.; Zheng, C. The role of short-chain fatty acids in immunity, inflammation and metabolism. Crit. Rev. Food Sci. Nutr. 2022, 62, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Makki, K.; Deehan, E.C.; Walter, J.; Backhed, F. The Impact of Dietary Fiber on Gut Microbiota in Host Health and Disease. Cell Host Microbe 2018, 23, 705–715. [Google Scholar] [CrossRef]
- Li, G.; Lin, J.; Zhang, C.; Gao, H.; Lu, H.; Gao, X.; Zhu, R.; Li, Z.; Li, M.; Liu, Z. Microbiota metabolite butyrate constrains neutrophil functions and ameliorates mucosal inflammation in inflammatory bowel disease. Gut Microbes 2021, 13, 1968257. [Google Scholar] [CrossRef] [PubMed]
- Konikoff, T.; Gophna, U. Oscillospira: A Central, Enigmatic Component of the Human Gut Microbiota. Trends Microbiol. 2016, 24, 523–524. [Google Scholar] [CrossRef] [PubMed]
- Polansky, O.; Sekelova, Z.; Faldynova, M.; Sebkova, A.; Sisak, F.; Rychlik, I. Important Metabolic Pathways and Biological Processes Expressed by Chicken Cecal Microbiota. Appl. Environ. Microbiol. 2015, 82, 1569–1576. [Google Scholar] [CrossRef] [PubMed]
- Hiippala, K.; Barreto, G.; Burrello, C.; Diaz-Basabe, A.; Suutarinen, M.; Kainulainen, V.; Bowers, J.R.; Lemmer, D.; Engelthaler, D.M.; Eklund, K.K.; et al. Novel Odoribacter splanchnicus Strain and Its Outer Membrane Vesicles Exert Immunoregulatory Effects in vitro. Front. Microbiol. 2020, 11, 575455. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Gao, N.; Nieto-Veloza, A.; Zhou, L.; Sun, X.; Si, X.; Tian, J.; Lin, Y.; Jiao, X.; Li, B. Lonicera caerulea polyphenols inhibit fat absorption by regulating Nrf2-ARE pathway mediated epithelial barrier dysfunction and special microbiota. Food Sci. Hum. Wellness 2023, 12, 1309–1322. [Google Scholar] [CrossRef]
- Clemente, J.C.; Manasson, J.; Scher, J.U. The role of the gut microbiome in systemic inflammatory disease. BMJ 2018, 360, j5145. [Google Scholar] [CrossRef]
- Wu, X.M.; Tan, R.X. Interaction between gut microbiota and ethnomedicine constituents. Nat. Prod. Rep. 2019, 36, 788–809. [Google Scholar] [CrossRef]
- Beller, A.; Kruglov, A.; Durek, P.; von Goetze, V.; Hoffmann, U.; Maier, R.; Heiking, K.; Siegmund, B.; Heinz, G.A.; Mashreghi, M.F.; et al. Anaeroplasma, A Potential Anti-Inflammatory Probiotic for the Treatment of Chronic Intestinal Inflammation. Ann. Rheum. Dis. 2019, 78, A45–A46. [Google Scholar] [CrossRef]
- Ibrahim, A.; Hugerth, L.W.; Hases, L.; Saxena, A.; Seifert, M.; Thomas, Q.; Gustafsson, J.-Å.; Engstrand, L.; Williams, C. Colitis-induced colorectal cancer and intestinal epithelial estrogen receptor beta impact gut microbiota diversity. Int. J. Cancer 2019, 144, 3086–3098. [Google Scholar] [CrossRef]
- Gates, T.J.; Yuan, C.; Shetty, M.; Kaiser, T.; Nelson, A.C.; Chauhan, A.; Starr, T.K.; Staley, C.; Subramanian, S. Fecal Microbiota Restoration Modulates the Microbiome in Inflammation-Driven Colorectal Cancer. Cancers 2023, 15, 2260. [Google Scholar] [CrossRef]
