Fluorescent Anemones in Japan—Comprehensive Revision of Japanese Actinernoidea (Cnidaria: Anthozoa: Actiniaria: Anenthemonae) with Rearrangements of the Classification

Izumi, Takato; Fujii, Takuma; Yanagi, Kensuke; Fujita, Toshihiko

doi:10.3390/d15060773

Open AccessArticle

Fluorescent Anemones in Japan—Comprehensive Revision of Japanese Actinernoidea (Cnidaria: Anthozoa: Actiniaria: Anenthemonae) with Rearrangements of the Classification^†

¹

Department of Marine Bio-Science, Faculty of Life Science and Biotechnology, Fukuyama University, 985 Sanzo, Higashi-Mura Cho, Fukuyama City 729-0292, Hiroshima, Japan

²

Kagoshima City Aquarium, 3-1 Honko-shinmachi, Kagoshima City 892-0814, Kagoshima, Japan

³

Coastal Branch of Natural History Museum and Institute, Chiba, 123 Yoshio, Katsuura City 299-5242, Chiba, Japan

⁴

Department of Zoology, National Museum of Nature and Science, 4-1-1 Amakubo, Tsukuba City 305-0005, Ibaraki, Japan

^*

Author to whom correspondence should be addressed.

^†

ZooBank: urn:lsid:zoobank.org:pub:6B21106E-E211-4DC0-BCFD-6208E6DDFEC8.

Diversity 2023, 15(6), 773; https://doi.org/10.3390/d15060773

Submission received: 31 March 2023 / Revised: 6 June 2023 / Accepted: 7 June 2023 / Published: 13 June 2023

(This article belongs to the Special Issue Diversity, Phylogeny and Evolutionary History of Cnidaria)

Abstract

:

Actinernoidea is a superfamily of the suborder Anenthemonae of the order Actiniaria, subclass Hexacorallia. This superfamily has been diagnosed by a peculiar endocoeletic mesenterial arrangement and included two families, Actinernidae and Halcuriidae. Although the monophyly of this superfamily is anticipated based on preceding molecular phylogenetic works, the relationship between these two families was not certain because of the rarity of actinernoidean anemones. We conducted comprehensive sampling in Japan, where the highest diversity of actinernoideans is known, and conducted phylogenetic analyses using nuclear and mitochondrial gene markers. According to the comprehensive analyses, both Actinernidae and Halcuriidae were not indicated as monophyletic but rather as poly- or paraphyletic. Based on our phylogeny reconstruction, we propose a new classification for Actinernoidea composed of three families, including Isactinernidae fam. nov., and seven genera, including Isohalcurias gen. nov. We also describe four new species, Halcurias hiroomii sp. nov., H. fragum sp. nov., Isohalcurias citreum sp. nov., and I. malum sp. nov.; and propose a new combination, Isohalcurias carlgreni comb. nov. This work is the first study of Actinernoidea that comprehensively analyzes its phylogeny and rearranges its classification, showing that there is highly divergent fauna in the seas around Japan.

Keywords:

systematics; new family; new genus; new species; redescription; aquarium; deep sea; monograph; actinernid; halcuriid

1. Introduction

Sea anemones are well-known marine animals that belong to the order Actiniaria Hertwig, 1882, of the class Anthozoa of the phylum Cnidaria. Actiniaria currently contains approximately 1100 valid species from 264 genera of 50 families [1]. All sea anemones consist of solitary individual polyps, whereas other anthozoans often form colonies of zooids. Sea anemones have only a few reliable taxonomic characters, and therefore, researchers have often been puzzled by their taxonomy and have struggled to correctly classify them by morphology [2]. Their taxonomy is mainly based on the arrangement of mesenteries, which are prominent structures in the bodies of sea anemones and develop in the direction of the distal–proximal axis and separate the actiniarian coelenteron into partitions. Mesenteries are distinguished into two types: macrocnemes, which are usually distinct and develop several structures such as retractor muscles, gonads, and filaments, and microcnemes, which are small and without these structures [2,3]. The mesenteries usually form pairs with one another and develop in a particular cyclic pattern (Figure 1): first, eight macrocnemes are formed (Figure 1A), and later, another four macrocnemes develop (Figure 1B). These 12 macrocnemes (mesenteries indicated as d, ld, lv, and v in Figure 1B) are called “mesenteries in the first cycle”. Subsequently, mesenteries of the second cycle develop between the mesenteries in the first cycle (Figure 1C,D), and younger mesenteries continue to develop. These arrangements of mesenteries differ depending on species and genera and are thus considered as among the most important taxonomic characters of sea anemones. In general, the thicker and larger the column of sea anemones, the more numerous the macrocnemes [4].

In this study, we mainly focused on the superfamily Actinernoidea. This superfamily is characterized by a peculiar mesenterial arrangement: mesenteries of the second and younger mesenterial cycles originate in the endocoels in the first cycle (Figure 1C). In contrast, in all other anemones (except anemones in which mesenteries in the first cycle are less than twelve, such as Edwardsiidae Andres, 1881, or Halcampulactinidae, Gusmão et al., 2019; Figure 1B), these mesenteries develop in exocoels (Figure 1D) [2,5,6]. In addition, some species are characterized by the presence of nematocyst batteries and spirocysts on their column. At present, Actinernoidea includes two families: Actinernidae Stephenson, 1922, and Halcuriidae Carlgren, 1918 [7,8]. They are distinguished by the number of siphonoglyphs attached to the actinopharynx (two siphonoglyphs for Actinernidae and only one for Halcuriidae) and the number of macrocnemes (twenty for Halcuriidae and more than twenty for Actinernidae).

Originally, in the classification by Carlgren [4,9], the first comprehensive classification system of the order Actiniaria, Actinernidae and Halcuriidae were accommodated in the independent suborder Endocoelantheae Carlgren, 1925, because of the peculiar mesenterial arrangements. This classification was used in subsequent studies [10,11,12], until recently. However, Rodríguez et al. (2014) [13], in the most comprehensive analysis of Actiniaria so far, included all higher taxa in the classification system of Carlgren and revealed that Endocoelantheae was closely related to the family Edwardsiidae of the suborder Anenthemonae on the basis of a molecular phylogeny reconstruction. The conclusion was that Endocoelantheae was a part of the suborder Anenthemonae Rodriguez and Daly, 2014. Thus, Rodríguez et al. maintained the lower taxon of Anenthemonae, accommodating Actinernidae and Halcuriidae, by reviving the superfamily Actinernoidea Stephenson, 1922 [13]. At present, both families are treated as members of the superfamily Actinernoidea of the suborder Anenthemonae. However, this classification system also has some taxonomic problems. The taxon sampling in Rodríguez et al. (2014) was still not complete. Their phylogenetic analyses contained few species of Actinernoidea: only three actinerniid species in three genera and only one halcuriid species. After that, Izumi et al. [14] added two more species to the phylogenetic tree, but there was still a lack of genetic information that would be needed to conduct a comprehensive revision of Actinernoidea. Thus, phylogenetic studies on this superfamily have not been sufficient yet. Hence, comprehensive taxon sampling of each lower taxa is required to obtain a better phylogeny reconstruction of Anenthemonae.

Actinernoidea has a relatively rich diversity in Japan: six species of four genera of Actinernidae and three species of Halcurias McMurrich, 1893, of Halcuriidae (Table 1) [11,12,14,15]. However, two of the three species of Halcurias newly described in Uchida (2004) [11] are regarded as invalid nomina nuda indicated by * in Table 1) [1,2], and additionally, there have been several anemones of Actinernoidea considered to be undescribed species collected from the oceans around Japan.

In this study, we conducted comprehensive sampling of Actinernoidea anemones from Japan. We observed the detailed morphology of the collected specimens, specifically identified them, and provided detailed descriptions. In addition, we established new systematics of Actinernoidea by using molecular phylogeny with sufficient taxon sampling and sufficient DNA markers. These analyses resulted in a comprehensive revision of superfamily Actinernoidea: the new family Isactinernidae fam. nov. and the new genus Isohalcurias gen. nov. are established; four new species, Halcurias hiroomii sp. nov., Halcurias fragum sp. nov., Isohalcurias citreum sp. nov., and Isohalcurias malum sp. nov. are formally described. Concerning existing taxa, genus Synactinernus Carlgren, 1918, is moved from Actinernidae to Halcuriidae and genera Isactinernus Carlgren, 1918, and Synhalcurias Carlgren, 1914, have been moved to Isactinernidae fam. nov.; some species of Halcurias are moved to Isohalcurias gen. nov.; and the nomina nuda of two species of Halcurias are completely resolved by their redescription as new species. From the present study, it is confirmed that there are eleven species in six genera of three families of Actinernoidea in the waters around Japan.

2. Materials and Methods

2.1. Sample Collection and Preservation

We collected all specimens from Japanese waters. All sampling localities are shown in Figure 2. The specimens in this study were obtained by scuba diving, dredging, or trawling by research vessels (R/V), fishing boats, or remotely operated vehicles (ROV). Some specimens attached to substrates were usually detached from substrates using fingers or spatulas, but occasionally collected with pieces of substrates. The collected specimens were preserved using several methods: sufficiently healthy specimens were kept alive in calm water in cases, aquaria, or tanks until they elongated their tentacles. Images in vitro were captured to record their external forms, colors, and sizes in vivo. Subsequently, they were anesthetized using a magnesium chloride solution. After they were completely anesthetized, small pieces of tissue for DNA analyses were dissected from their tentacles and preserved in 99% ethanol. Remaining polyps were fixed in 10–20% (v/v) formalin sea water solution for morphological analyses. Occasionally, specimens were directly preserved in ethanol or formalin solution if they were weakened, damaged, or almost dead. Polyps fixed in formalin solution were immersed into 70% ethanol after they were completely preserved. For DNA analyses, we also obtained tissues of tentacles from some living polyps from Okinawa Churaumi Aquarium (Motobu, Okinawa) and preserved them in 99% ethanol. Specimens have been deposited at the National Museum of Nature and Science (NSMT), Tokyo, and the Coastal Branch of Natural History Museum and Institute (CMNH), Chiba. In addition, some type specimens were observed in the museums in which they had been deposited: Museum of Evolution Zoology, Uppsala University (UUZM), The Swedish Museum of Natural History (SMNH), Biological Museum, Lund University (MZLU), Natural History Museum of Denmark (ZMUC), and the Natural History Museum, London (BM). The type specimens were photographed, and their external and gross internal morphological characters were examined.

2.2. Morphological Observation and Preparation of Histological Sections

Morphological observations were performed on external and internal characters. Preserved polyps were dissected into pieces to obtain some tissues for histological sections after external morphological characters were observed. The dissected tissues were then dehydrated by 80–100% ethanol, cleared in xylene, embedded in paraffin, sliced into serial sections (7–10 µm thick) using a microtome, mounted on glass slides, and stained with hematoxylin and eosin (HE). The method of HE staining was based on Presnell and Schreibman (1997) [16], but the staining or washing times were slightly altered for sea anemones: the times were suitably extended for the samples in which the mesoglea was thick. Sections were mounted on slide glasses and enclosed by slide glasses. Finally, anatomies of several internal features were observed using conventional microscopes. In this study, we refer to the terminology by Carlgren (1949), Daly (2015), and Yanagi (2017) for the morphology of sea anemones [2,4,17].

Figure 2. The localities of actinernoidean anemone specimens examined in this study.

2.3. Observation of Cnidae

The cnidae of the tentacle, actinopharynx, column, and mesenterial filament were observed. Tissues from every part were placed on glass slides and mounted using 50% (v/v) glycerin–sea water. Images of the cnidae were obtained using a differential interference contrast microscope, generally following the method of Yanagi et al. (2015) [18]. The lengths and widths of the cnidae were measured using the software ImageJ ver. 1.49 (Rasband, 1997–2012) [19]. We followed Mariscal (1974) [20] for the nomenclature of the cnidom. We evaluated the number of cnidae as follows: <5: rare; 5≤ and <10: few; and 10≤: numerous.

2.4. PCR and DNA Sequences

DNA was extracted from each tissue that was preserved in 99% ethanol by using a Charge Switch gDNA Micro Tissue Kit (Invitrogen). In addition, some tissue samples for DNA were processed following the guanidine extraction protocol (Sinniger et al., 2010) [21]. PCR amplifications were performed in 10 µL reaction volume, consisting of 0.4 µL of 25 µM forward and reverse primers, 5.0 µL of Emerald Amp PCR Master Mix (TaKaRa), and 3.4 µL of distilled water. For PCR amplifications, three mitochondrial markers—12S, 16S rDNA—three nuclear markers—18S and 28S rDNA—and internal transcribed spacers (ITS) 1 and 2 with 5.8S rDNA were used. The primers and amplification conditions are shown in Table 2. Amplifications were performed using five traditional molecular markers of Actiniaria: 12S, 16S, 18S, and 28S rDNA, adopted in Rodríguez et al. (2014) [13], following the methods of preceding phylogenetic studies on sea anemones (Apakupakul et al., 1999; Geller and Walton, 2001; Medina et al., 2001; Meldin et al., 1988; Sinniger et al., 2005) [22,23,24,25,26]. We used another set of primers for 28S rDNA during some amplifications (Littlewood et al., 2000; Williams et al., 2003; Williams and Ozawa, 2006) [27,28,29] if the primers of Medina et al. (2001) [24] did not work effectively. We newly adopted the ITS1/ITS2 marker with 5.8S rDNA and used the method of amplification from preceding studies for another phylum (Heath et al., 1995) [30]. The PCR products were processed using exonuclease I and shrimp alkaline phosphate (ExoSAP-IT; Thermo Fisher, Waltham, MA, USA) before sequencing. The sequencing reaction was performed using BigDye Terminator Cycle Sequencing Ready Reaction Kit v3.1 (Applied Biosystems) and using just PCR primers (12S, 16S, COXIII, and ITS1/2) or both PCR primers and internal primers (18S and 28S; Table 2). We used four internal primers (two forward and two reverse) for 18S (Apakupakul et al., 1999) [22] and three primers (two forward and one reverse) for 28S (Williams and Ozawa, 2005) [29]. Sequencing was performed using an ABI 3500xL Genetic Analyzer (Applied Biosystems). The sequence of each marker was individually assembled using GeneStudio ver. 2.2.0.0 (http://genestudio.com; accessed on 7 January 2021]).

2.5. Phylogenetic Analyses

The base sequences used in phylogenetic analyses are shown in Table 3. The sequence data of five species were obtained from GenBank (registration numbers are shown in Table 3). Each dataset was aligned using MAFFT ver. 7.402 (Katoh and Standley, 2013) [31] under the default settings. Ambiguously aligned areas were eliminated using Gblocks ver. 0.91b (Castresana, 2002) [32] with the type of DNA sequence and using default parameters, except allowing small final blocks and gap positions within the final blocks. The obtained data were processed using Kakusan 4 (Tanabe, 2011) [33] to concatenate every alignment to one file and select substitution models for the RAxML and MrBayes analyses (models are shown in Table 4). In the combined dataset, substitution parameters were estimated separately for each gene partition. The maximum likelihood (ML) analysis was performed using RAxML-VI-HPC (Stamatakis, 2006) [34], with substitution models recommended by Kakusan 4 and evaluated using 100 bootstrap replicates. Bayesian inference (BI) was conducted using MrBayes ver. 3.2.6 (Ronquist and Huelsenbeck, 2003) [35] with substitution models recommended by Kakusan 4. Two independent runs of the Markov Chain Monte Carlo were performed simultaneously for 5,000,000 generations; trees were sampled every 100 generations, and the average standard deviations of split frequencies (ASDSF) every 100,000 generations were calculated. As the ASDSF was calculated on the basis of the last 75% of the samples, the initial 25% of the sampled trees were discarded as burn-in. Constructed ML and Bayesian trees were rooted and combined using FigTree ver. 1.4.3 (http://tree.bio.ed.ac.uk/software/figtree/; accessed on 7 January 2021]).

3. Results and Discussions

3.1. Phylogeny

We analyzed the phylogeny of Actinernoidea using 34 specimens of 11 species of all genera except Carlgrenia Stephenson, 1918 [36], including both families, Actinernidae and Halcuriidae [4,14]. Two large clades were formed in the phylogenetic tree (Figure 3). One clade included three genera, Actinernus Verrill, 1879, Isactinernus, and Synhalcurias of Actinernidae, and the other included Synactinernus of Actinernidae and Halcurias of Halcuriidae. Actinernidae (the lineages indicated in pink in Figure 3) thus became polyphyletic, and Halcuriidae (in orange in Figure 3) was paraphyletic with regards to the genus Synactinernus. The monophyly of every node (Figure 4A–D) was supported with bootstrap values of 88–100% and posterior probability of 1. We also tried the analysis independently using mitochondrial and nuclear markers: in the results, the topology was strongly supported with nuclear markers (with bootstrap values/posterior probabilities of 98%/1 on node A, 100%/1 on node B, 87%/0.95 on node C, and 100%/1 on node D; Supplementary Figures S1 and S2) but not supported well with mitochondrial markers (node A was not supported, and bootstrap values/posterior probabilities were 98%/1 on node B, 51%/0.95 on node C, and 66%/0.99 on node D; Supplementary Figures S3 and S4). The support rates were comparatively low despite the topologies being not so different from each other, so we decided to analyze using whole markers.

Remarks. The two families Actinernidae and Halcuriidae of the superfamily Actinernoidea have peculiar mesenterial arrangements. Only these two families develop their mesenteries of the second mesenterial cycle in the endocoels of the mesenteries of the first cycle (Figure 1C). Conversely, almost all species of actiniarians except for these two families develop mesenteries in the exocoels, out of the mesenterial pairs of the first cycle (Figure 1D). Therefore, the classification system in Carlgren (1949) accommodated Actinernidae and Halcuriidae in the independent suborder Endocoelantheae and distinguished them from the other families (Table 1 in [14]). Carlgren (1949) [4] stated that these two families could be distinguished from each other by the number of cycles of mesenteries and the number of siphonoglyphs (see introduction). This classification system of these families has been accepted up until the present study [10,11,12,14]. This is mainly because Actinernoidea anemones are scarcely collected owing to their rarity. Even Rodríguez et al. [13], who conducted the most comprehensive phylogenetic analysis of Actinernoidea to date, could obtain only four species of this suborder; hence, they only changed the taxonomic rank of the suborder to superfamily and did not discuss the inner classifications of these two families.

In contrast, numerous specimens representing eleven species covering five out of six genera of Actinernoidea were analyzed in the molecular analyses in this study. Thus, we demonstrate that Actinernidae as previously defined is polyphyletic and Halcuriidae as previously defined is paraphyletic (Figure 3). Thus, based on our phylogeny, we comprehensively revise Actinernoidea (Figure 4): the genus Synactinernus (indicated in the purple box in Figure 4) is transferred from Actinernidae to Halcuriidae; Isactinernus and Synhalcurias are accommodated into the newly established family Isactinernidae fam. nov. (indicated in the upper black bar in Figure 4) as there were few common features between Actinernus (in the orange box) and Isactinernus/Synhalcurias (in the green and yellow boxes; see remarks of family Isactinernidae fam. nov.); and some species of Halcurias are moved to the new genus Isohalcurias gen. nov. (in the blue box) to solve the paraphyly of the genus Halcurias (in the red box). This study further demonstrates that Japan has an extraordinarily rich fauna of the superfamily Actinernoidea: six out of seven genera and over half of the species of the world are known from this region

3.2. Descriptions

Order ACTINIARIA Hertwig, 1882.