- Wang, R.; Cao, S.; Bashir, M.E.H.; Hesser, L.A.; Su, Y.; Hong, S.M.C.; Thompson, A.; Culleen, E.; Sabados, M.; Dylla, N.P.; et al. Treatment of peanut allergy and colitis in mice via the intestinal release of butyrate from polymeric micelles. Nat. Biomed. Eng. 2023, 7, 38–55. [Google Scholar] [CrossRef] [PubMed]
- Chen, G.; Ran, X.; Li, B.; Li, Y.; He, D.; Huang, B.; Fu, S.; Liu, J.; Wang, W. Sodium Butyrate Inhibits Inflammation and Maintains Epithelium Barrier Integrity in a TNBS-induced Inflammatory Bowel Disease Mice Model. EBioMedicine 2018, 30, 317–325. [Google Scholar] [CrossRef] [PubMed]
- Desai, M.S.; Seekatz, A.M.; Koropatkin, N.M.; Kamada, N.; Hickey, C.A.; Wolter, M.; Pudlo, N.A.; Kitamoto, S.; Terrapon, N.; Muller, A.; et al. A Dietary Fiber-Deprived Gut Microbiota Degrades the Colonic Mucus Barrier and Enhances Pathogen Susceptibility. Cell 2016, 167, 1339–1353 e1321. [Google Scholar] [CrossRef]
- Paone, P.; Cani, P.D. Mucus barrier, mucins and gut microbiota: The expected slimy partners? Gut 2020, 69, 2232–2243. [Google Scholar] [CrossRef]
- Derrien, M.; Vaughan, E.E.; Plugge, C.M.; de Vos, W.M. Akkermansia muciniphila gen. nov., sp. nov., a human intestinal mucin-degrading bacterium. Int. J. Syst. Evol. Microbiol. 2004, 54, 1469–1476. [Google Scholar] [CrossRef] [PubMed]
- Taira, T.; Yamaguchi, S.; Takahashi, A.; Okazaki, Y.; Yamaguchi, A.; Sakaguchi, H.; Chiji, H. Dietary polyphenols increase fecal mucin and immunoglobulin A and ameliorate the disturbance in gut microbiota caused by a high fat diet. J. Clin. Biochem. Nutr. 2015, 57, 212–216. [Google Scholar] [CrossRef]
- Anhe, F.F.; Pilon, G.; Roy, D.; Desjardins, Y.; Levy, E.; Marette, A. Triggering Akkermansia with dietary polyphenols: A new weapon to combat the metabolic syndrome? Gut Microbes 2016, 7, 146–153. [Google Scholar] [CrossRef]
- Maurer, L.H.; Cazarin, C.B.B.; Quatrin, A.; Nichelle, S.M.; Minuzzi, N.M.; Teixeira, C.F.; Manica da Cruz, I.B.; Maróstica Júnior, M.R.; Emanuelli, T. Dietary fiber and fiber-bound polyphenols of grape peel powder promote GSH recycling and prevent apoptosis in the colon of rats with TNBS-induced colitis. J. Funct. Foods 2020, 64, 103644. [Google Scholar] [CrossRef]
- David, L.A.; Maurice, C.F.; Carmody, R.N.; Gootenberg, D.B.; Button, J.E.; Wolfe, B.E.; Ling, A.V.; Devlin, A.S.; Varma, Y.; Fischbach, M.A.; et al. Diet rapidly and reproducibly alters the human gut microbiome. Nature 2014, 505, 559–563. [Google Scholar] [CrossRef]
- Sartor, R.B. Mechanisms of disease: Pathogenesis of Crohn’s disease and ulcerative colitis. Nat. Clin. Pract. Gastroenterol. Hepatol. 2006, 3, 390–407. [Google Scholar] [CrossRef]
- Herp, S.; Durai Raj, A.C.; Salvado Silva, M.; Woelfel, S.; Stecher, B. The human symbiont Mucispirillum schaedleri: Causality in health and disease. Med. Microbiol. Immunol. 2021, 210, 173–179. [Google Scholar] [CrossRef] [PubMed]