Suborder ANENTHEMONAE Rodríguez and Daly, 2014.

Superfamily ACTINERNOIDEA Stephenson, 1922.

(Japanese name: yatsuba-kawari-ginchaku-jouka [37].)

Diagnosis. Anenthemonae with a well-developed basal disc but without basilar muscles. Column smooth, or with nematocyst batteries, nearly always with spirocysts. Margin tentaculate. Sphincter absent or weak mesogleal. Tentacles in variable number, with or without thickening aboral side, either in two alternating cycles or, although usually arranged in cycles, in a peculiar way related to the development of mesenteries. Longitudinal muscles of tentacles and radial muscles of oral disc ectodermal, with a slight mesogleal tendency. Oral disc sometimes lobed. One or two siphonoglyphs. Usually more mesenteries than directives attached to siphonoglyphs. Unique mesenterial arrangement: after the first twelve mesenteries (six couples) are developed, all subsequent pairs appear in lateral endocoels with longitudinal muscles oriented as in directives. Cnidom: spirocysts, basitrichs, holotrichs, and microbasic p-mastigophores. (Revised points from Rodríguez et al. (2014) [13] are indicated in bold.)

Remarks. Actinernidae Verrill, 1879, and Halcuriidae Carlgren, 1918, have peculiar mesenterial arrangement [7,38]. Despite that almost all sea anemones develop their second cycle of mesenteries out of first cycle of mesenterial pairs (at exocoels), only species belonging to these two families develop them in the first cycle pairs (at endocoels). So, in the classification system of Carlgren [4], they were accommodated in the suborder Endocoelantheae Carlgren, 1925 [9]. However, the phylogenetic research of Rodríguez et al. (2014) revealed that species of Endocoelantheae were related to Edwardsiidae, and thus, they established a new suborder, Anenthemonae Rodríguez and Daly, 2014, for Actinernidae, Halcuriidae, and Edwardsiidae [13]. Thus, Endocoelantheae disappeared, and they used the superfamily Actinernoidea Stephenson, 1922, instead to accommodate those two families.

There are two families and six genera of actinernoideans confirmed from Japan. According to our phylogenetic and morphological analyses (Figure 3 and Figure 4), the monophyly was strongly supported as a superfamily, and the new family Isactinernidae and a new genus Isohalcurias were established. See Table 5 for comparison of Isactinernidae fam. nov. and the other families of Actinernoidea. The new taxonomic key of this superfamily to each genus, including Isohalcurias gen. nov., is as below.

Taxonomic key of the suborder Actinernoidea
1A. Mesenteries distinguished macrocnemes and microcnemes	See 2.
2A. Base of tentacles thickening in aboral side	Actinernus Verrill, 1879
2B. Tentacle simple, no thickening	See 3.
3A. Edge of oral disc developed into lobes	Synactinernus Carlgren, 1918
3B. Edge of oral disc simple, not lobed	See 4.
4A. 12 macrocnemes in column	Carlgrenia Stephenson, 1918
4B. 20 macrocnemes in column	See 5.
5A. Spirocysts absent on column. Muscular processes simple and unified	Halcurias McMurrich, 1893
5B. Spirocysts present on column. Part of retractor muscles clustered	Isohalcurias gen. nov.
1B. All mesenteries perfect and macrocnemes	See 6.
6A. Edge of oral disc developing into lobes	Isactinernus Carlgren, 1918
6B. Edge of oral disc simple, not lobed	Synhalcurias Carlgren, 1914

Family ACTINERNIDAE Stephenson, 1922.

(Japanese name: yatsuba-kawari-ginchaku-ka [39].)

Actinernidae Stephenson, 1922: 258; Carlgren, 1949: 20.

Diagnosis. Actinernoidea with an elongated body. Distal margin of column usually expanded and drawn into lobes but sometimes not expanded nor lobed. Column with or without nematocyst batteries. Tentacles numerous, with basal thickening on their aboral side. With two siphonoglyphs. Mesenteries numerous, divisible into macro- and microcnemes, and develop bilaterally. Retractors rather weak. All stronger mesenteries fertile. Cnidom: basitrichs, spirocysts, and microbasic p-mastigophores.

(The revised points from Uchida (2007) [12] are indicated in bold.)

Type genus. Actinernus Verrill, 1879.

Remarks. This family until now contained four genera: Actinernus Verrill, 1879, Synhalcurias Carlgren, 1914, Isactinernus Carlgren, 1918, and Synactinernus Carlgren, 1918, and have been characterized by having two siphonoglyphs on their actinopharynx and lacking the deviation between macrocnemes and microcnemes [7,39,40]. However, though there was apparent deviation between macrocnemes and microcnemes only in Actinernus (see Uchida, 2007 [12]; Figure 5) and Synactinernus (see Figure 4 in Izumi et al. (2019) [14]), no apparent deviation was observed in Isactinernus (see Figure 8) and Synhalcurias (see Figure 3 in Izumi and Yanagi (2021) [15]), and it is doubtful that these four genera should be accommodated in same family.

In this study, our phylogenetic analyses (Figure 3 and Figure 4) revealed that Synactinernus was not monophyletic with the other three genera of Actinernidae but instead within the clade of Halcuriidae. Thus, it was necessary to remove this genus from Actinernidae. Moreover, there was no synapomorphy between Actinernus and the other two genera, and rather, there were apparent differences between these genera in mesenterial arrangement and cnidom (see remarks part of Isactinernidae fam. nov.). These are the reasons why we have established a new family for Isactinernus and Synhalcurias and removed them from Actinernidae.

Finally, this family became monotypic to type genus Actinernus. The most characteristic feature of this genus is developing their mesenteries laterally: this arrangement is only observed in the species of Actinernus in Actinernoidea. In addition, the species of this family are distinguished from the species of the other two families by a combination of “lacking spirocysts in tentacle and column” and “thickened aboral ends of tentacles”.

Table 5. Comparison of Isactinernidae fam. nov. and the other two families in superfamily Actinernoidea.

	Isactinernidae fam. nov.	Actinernidae Stephenson, 1922	Halcuriidae Carlgren, 1918
Type genus	Isactinernus Carlgren, 1918	Actinernus Verrill, 1879	Halcurias McMurrich, 1893
The other genera	Synhalcurias Carlgren, 1914	none	Synactinernus Carlgren, 1918 Carlgrenia Stephenson, 1918 Isohalcurias gen. nov.
Characters
Mesenterial arrangement	Cyclic	Bilateral	Cyclic
Microcnemes	Absent	Present	Present
Number of macrocnemes	Unfixed (more than 68)	Unfixed (more than 20)	Fixed (12, 20, or 36)
References	[7,12,40] The present study	[8,12]	[7,8,11,12] The present study

Genus Actinernus Verrill, 1879.

(Japanese name: Yatsuba-kawari-ginchaku-zoku.)

Actinernus Verrill, 1879: 474; McMurrich, 1893: 165; Carlgren, 1914: 62; Carlgren, 1918: 31; Carlgren, 1921: 14, 184; Stephenson, 1922: 259; Carlgren, 1949: 20.

Porponia Hertwig, 1882, p. 111; Carlgren, 1914, p. 61.

Diagnosis. Column cylindrical, the upper part expanded and forms more or less distinctly eight lobes. Tentacles numerous, with basal thickening on their aboral side. Mesenteries many, consist of 24–52 perfect mesenteries and a half number of imperfect mesenteries. After the formation of ten pairs, first and second cycles, further mesenterial formation takes place at the middle point of each eight lateral endocoel. Then, the formation is not in a radial but in a bilateral way. Furthermore, the size in higher cycles of mesenteries is much different to its partner in each mesenterial pair. Cnidom: basitrichs (all tissues), spirocysts (actinopharynx and filaments), and microbasic p-mastigophores (actinopharynx and filaments).

(The revised points from Uchida (2007) [12] are indicated in bold.)

Type species. Actinernus elongatus (Hertwig, 1882).

Actinernus robustus (Hertwig, 1882).

(Japanese name: yatsuba-kawari-ginchaku.)

Figure 5, Figure 6 and Figure 7, Table 6.

Porponia robusta Hertwig, 1882: 107, pl. 1 Figure 10a; Carlgren, 1914: 61.

Actinernus robustus: Carlgren, 1918: 12, 34, pl. 1 Figure 9; Stephenson, 1922: 259; Carlgren, 1949: 21.

Material examined. CMNH–ZG 09735 (Figure 5 and Figure 6): specimen dissected, tissues embedded in paraffin, histological sections prepared, nematocysts prepared, corrected on 28 April 2002, from Okinawa Trough (27°02.34′ N, 126°58.24′ E; St. D-2), 1550 m in depth, during research cruise of R/V Tansei-Maru (KT02-3 reg. 2), by ORE beam trawl, by Kensuke Yanagi; CMNH–ZG 09736: specimen dissected, tissues embedded in paraffin, histological sections prepared, same collector, locality, and method as for CMNH–ZG 09735; CMNH–ZG 09737, 09738: whole specimens, same collector, locality, and method as for CMNH–ZG 09735; CMNH 10211: specimen dissected, corrected on 23 September 2001, from Pacific off Kushiro (42°11.02′ N, 146°17.02′ E; St. XR-11), 5346–5473 m in depth, collected during research cruise of R/V Hakuho-Maru (KH01-2), by ORE beam trawl, by Kensuke Yanagi; BM 89–11–25–30 (holotype) (Figure 7A,B): dissected specimen, collected on 17 June 1875 southeast off the Boso Peninsula (34°37′ N, 140°32′ E), depth 1875 fathoms (ca. 3500 m) by trawl, St. 237 of the Challenger Expedition.

Diagnosis. External anatomy. Body cylindrical (Figure 5A), up to ca. 2–6 cm in length and ca. 2.5–5 cm in width on preserved specimens. Column surface smooth, without any structures. Ectoderm of column easily peeled off, without nematocyst batteries, and nematocysts very sparsely distributed. The naked column is opaque milky white in color (Figure 5A). Basal disk in aboral end, thin and fragile but adhesive (Figure 5A). Upper part of column widely expanded and thrown into eight lobes, four larger and four smaller ones (Figure 5B,C). Upper margin continued to tentacle bases, and the bases have a spine-like shape (Figure 5A). Tentacles ca. 60–90 in number on oral disk, all marginal. All tentacles ca. 7–10 mm in length, pale white to brown in color, simple shape but with strong thickenings at their aboral base. Oral disc pale brown, with radial streaks corresponding to every tentacle. Mouth at center of oral disk, apparently swelled, lip-like, brown in color.

Internal anatomy. Circa 24–52 macrocnemes (Figure 5D) on actinopharynx: 12, including 4 directives, in the 1st cycle; 8 in the 2nd cycle; maximum 16 in the 3rd cycle; and maximum 16 in the 4th cycle. Macrocnemes in the second cycle born in the endocoel of the first cycle mesenteries, and fourth ones in the endocoels of third ones (bilateral arrangement). Judged by the numbers of tentacles, 20–40 more microcnemes on distal end. Each tentacle either exo- or endocoelic. Tentacular longitudinal muscle and tentacular circular muscle both too weak to observe in histological sections. On aboral ends of tentacles, mesoglea apparently thickened. Retractor muscles extremely weak and diffused (Figure 5D). Muscle processes very short, simple or a little branched, around 30–50 in each muscle pennon. Parietal muscles of macrocnemes very weak and indistinct, with a few muscle fibers. Mesoglea thickest in body wall and actinopharynx (Figure 5D), reaching 2–2.5 mm in thickness, and far thicker than the ectoderm and endoderm. However, mesoglea thinner in mesenteries and basal disc (Figure 5D,E) and thinnest in tentacles. Actinopharynx, with siphonoglyphs on dorsal and ventral sides (Figure 5D), always connected to actinopharynx, and with ca. 8–12 longitudinal grooves as deep as siphonoglyphs. Sphincter muscle absent. On the aboral end, basilar muscle absent (Figure 5E). Dioecious.

Cnidom. Basitrichs, spirocysts, and microbasic p-mastigophores (Figure 6, Table 6).

Remarks. Actinernus robustus is the only species of this genus in Japan. Our specimens completely correspond to the description of Hertwig (1882) and Uchida (2007) [12,41]. In contrast to all Japanese Actinernoidea species, which live between 20 and 500 m, this species inhabits waters deeper than 1000 m.

The approximate morphology and cnidom of our specimens corresponded to the descriptions of Hertwig (1882) and Uchida (2007), and these specimens can be identified as A. robustus. However, there were no holotrichs in filaments, though Uchida (2007) [12] observed a few.

Table 6. Cnidoms of the species of Actinernus and Isactinernus.

		Actinernus robustus			Isactinernus quadrilobatus
		CMNH–ZG 9735			NSMT–Co 1662
		Length × Width (µm)	frequency	N	Length × Width (µm)	frequency	N
Tentacle
basitrichs	S	18.2–28.8 × 3.7–5.9	numerous	53	9.1–21.5 × 2.0–3.5	numerous	15
basitrichs	L	40.0–53.6 × 4.3–4.8	few	8	31.1–42.3 × 3.0–4.4	numerous	24
spirocysts		25.2–54.7 × 5.2–8.7	few	5	20.9–49.5 × 3.1–9.8	numerous	78
microbasic p-mastigophores
microbasic b-mastigophores					29.9–31.7 × 4.4–5.2	rare	3
Actinopharynx
basitrichs	S	20.2–25.1 × 4.0–5.5	numerous	10	8.3–13.0 × 2.2–3.3	numerous	36
basitrichs	L	38.8–49.3 × 3.9–5.4	few	9	36.1–43.4 × 3.5–5.2	numerous	27
spirocysts					25.4–36.4 × 4.7–6.3	few	4
microbasic p-mastigophores		11.7–14.0 × 3.9–5.6	few	5	34.9–44.5 × 6.3–8.6	numerous	23
Column					Column damaged
basitrichs		20.4–22.5 × 4.3–5.4	rare	3	Column damaged
Filament
basitrichs		15.8–23.8 × 3.8–5.6	numerous	35	17.8–47.2 × 2.9–4.2	few	9
		27.7–52.8 × 3.4–5.4	numerous	27	17.8–47.2 × 2.9–4.2	few	9
spirocysts		41.6 × 7.2	rare	1	28.1–42.5 × 4.8–7.6	numerous	55
microbasic p-mastigophores		38.8–42.3 × 8.1–9.8	rare	4	35.3–42.4 × 6.0–7.2	numerous	25

Figure 5. External and internal morphology of Actinernus robustus (CMNH–ZG 9735). (A) Lateral view of a fixed specimen; (B) oral view; (C) bared oral disc; (D) transverse section of column; (E) longitudinal section of basal disc. Basilar muscle absent; abbreviations: a, actinopharynx; bd, basal disc; ma, macrocneme; me, mesoglea; pa, parietal muscle; rm, retractor muscle; s, siphonoglyph; te, tentacle. Scale bars indicate 1 cm in (A–C), 1 mm in (B,E), and 500 µm in (D,E).

Figure 6. Cnidoms of Actinernus robustus and Isactinernus quadrilobatus. A–K: A. robustus. A–C: tentacle; A, small basitrich; B, large basitrich; C, spirocyst. D–F: actinopharynx; D, small basitrich; E, large basitrich; F, microbasic p-mastigophore. G, basitrich in column. H–K: filament; H, small basitrich; I, large basitrich; J, spirocyst; K, microbasic p-mastigophore. L–V: I. quadrilobatus. L–O: tentacle; L, small basitrich; M, large basitrich; N, spirocyst; O, microbasic b-mastigophore. P–S: actinopharynx; P, small basitrich; Q, large basitrich; R, spirocyst; S, microbasic p-mastigophore. T–V: filament; T, small basitrich; U, large basitrich; V, microbasic p-mastigophore.

Figure 7. Type specimens of actinernoidean anemones. The type specimen of Actinernus robustus ((A,B): BM 89-11-25-30, holotype), Isactinernus quadrilobatus ((C,D): ZMUC–ANT–000098, one of the syntypes), and Isohalcurias carlgreni ((E): UUZM 705b (Anthozoa), one of the syntypes, (F): SMNH–TYPE–1200, one of the syntypes).

Family ISACTINERNIDAE fam. nov.

(New Japanese name: yotsuba-kawari-ginchaku-ka.)

urn:lsid:zoobank.org:act:E3DEAB20-FDE6-4E96-A2E1-A0E892DD485A

Diagnosis. Actinernoidea with an elongated body. Distal margin of column usually expanded and drawn into lobes but sometimes not expanded nor lobed. Column with or without nematocyst batteries. Tentacles numerous, simple or with basal thickening or on their aboral side. With two siphonoglyphs. Mesenteries all macrocnemes, numerous, and developing cyclically. Retractors rather weak. All mesenteries fertile. Cnidom: basitrichs, spirocysts, and microbasic p-mastigophores (each in all tissue).

Type genus. Isactinernus Carlgren, 1918.

Etymology. Derived from the name of type genus, Isactinernus Carlgren, 1918.

Remarks. In this study, our phylogenetic analyses (Figure 4) revealed that Isactinernus and Synhalcurias were the most closely related genera and formed a monophyly with Actinernus. However, there were no synapomorphies between Actinernus and Isactinernus/Synhalcurias: Synactinernus has almost all the general features of Actinernidae, and we could not find any accurate common feature shared among the remaining three families. In addition, there are apparent differences between Actinernus and Isactinernus/Synhalcurias in mesenterial arrangement and cnidom: in Actinernoidea, only the latter two genera have microbasic p-mastigophores in their tentacles and column, and their mesenteries are all macrocnemes, the same in number as tentacles [10,12,15]. For these reasons, we have established this new family for Isactinernus and Synhalcurias and removed them from Actinernidae (Figure 4). See Table 5 for the comparison with the other families of Actinernoidea. This family is characterized by possessing microbasic p-mastigophores in their tentacles and column and all mesenteries being perfect and fertile.

Genus Isactinernus Carlgren, 1918.

(Japanese name: yotsuba-kawari-ginchaku-zoku.)

Isactinernus Carlgren, 1918: 29; Stephenson, 1922: 260; Carlgren, 1949: 20; Fautin and den Hartog, 2003: 107.

Diagnosis. Column cylindrical, the upper part expanded, and forms four large lobes. With many tentacles, thickening on aboral side. Mesenteries ca. 34–70 pairs of large and many small ones, all mesenteries perfect and almost all fertile. After the formation of ten pairs of the oldest mesenteries, in the first and second cycles, further mesenterial formation by cyclic in each eight lateral endocoel, in the same manner as those of Halcurias. With two siphonoglyphs. Column ectoderm with minute nematocyst batteries. Cnidom: basitrichs, spirocysts, and microbasic p-mastigophores (each in all tissue).

(The revised points from Uchida (2007) [12] are indicated in bold.)

Type species. Isactinernus quadrilobatus Carlgren, 1918.

Remarks. This genus had been monotypic with I. quadrilobatus Carlgren, 1918, for a century. However, accompanied by Fautin and Hartog (2003), the work which synonymized Synactinernus flavus Carlgren, 1918, into I. quadrilobatus, genus Synactinernus became a junior synonym of this genus. However, our phylogenetic analyses indicated that these genera are less related phylogenetically (Figure 3): I. quadrilobatus and S. flavus are polyphyletic, not closely related in the phylogenetic tree, and thus, the species should be accommodated into a different family (see also remarks of Synactinernus).