- Berry, D.; Schwab, C.; Milinovich, G.; Reichert, J.; Ben Mahfoudh, K.; Decker, T.; Engel, M.; Hai, B.; Hainzl, E.; Heider, S.; et al. Phylotype-level 16S rRNA analysis reveals new bacterial indicators of health state in acute murine colitis. ISME J. 2012, 6, 2091–2106. [Google Scholar] [CrossRef] [PubMed]
AIN-93M | 5% LCP Diet (P5) | 10% LCP Diet (P10) | ||||
---|---|---|---|---|---|---|
g | kcal | g | kcal | g | kcal | |
Casein | 140 | 560 | 135.5 | 542 | 130.9 | 523.6 |
Corn starch | 465.69 | 1862.77 | 449.7 | 1798.8 | 433.2 | 1732.8 |
Maltodextrin | 155 | 620 | 155 | 620 | 155 | 620 |
Sucrose | 100 | 400 | 100 | 400 | 100 | 400 |
Soybean oil | 40 | 360 | 38.7 | 348.3 | 37.35 | 336.15 |
Cellulose | 50 | - | 50 | - | 50 | - |
Mineral | 35 | - | 35 | - | 35 | - |
Vitamin | 10 | - | 10 | - | 10 | - |
L-cysteine | 1.8 | - | 1.8 | - | 1.8 | - |
Choline Bitartrate | 2.5 | - | 2.5 | - | 2.5 | - |
TBHQ | 0.008 | - | 0.008 | - | 0.008 | - |
LCP | - | - | 52 | 113.41 | 106 | 231.19 |
Total | 1000 | 3802.77 | 1030.21 | 3822.51 | 1061.76 | 3843.74 |
Calorie (%) | ||||||
Lipids | 9.47 | 9.42 | 9.36 | |||
Protein | 14.73 | 14.60 | 14.47 | |||
Carbohydrates | 75.81 | 75.21 | 74.60 |
Gene | Sequences (5′ to 3′) | |
---|---|---|
Forward Primer | Reverse Primer | |
β-actin | TGTCCACCTTCCAGCAGATGT | AGCTCAGTAACAGTCCGCCTAGA |
TNF-α | TGCTTTCTGTGCTCATGGTG | GACTAGCCAGGAGGGAGAAC |
IL-1β | ACTCATTGTGGCTGTGGAGA | AGCCTGTAGTGCAGTTGTCT |
IL-6 | ACTTCACAAGTCCGGAGAGG | TGCAAGTGCATCATCGTTGT |
Muc2 | ACGTGTCATATTTGCACCTCT | TCAACATTGAGAGTGCCAACT |
Claudin-1 | ACGGTCTTTGCACTTTGGTC | GGGAGAGGAGAAGCACAGTT |
Occludin | TGCGGTGACTTCTCCAAACT | GGGGAACGTGGCCGATAT |
ZO-1 | TCTTCCATCATTTCGCTGTGT | TCTGAAACCATCAAGTCCACA |
Composition (g/100 g of Dry Weight) | LCP (%) |
---|---|
Ash | 1.95 ± 0.02 1 |
Lipids | 3.73 ± 0.06 |
Protein | 11.43 ± 0.13 |
Carbohydrates | 40.29 ± 0.18 |
Soluble sugar | 18.44 ± 0.13 |
Fructose | 8.37 ± 0.04 |
Glucose | 10.07 ± 0.12 |
Sucrose | ND 2 |
Maltose | ND |
Dietary fiber | 42.60 ± 0.18 |
Soluble fiber | 13.29 ± 0.08 |
Insoluble fiber | 29.31 ± 0.13 |
Total polyphenol | 9.00 ± 0.07 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, B.; Huang, X.; Niu, L.; Chen, X.; Hu, B.; Tang, X. Lonicera caerulea Pomace Alleviates DSS-Induced Colitis via Intestinal Barrier Improvement and Gut Microbiota Modulation. Foods 2023, 12, 3329. https://doi.org/10.3390/foods12183329
Zhang B, Huang X, Niu L, Chen X, Hu B, Tang X. Lonicera caerulea Pomace Alleviates DSS-Induced Colitis via Intestinal Barrier Improvement and Gut Microbiota Modulation. Foods. 2023; 12(18):3329. https://doi.org/10.3390/foods12183329
Chicago/Turabian StyleZhang, Baixi, Xinwen Huang, Lijuan Niu, Xuemei Chen, Bo Hu, and Xiaoshu Tang. 2023. "Lonicera caerulea Pomace Alleviates DSS-Induced Colitis via Intestinal Barrier Improvement and Gut Microbiota Modulation" Foods 12, no. 18: 3329. https://doi.org/10.3390/foods12183329