Thus, Isactinernus should remain as a monotypic genus, the same status as Carlgren (1918) [7]. However, it turned out to be appropriate that this genus should not be accommodated into Actinernidae, but into a new family (see the remarks of Isactinernidae).

Isactinernus quadrilobatus Carlgren, 1918.

(Japanese name: yotsuba-kawari-ginchaku.)

Figure 6, Figure 7 and Figure 8, Table 6.

Isactinernus 4-lobatus Carlgren, 1918: 7, 29, textfigs. 5 and 6, pl. 1 Figures 4 and 5; Carlgren, 1940: 22; Carlgren, 1949: 20.

Isactinernus quadrilobatus: Stephenson, 1922: 260; Fautin and den Hartog, 2003: 108–113, Figures 1–5.

Material examined. NSMT–Co 1662: specimen dissected, tissues embedded in paraffin, histological sections prepared, nematocysts prepared and collected on 8 March 2016, from the Kumano-nada Sea off Hamajima Island, Mie Prefecture, around a depth of 350 m, by trawling of fishing boat Kiei-Maru, kept in Toba Aquarium for a while, preserved on 19 March 2016 by Takeya Moritaki in 70% ethanol, and re-preserved on 19 April 2016 by Takuma Fujii in 10% formalin–seawater solution (v/v) for histological section; CMNH–ZG 09734: specimen dissected, tissues embedded in paraffin, histological sections prepared, nematocysts prepared and collected on 18 April 2018, from the East China Sea off Koshikijima Island, Kagoshima Prefecture, around a depth of 380 m, by the fishing boat Koei-Maru, kept in Kagoshima City Aquarium for a while, and preserved on 6 May 2018 by Takato Izumi. ZMUC–ANT–000098 (syntypes): three specimens, 14 May 1914, off the Goto Islands (32°17′ N, 128°11′ E), depth 207 m, collected by Theodor Mortensen (Figure 7C,D). MZLU–L14/3033 (syntype): collection data same as above syntypes.

Description. External anatomy. Body cylindrical (Figure 8A), up to ca. 4.5–7 cm in length and ca. 5 cm in width on preserved specimens. Column surface comparatively smooth, without any structures or with small tenaculi. Ectoderm of column is pale white (Figure 8A), with small nematocyst batteries. The naked column is opaque milky white in color. Basal disk in aboral end, robust and adhesive (Figure 8A). Upper part of column widely expanded and thrown into four large lobes (Figure 8B). Upper margin continued to tentacle bases, and the bases have numerous spine-like shapes (Figure 8B). Tentacles ca. 72–140 in number on oral disk, all marginal. All tentacles ca. 3–5 mm in length, pale white in color, simple shape, but with strong thickenings at their aboral base. Oral disc is pale white, with radial streaks corresponding to every tentacle. Mouth at center of oral disk, apparently swelled, lip-like, cross-like shape, white in color.

Internal anatomy. Circa 72–140 macrocnemes on actinopharynx; 12, including 4 directives, in the 1st cycle; 8 in the 2nd cycle; 16 in the 3rd cycle; and 32 in 4th cycle. Judged by the numbers of tentacles, the mesenterial cycle reaching to sixth. Macrocnemes in the second cycle born in the endocoel of the first cycle mesenteries, same as the general arrangement of Actinernoidea. Microcnemes absent (Figure 8C). Each tentacle either exo- or endocoelic. Tentacular longitudinal muscle and tentacular circular muscle both too weak to observe in histological sections. On aboral ends of tentacles, mesoglea apparently thickened. Retractor muscles extremely weak and diffused (Figure 8C,D). Muscle processes very short, simple or a little branched, around 40–70 in each muscle pennon. Parietal muscles of macrocnemes very weak and indistinct, with a few muscle fibers. Mesoglea thickest in body wall and actinopharynx (Figure 8C,D), reaching 2.5–3 mm in thickness, and far thicker than the ectoderm and endoderm. Mesoglea evenly thick in mesenteries (Figure 8C) and basal disc but far thinner in tentacles. Actinopharynx, with siphonoglyphs on dorsal and ventral sides, always connected to actinopharynx, and with 10 longitudinal grooves as deep as siphonoglyphs. Sphincter muscle absent. On the aboral end, basilar muscle absent. Dioecious: almost all mesenteries fertile and matured oocytes in CMNH–ZG 09734.

Cnidom. Basitrichs, spirocysts, and microbasic p-mastigophores (Figure 6, Table 6).

Remarks. This species has been the only species of genus Isactinernus for a century. According to our research, Synactinernus flavus Carlgren, 1918, once synonymized into I. quadrilobatus by Fautin and den Hartog (2003), is not only a different species but also a species in a different family (see remarks of genus Synactinernus [14]).

Figure 8. External and internal morphology of Isactinernus quadrilobatus (CMNH–ZG 9734). (A) Lateral view of a fixed specimen; (B) oral view; (C) enlarged transverse section of upper column; (D) enlarged transverse section of lower column. Abbreviations: a, actinopharynx; fi, filament; ma, macrocneme; me, mesoglea; ov, ovary; pa, parietal muscle; rm, retractor muscle; te, tentacle. Scale bars indicate 1 cm in (A,B) and 1 mm in (C,D).

Genus Synhalcurias Carlgren, 1914.

(Japanese name: seitaka-kawari-ginchaku-zoku.)

Synhalcurias Carlgren, 1914: 53; Carlgren, 1918: 27; Stephenson, 1922: 260; Carlgren, 1949: 19.

Diagnosis. Column cylindrical, the upper part not expanded nor forms lobes. With many tentacles in a simple shape. Mesenteries number 68 to ca. 100, and all mesenteries are perfect and fertile. After the formation of ten pairs of the oldest mesenteries, in the first and second cycles, further mesenterial formation by cyclic in each eight lateral endocoel in the same manner as those in Halcurias. With two siphonoglyphs. Column ectoderm with or without small nematocyst batteries. Cnidom: basitrichs, spirocysts, and microbasic p-mastigophores (each in all tissue).

(The revised points from Uchida (2007) [12] are indicated in bold.)

Type species. Synactinernus elegans (Wassilieff, 1908).

Remarks. Different from Isactinernus, Synhalcurias has been continuously monotypic since the foundation of the genus. However, a different species of Synhalcurias were discovered recently: they are apparently smaller than S. elegans, and there were several differences between S. elegans and these recently discovered specimens, although their morphological features satisfied the diagnosis of Synhalcurias. Based on this, Izumi and Yanagi (2021) [15] determined these specimens as a new species of Synhalcurias and described them as Synhalcurias kahakui Izumi and Yanagi, 2021.

Synhalcurias has long belonged to Actinernidae, but it is appropriate that Synhalcurias and Isactinernus should not be accommodated into the family by our morphological and phylogenetic analyses, and so, we have established a new family for these genera (see the remarks of family Isactinernidae).

Synhalcurias elegans (Wassilieff, 1908).

(Japanese name: seitaka-kawari-ginchaku.)

Figures 2–4 and Table 1 in Izumi and Yanagi (2021) [15].

Ilyanthopsis elegans Wassilieff, 1908: 8, textfigs. 2–5, pl. 1 Figure 2, pl. 3 Figure 38, pl. 4 Figures 39, 40a, and 40b.

Synhalcurias elegans: Carlgren, 1914: 50–53, pl. Figures 1–4; Carlgren, 1918: 6, 27, textfigs. 2–4; Stephenson, 1922: 260; Carlgren, 1940: 22; Carlgren, 1949: 20; Uchida, 1992: 129, pl. 29 Figure 5; Uchida and Soyama, 2001: 21.

Material examined/description. See Izumi and Yanagi (2021) [15].

Synhalcurias kahakui Izumi, 2021.

(New Japanese name: kobito-seitaka-kawari-ginchaku.)

Figures 4 and 5 and Table 1 in Izumi and Yanagi (2021) [15].

Synhalcurias kahakui Izumi and Yanagi, 2021: 567–573.

Material examined/description. See Izumi and Yanagi (2021) [15].

Family HALCURIIDAE Carlgren, 1918 (1897).

(Japanese name: kawari-ginchaku-ka.)

Halcuriidae Carlgren, 1918: 24; Carlgren, 1921: 13; Stephenson, 1922: 257; Carlgren, 1938: 17; Carlgren, 1949: 18.

Diagnosis. (Revised parts are shown in bold). Actinernoidea with an elongated body. Distal margin of column lobed or not lobed. Column with or without nematocyst batteries. Tentacles without basal thickening on their aboral side. With a single or double siphonoglyph. Mesenteries divisible into macro- and microcnemes. Macrocnemes six, ten or eighteen pairs. Some of the microcnemes, however, are perfect in many species. Retractors of the macrocnemes restricted. Macrocnemes fertile with filaments but microcnemes sterile without filaments.

(The revised points from Uchida (2004) [11] are indicated in bold.)

Type genus. Halcurias McMurrich, 1893.

Remarks. Regarding the nomenclature of the family, refer to Sanamyan and Sanamyan (2020) [42]. This family has accommodated two genera: Halcurias McMurrich, 1893, and Carlgrenia, Stephenson, 1918 (the latter genus never confirmed from Japan, including in our research) [7,43]. However, our phylogenetic analyses revealed that Synactinernus Carlgren, 1918, one of the genera of Actinernidae, was in the clade of Halcuriidae (Figure 3). However, species of this genus have almost the same morphology as Actinernidae, and there was no synapomorphy between Halcurias and Synactinernus. Thus, it was unnatural to classify the synactinernid species into Halcurias.

Thus, we divided the previous Halcurias into “true” Halcurias and a new genus, Isohalcurias gen. nov., following the phylogeny (Figure 4). According to the tree, there were only two species from Japan, Halcurias hiroomii sp. nov. and Halcurias fragum sp. nov., in the same clade as Halcurias pilatus McMurrich, 1893, the type species of the genus. On the other hand, the other three Halcurias species were in the other clade, which was paraphyletic to “true” Halcurias and Synactinernus. Thus, these three species, Isohalcurias carlgreni (McMurrich, 1901) comb. nov., Isohalcurias citreum sp. nov., and Isohalcurias malum sp. nov., were accommodated into the new genus, Isohalcurias. See Table 7 for a comparison of the four genera included in the suborder Anenthemonae.

Genus Halcurias McMurrich, 1893.

(Japanese name: kawari-ginchaku-zoku.)

Halcurias McMurrich 1893: 142; McMurrich, 1901: 155, 158; Carlgren, 1914: 60; Carlgren, 1918: 25; Stephenson, 1918: 14; Carlgren 1938: 18; Carlgren, 1949: 18.

Halcuriopsis Carlgren 1921: 93.

Diagnosis. Mesenteries up to 34 pairs arranged in 4 cycles, 6 + 4 + 8 + 16. Macrocnemes, ten pairs, fertile, filamented and with restricted retractors. Microcnemes in only the upper part of the body, some of them perfect. Retractor muscles strong and diffused. Parietal muscles rather well developed to fairly weak. Tentacles, up to 68. Dioecious. Cnidom: basitrichs (in all tissues), spirocysts (in tentacles, actinopharynx, and filaments), and microbasic p-mastigophores (in actinopharynx and filaments).

(The revised points from Uchida (2004) [11] are indicated in bold.)

Type species. Halcurias pilatus McMurrich, 1893.

Remarks. Halcuriidae Carlgren, 1918, contained two genera, Halcurias McMurrich, 1893, and Carlgrenia Stephenson, 1918 [7,43]. The latter genus has been monotypic, so almost all species of this family have been accommodated in Halcurias. However, according to our phylogenetic analyses, Halcurias became paraphyletic (Figure 3). Thus, we established the new genus Isohalcurias gen. nov. and moved some species into this genus (Figure 4). Compared to Isohalcurias, Halcurias is characterized by two features: lacking spirocysts in their column (compare Halcurias species in Table 8 and Isohalcurias species in Table 10) and retractor muscles with comparatively simple, not clustered muscular processes (Figure 9D and Figure 11D; Table 7).

The two species of Halcuriidae from Japan remain in Halcurias: Halcurias hiroomii sp. nov. and Halcurias fragum sp. nov. Across the world, Halcurias pilatus McMurrich, 1893, was confirmed to belong to this genus by phylogenetic analyses (Figure 4). Concerning the other described species, classification was conjectured by the cnidom of the column, as below.

The following species possibly remain in Halcurias: Halcurias uchidai, Rodríguez and Lauretta, 2023 (according to Rodríguez et al. (2013); this species, described as Halcurias macmurrich Uchida, 2004, does not contain spirocysts in its column [44]; recently, Rodriguez and Lauretta (2023) gave a new name for this species [45]); Halcurias endocoelactis Stephenson, 1918 (it was described that spirocysts were absent in the body wall [36]); Halcurias capensis Carlgren, 1928 (same as H. endocoelactis [36]).

Species possibly assigned to Isohalcurias: Halcurias minimus Carlgren, 1928; Halcurias sudanensis Riemann-Zürneck, 1983 (it was described that spirocysts were present on the body walls of both species [46,47]).

Halcurias hiroomii sp. nov.

(Japanese name: abata-kawari-ginchaku.)

urn:lsid:zoobank.org:act:806B2C63-878E-4569-86C4-E3F6F1AF2783

Figure 9 and Figure 10; Table 8.

Halcurias japonicus (nomen nudum) Uchida, 2004: 13–15, Figure 2. pl. 1C–1E.

Material examined. Holotype. CMNH–ZG 10212: specimen dissected, tissues embedded in paraffin, histological sections prepared, nematocysts prepared, collected on 2016 (date unknown) from Toyama Bay, Toyama Prefecture, around a depth of 50–100 m, gill net of fishing boat Koei-Maru, provided by Itaru Kobayashi. Paratype. NSMT–Co 1824: specimen dissected, tissues embedded in paraffin, histological sections prepared, nematocysts prepared, collected from Toyama Bay, off Toyama Prefecture, by gill net (anonymous collector, and date unknown), kept in a tank of Uozu Aquarium by Tomoharu Kimura, and fixed on 28 February 2015 by Takato Izumi. Other specimens. CMNH–ZG 10213: whole specimen, same date, collector, and method as for CMNH–ZG 10212; NSMT–Co 1825–1827, same date, collector, and method as for NSMT–Co 1824: whole specimens; CMNH–ZG 10214: whole specimen; originally collected from Ise Bay by trawling of fishing boat Kiei-Maru, kept in Takeshima Aquarium, and fixed by Takato Izumi on 29 June 2017. CMNH–ZG 10215: whole specimen; originally collected in January 2018 at Uragami, Wakayama Prefecture, at 100–130 m by Isao Hirabayashi, and fixed by Takuma Fujii and Kensuke Yanagi from the tank at the Kushimoto Marine Park on 22 May 2018.

Description. External anatomy. Body cylindrical (Figure 9A,B), up to ca. 40 mm in height and ca. 15 mm in width in a living specimen and 15–30 mm in height and 5–22 mm in width in a preserved specimen. Column surface comparatively rough, reddish-orange ectoderm layer with white tenaculi-like nematocyst batteries. Nematocysts densely distributed, especially in nematocyst batteries. Upper part of column a little narrower, pale yellow in color, simple and not thrown into any lobes. Tentacles simple, conical, all marginal, 6–8 mm in length, no thickenings including their aboral base, pale yellow in color, and 68 in number on oral disk; inner and outer ones alternatingly bared (Figure 9C). The tip of tentacles pointed. Basal disk in aboral end, opaque and mesenterial insertion invisible (Figure 9A,B). Oral disk diameter as broad as column, hemi-transparent pale yellow. Mouth at center of oral disk, highly swelled, lip-like, smooth, bright yellow and orange (Figure 9C).

Internal anatomy. Twenty macrocnemes on actinopharynx (our specimens, all twenty): twelve, including four directives, in the first cycle and eight in the second cycle. Macrocnemes in the second cycle born in the endocoel of the first cycle mesenteries, an arrangement obeying the rule of mesenterial arrangement of Actinernidae. Mesenteries in third and fourth cycle microcnemes. Each tentacle between either exo- or endocoelic. Tentacular longitudinal muscle exocoeletic and circular muscle too weak to observe in histological section; retractor muscles restricted at the center of mesenteries, comparatively weak but distinct (Figure 9D). Muscle processes simple or slightly branched, around 25–41 in each muscle pennon (Figure 9D). Parietal muscles of macrocnemes quite weak with 10–13 simple processes (Figure 9D). Mesoglea thickest in body wall and actinopharynx, far thicker than ectoderm and endoderm (Figure 9G). Mesoglea thinner in mesoglea (Figure 9D,E). Actinopharynx, with siphonoglyphs on one side, always connected to actinopharynx, and with the other eleven longitudinal grooves less deep than siphonoglyphs. Sphincter muscle absent. On the aboral end, basilar muscle absent. Dioecious, immature testis in our specimen (Figure 9E). Mesenteries in second cycle fertile.

Cnidom. Basitrichs, spirocysts, and microbasic p-mastigophores. Spirocysts are absent in the column (Figure 10, Table 8).

Etymology. This name is derived from Hiro’omi Uchida, the author of Uchida (2004) [11] in which Halcurias hiroomii sp. nov. was originally described. He defined this anemone as a new species. Thus, we renamed this species to make it valid and used his first name.

Table 8. Cnidoms of the species of Halcurias.

		Halcurias hiroomii sp. nov.			Halcurias fragum sp. nov.
		CMNH–ZG 10212			CMNH–ZG 10216
		Length × Width (µm)	frequency	N	Length × Width (µm)	frequency	N
Tentacle
basitrichs	S	10.3–12.4 × 2.0–3.0	rare	2	9.7–13.7 × 2.0–3.1	numerous	13
	L	24.0–34.5 × 2.3–4.6	numerous	60	21.1–27.5 × 2.5–4.8	numerous	44
spirocysts		13.6–39.4 × 2.6–6.7	numerous	67	20.8–31.0 × 3.5–7.0	numerous	68
Actinopharynx
basitrichs	S	8.6–12.3 × 2.2–3.1	few	8	22.8–32.6 × 2.4–4.0	numerous	45
	L	20.3–31.5 × 2.3–4.2	numerous	61	22.8–32.6 × 2.4–4.0	numerous	45
spirocysts		26.2–36.8 × 5.4–7.4	numerous	64	19.6–27.8 × 4.2–5.3	few	6
microbasic p-mastigophores		23.8–31.9 × 4.5–6.7	numerous	63	20.4–29.2 × 4.5–7.7	numerous	43
Column
basitrichs		26.7–36.1 × 2.0–4.2	numerous	84	31.2–39.9 × 2.3–4.2	numerous	70
Filament
basitrichs		25.3–33.6 × 2.9–4.2	numerous	31	23.9–33.5 × 2.4–4.3	numerous	28
spirocysts		20.4–38.5 × 4.9–7.1	numerous	30	24.8 × 45.3	rare	1
microbasic p-mastigophores		12.2–33.5 × 3.6–8.7	numerous	61	13.4–29.6 × 3.5–10.5	numerous	79

Figure 9. External and internal morphology of Halcurias hiroomii sp. nov. (CMNH–ZG 10212). (A) Lateral view of a living specimen; (B) lateral view of a fixed specimen; (C) oral view of a living specimen; (D) enlarged transverse section of upper column; (E) enlarged transverse section of lower column. Abbreviations: fi, filament; go, gonad; ma, macrocneme; me, mesoglea; pa, parietal muscle; rm, retractor muscle; te, tentacle. Scale bars indicate 1 cm in (A–C) and 500 µm in (D,E).

Figure 10. Cnidoms of Halcurias hiroomii sp. nov. and H. fragum sp. nov. A–K: H. hiroomii. A–C: tentacle; A, small basitrich; B, large basitrich; C, spirocyst. D–F: actinopharynx; D, small basitrich; E, large basitrich; F, spirocyst. G, microbasic p-mastigophore. H, basitrich in column. I–K: filament; I, small basitrich; J, large basitrich; K, microbasic p-mastigophore. L–U: H. fragum. L–N: tentacle; L, small basitrich; M, large basitrich; N, spirocyst. O–Q: actinopharynx; O, basitrich; P, spirocyst; Q, microbasic p-mastigophore. R, basitrich in column. S–U: filament; S, basitrich; T, spirocyst; U, microbasic p-mastigophore.

Remarks. See Table 9 for comparison to the other species of Halcuriidae. Uchida (2004) [11] described this species as Halcurias japonicus. However, this species name is nomen nudum as Uchida’s description in 2004 did not designate any type specimens. Even though Uchida indicated a specimen as the type belatedly in Uchida (2007), there is no description together, and the species name is not valid currently [48]. In the present study, we collected halcuriids which almost corresponded to the description of Uchida (2004) [11]. He only reported this species in the Japanese Sea off the Hokuriku region, but we recorded this species also from Kumano-nada Sea, the Pacific Ocean.

According to our phylogenetic tree (Figure 4), this halcuriid species was in the clade of Halcurias and lacks spirocysts in their column, and H. hiroomii should therefore remain in this genus.

Table 9. Comparison of Halcurias fragum sp. Nov. and the other species of Halcurias, including species possibly assignable to the genus.

	Halcurias fragum sp. nov.	Halcurias hiroomii sp. nov.	Halcurias pilatus McMurrich, 1893	* Halcurias capensis Carlgren, 1928	* Halcurias endocoelactis Stephenson, 1918	* Halcurias uchidai Uchida, 2004
Characters
Size (height)	9–10 mm	15–30 mm	14–15 mm	12–22 mm	48 mm	40 mm
Basitrichs of tentacles	2 types	1 type	1 type	1 type	1 type	1 type
Spirocysts in actinopharynx	Present	Present	Present	Absent	Absent	Present
Long basitrichs in filaments	Absent	Absent	Present	Unknown	Unknown	Absent
References	The present study	[11] The present study	[43,44]	[11,46]	[11,36]	[11,45]

* Species without molecular phylogenetic information.

Halcurias fragum sp. nov.

(New Japanese name: ichigo-kawari-ginchaku.)

urn:lsid:zoobank.org:act:F32F94B6-06FF-4A69-8862-861F38D79C6E

Figure 10 and Figure 11; Table 8.

Material examined. Holotype. CMNH–ZG 10216: specimen dissected, tissues embedded in paraffin, histological sections prepared, nematocysts prepared, collected by scuba diving on 22 March 2018 at Mushizaki, Sado Island, Niigata Pref., 15 m in depth, by Akihito Omori. Paratypes. NSMT–Co 1828–1829: whole specimen, same date, collector, and method as for CMNH–ZG 10216. Other specimens; CMNH–ZG 10217: whole specimen; originally collected in January 2018 at Uragami, Wakayama Prefecture, at 100–130 m, by Isao Hirabayashi, and fixed by Takuma Fujii and Kensuke Yanagi from the tank at the Kushimoto Marine Park on 22 May 2018.

Description. External anatomy. Body cylindrical (Figure 11A,B), up to ca. 10 mm in height and ca. 5 mm in width in a living specimen and 9 mm in height and 4 mm in width in a preserved specimen. Column surface comparatively smooth, reddish-orange ectoderm layer and sometimes patchy pattern with dark red and light orange, and with white tenaculi-like nematocyst batteries. Nematocysts densely distributed, especially in nematocyst batteries. Upper part of column a little narrower, white in color, simple and not thrown into lobes. Tentacles simple, all marginal, 3–6 mm in length, no thickenings including their aboral base, bright red to orange in color and pale white in roots, and 68 in number on oral disk; inner and outer ones alternatingly bared (Figure 11C). The tip of tentacles pointed. Basal disk in aboral end, opaque and mesenterial insertion invisible. Oral disk diameter broader than column, hemi-transparent, pale white. Mouth at center of oral disk, highly swelled, lip-like, groove on surface, bright orange (Figure 11A).

Internal anatomy. Twenty (ten pairs of) macrocnemes on actinopharynx: twelve, including four directives, in the first cycle and eight in the second cycle (Figure 11G,H). Macrocnemes in the second cycle born in the endocoel of the first cycle mesenteries, an arrangement obeying the rule of mesenterial arrangement of Actinernidae. Mesenteries in third and fourth cycle microcnemes. Each tentacle between either exo- or endocoelic. Tentacular longitudinal muscle exocoeletic (Figure 11F) and circular muscle too weak to observe in histological section (Figure 11F); retractor muscles restricted near actinopharynx or filaments, obviously developed (Figure 11D). Muscle processes simple or slightly branched, around 15–25 in each muscle pennon (Figure 11D). Parietal muscles of macrocnemes comparatively developed and distinct (Figure 11D). Parietal muscle processes are simple, four to seven on each side. Mesoglea thickest in body wall and actinopharynx, generally thicker than ectoderm and endoderm (Figure 11G). Mesoglea thinner than the other parts, especially in the tentacle: far thinner than ectoderm (Figure 11E,F). Actinopharynx, with siphonoglyphs on one side, always connected to actinopharynx, and the other 11 longitudinal grooves are less deep than siphonoglyphs (Figure 11G). Sphincter muscle absent. On the aboral end, basilar muscle absent. Dioecious, immature testis in our specimen. Mesenteries in second cycle fertile.

Cnidom. Basitrichs, spirocysts, and microbasic p-mastigophores. Spirocysts are absent in the column (Figure 10, Table 8).

Etymology. Fragum means strawberry in Latin. This name is derived from the nematocyst batteries on the red surface of columns of this species, which look like the seeds of strawberries.

Remarks. See Table 9 for comparison to the other species of Halcurias. This species can be easily distinguished from any other species of Halcurias as they possess two types of basitrichs in their tentacles.

This halcuriid most resembles H. pilatus McMurrich, 1893, in external morphology, but there are no long basitrichs in the filaments of this species. The long basitrichs strongly characterize H. pilatus [44]. Moreover, phylogenetic analyses indicated that this halcuriid was monophyletic with Halcurias hiroomii sp. nov., and this anemone and H. pilatus were paraphyletic. Thus, we determined this sea anemone is not H. pilatus but a new species described here.

Genus Synactinernus Carlgren, 1918.

(New Japanese name: Kuroba-kawari-ginchaku-zoku.)

Synactinernus Carlgren, 1918: 30; Carlgren, 1949: 21.

Diagnosis (revised parts are shown in bold). Actinernidae with a cylindrical body which distally is drawn out into eight distinct lobes; all eight are the same size or four larger and four smaller alternating. Column without papillae. No sphincter. Tentacles in at least two cycles without distinct mesogleal thickenings, all same length or largest at apices of the lobes, numerous. Longitudinal muscles of tentacles ectodermal, radial muscles of oral disc chiefly ectodermal, strong. Two broad siphonoglyphs on actinopharynx. In total, 36 macrocnemes cyclic in arrangement, beyond them weak mesenteries of unequal size in the upper part of the body. Retractors weak, parietal muscles weak or rather well developed.

Type species. Synactinernus flavus Carlgren, 1918.

Figure 11. External and internal morphology of Halcurias fragum sp. nov. (CMNH–ZG 10206). (A) Lateral view of a living specimen; (B) lateral view of a fixed specimen; (C) oral view of a fixed specimen; (D) enlarged transverse section of upper column; (E) enlarged longitudinal section of tentacle; (F) enlarged transverse section of tentacle; (G) enlarged transverse section of upper column; (H) enlarged transverse section of lower column. Abbreviations: a, actinopharynx; fi, filament; ma, macrocneme; me, mesoglea; oo, oocyte; pa, parietal muscle; rm, retractor muscle; s, siphonoglyph; te, tentacle. Scale bars indicate 1 cm in (A–C), 1 mm in (G,H), 500 µm in (D), and 100 µm in (E,F). Picture A was taken by Akihito Omori.

Remarks. The genus Synactinernus was established in the family Actinernidae by Carlgren (1918) [4] monotypically for Synactinernus flavus Carlgren, 1918. Later, Carlgren (1949) [7] transferred this genus to Family Actinernidae Stephenson, 1922, of suborder Endocoelantheae Carlgren, 1925. Recently, Fautin and den Hartog (2003) [10] argued that Synactinernus flavus, the only species of Synactinernus, cannot be distinguished from Isactinernus quadrilobatus Carlgren, 1918, and so, they synonymized Synactinernus with Isactinernus. However, other studies treated this genus as valid [1]. Thus, the actual status of S. flavus and the validity of Synactinernus has remained unclear.

One century after the original description of Carlgren, Izumi et al. (2019) [14] newly collected specimens of two Synactinernus species and Isactinernus quadrilobatus. According to their morphological and phylogenetic analyses, it was suggested that the Synactinernus species can be distinguished from Isactinernus quadrilobatus both by morphology and phylogeny—Synactinernus species lack the thickening on the edges of their oral disc that Isactinernus have, and they only have 36 macrocnemes, while Isactinernus have over 100; S. flavus and S. churaumi formed a clade separate from I. quadrilobatus [14]. Thus, they redescribed Synactinernus as a valid genus of the family Actinernidae and revised the diagnosis to accommodate S. churaumi Izumi and Fujii, 2019.

However, the molecular phylogeny of the present study showed that the genus Synactinernus is an independent clade from the other three genera of Actinernidae (Figure 3). Moreover, two Halcuriidae clades were paraphyletic to Synactinernus, so this genus should not be accommodated in Actinernidae but should be in Halcuriidae.

This genus is endemic in Japan and is distributed at around 300 m in depth in the East China Sea and the Pacific Ocean.

Synactinernus flavus Carlgren, 1918.

(Japanese name: Kuroba-kawari-ginchaku.)

Figures 2, 3, 5, and 6 in Izumi et al. (2019).

Synactinernus flavus Carlgren, 1918: 31.

Synactinernus flavus: Izumi et al., 2019b: 531–534, Figures 2, 3, 5, and 6.

Material examined/Description. See Izumi et al. (2019) [14].

Synactinernus churaumi Izumi and Fujii, 2019.

(Japanese name: Churaumi-kawari-ginchaku.)

Figures 2, 5, and 7 in Izumi et al. (2019).

Synactinernus churaumi Izumi and Fujii, 2019: Izumi et al., 2019b: 534–537; Figures 2, 5, and 7.

Material examined/description. See Izumi et al. (2019) [14].

Genus Isohalcurias gen. nov.

(New Japanese name: kawari-ginntyaku-modoki-zoku.)

urn:lsid:zoobank.org:act:E16FF13C-6711-4822-9F54-0803733AC956

Diagnosis. Mesenteries up to 34 pairs arranged in 4 cycles, 6 + 4 + 8 + 16. Macrocnemes, 10 pairs, fertile, filamented, and with restricted retractors. Microcnemes in only the upper part of the body, some of them perfect. Retractor muscles diffused and pinnate. Parietal muscles rather well developed to fairly weak. Tentacles, up to 68. Dioecious. Cnidom: spirocysts and basitrichs (in all tissues) and microbasic p-mastigophores (in actinopharynx and filaments).

Type species. Isohalcurias carlgreni (McMurrich, 1901).

Etymology. Isohalcurias is derived from “Iso (=Greek isos, equal)” + “halcurias (the divided genus)”. Isohalcurias species resemble species of Halcurias so much that they cannot be distinguished unless making sections or inspecting cnidae.

Remarks. According to our phylogenetic analyses (Figure 9 and Figure 10), the species which were originally identified as genus Halcurias were paraphyletic. The outer clade, which contained H. carlgreni, H. citreum sp. nov., and H. malum sp. nov., did not contain the type species, Halcurias pilatus. Thus, this group cannot be named Halcurias. This is why we established the new genus Isohalcurias gen. nov. for these three species.

See Table 7 for a comparison with the other genera of Halcuriidae. This genus can be identified by having spirocysts in the column (comparison of Isohalcurias gen. nov. in Table 8 and Table 10) and partly pinnate retractor muscles (e.g., Figure 12D, 14D, and 15C). In addition to the three species, Halcurias minimus Carlgren, 1928, and Halcurias sudanensis Riemann-Zürneck, 1983, are possibly in this new genus as these species have spirocysts in the body wall [11,46,47]. It is hoped to obtain molecular information on these species for phylogenetic analyses in future.

Isohalcurias carlgreni (McMurrich, 1901) comb. nov.

(Japanese name: kawari-ginchaku.)

urn:lsid:zoobank.org:act:71D07E54-D6C4-4888-8FD5-4A3F5301CE7A

Figure 12 and Figure 13; Table 10.

Halcurias Carlgreni McMurrich 1901: 159.

Halcurias carlgreni: Carlgren, 1914: 69; Uchida 2004: 9–13, Figure 1, pl. 1A, B.

Material examined. NSMT–Co 1697: specimen dissected, tissues embedded in paraffin, histological sections prepared, nematocysts prepared, collected on 19 September 2011, collected from Suo-Oshima, Yamaguchi Pref., Japan, at 10 m in depth, by scuba diving, by Takuma Fujii; NSMT–Co 1698: specimen dissected, tissues embedded in paraffin, histological sections prepared, nematocysts prepared, same collector, locality, and method as for NSMT–Co 1697; NSMT–Co 1830: whole specimen, same collector, locality, and method as for NSMT–Co 1697; CMNH–ZG 10218: specimen dissected, tissues embedded in paraffin, histological sections prepared, nematocysts prepared; collected by trawling of fishing boat Jinsho-Maru from Kumano-nada Sea off Mie Pref. (depth and date unknown), by Takeya Moritaki, kept in Toba Aquarium for a while, and preserved on 18 June 2017 by Takato Izumi; CMNH–ZG 10219: juvenile specimen dissected, tissues embedded in paraffin, histological sections prepared, nematocysts prepared, collected on 19 September 2015, collected from west-off Uki-shima, Chiba Pref., Japan, at 20 m in depth, by scuba diving, by Junji Okuno; CMNH–ZG 10220: whole specimen, same collector, locality, and method as for CMNH–ZG 10219; UUZM 705b, 705c (syntypes): on 14 March 1890, Hirado Strait (33°5′ N, 129°16 E); UUZM 705a (syntype): in 1893, off Hirado (33°15 N, 129°15 E), 45 fathoms (ca. 82 m) depth; UUZM 705d (syntype; Figure 7E): Korea Strait 65 fathoms (ca. 120 m) depth; ZMNH–TYPE–4908 (syntype): in 1893, China sea, 30 fathoms (ca 55 m) depth; ZMNH–TYPE–1200 (syntype; Figure 7F): in 1893, off Hirado (33°15 N, 129°15 E), 45 fathoms (ca, 82 m) depth.

Description. External anatomy. Body cylindrical (Figure 12A,B), up to 17–70 mm in height and ca. 11–50 mm in width. Column surface comparatively smooth, with reddish-orange ectoderm layer and sparse small nematocyst batteries. Nematocysts densely distributed, especially in nematocyst batteries. Tentacles simple, all marginal, 6–40 mm in length, no thickenings including their aboral base, pale white in color, and 68 in number on oral disk; inner and outer ones alternatingly bared (Figure 12A). The tip of tentacles pointed. Basal disc distinct and adhesive (Figure 12A), opaque, and mesenterial insertion invisible. Oral disk diameter as broad as column, hemi-transparent, pale white. Mouth at center of oral disk, highly swelled, lip-like, groove on surface, white in color.

Figure 12. External and internal morphology of Isohalcurias carlgreni comb. nov. (NSMT–Co 1697). (A) Living individuals in nature; (B) lateral view of a fixed specimen; (C) transverse section of upper column; (D) enlarged transverse section of upper column; (E) enlarged transverse section of lower column. Abbreviations: a, actinopharynx; fi, filament; ma, macrocneme; me, mesoglea; pa, parietal muscle; rm, retractor muscle; s, siphonoglyph; te, tentacle; ts, testis. Scale bars indicate 5 cm in (A), 1 cm in (B,C), 1 mm in (D), and 500 µm in (E). Picture A was taken by Takuma Fujii.

Internal anatomy. Twenty (ten pairs of) macrocnemes on actinopharynx: twelve, including four directives, in the first cycle and eight in the second cycle (Figure 12C). Macrocnemes in the second cycle born in the endocoel of the first cycle mesenteries, an arrangement obeying the rule of mesenterial arrangement of Actinernidae. Mesenteries in third and fourth cycle microcnemes. Each tentacle between either exo- or endocoelic. Tentacular longitudinal muscle exocoeletic and circular muscle endocoeletic; retractor muscles restricted near parietal muscles, obviously developed and pinnate (Figure 12D). Muscle processes well-branched, around 8–15 in each muscle pennon (Figure 12D). Parietal muscles of macrocnemes comparatively developed and distinct with simple or slightly branched 4–11 processes in each side. Mesoglea thickest in body wall and actinopharynx, generally thicker than ectoderm and endoderm (Figure 12D). Mesoglea thinner than the other parts, especially in the tentacle: far thinner than ectoderm. Actinopharynx, with siphonoglyphs on one side, always connected to actinopharynx, and the other 15–19 longitudinal grooves are less deep than siphonoglyphs (Figure 12C). Sphincter muscle absent. On the aboral end, basilar muscle absent. Dioecious, immature testis in our specimen (Figure 12E). Mesenteries in second cycle fertile.

Cnidom. Basitrichs, spirocysts, and microbasic p-mastigophores. Spirocysts are numerous in the column (Figure 13, Table 10).

Figure 13. Cnidoms of Isohalcurias carlgreni comb. nov., I. citreum sp. nov., and I. malum sp. nov. A–N: I. carlgreni. A–B: tentacle; A, basitrich; B, spirocyst. C–G: actinopharynx; C, small basitrich; D, large basitrich; E, spirocyst; F, microbasic p-mastigophore; G, microbasic b-mastigophore. H–J: column; H, small basitrich; I, large basitrich; J, spirocyst. K–N: filament; K, small basitrich; L, large basitrich; M, microbasic p-mastigophore; N, microbasic b-mastigophore. O–a: I. carlgreni. O–Q: tentacle; O, small basitrich; P, large basitrich; Q, spirocyst. R–U: actinopharynx; R, basitrich; S, spirocyst; T, microbasic p-mastigophore; U, microbasic b-mastigophore. V–W: column; V, basitrich; W, spirocyst. X–a: filament; X, small basitrich; Y, large basitrich; Z, spirocyst; a, microbasic p-mastigophore. b–o: I. malum. b–e: tentacle; b, small basitrich; c, small basitrich; d, spirocyst; e, microbasic b-mastigophore. f–i: actinopharynx; f, basitrich; g, spirocyst; h, microbasic p-mastigophore; i, microbasic b-mastigophore. j–k: column; j, basitrich; k, spirocyst. l–o: filament; l, small basitrich; m, large basitrich; n, microbasic p-mastigophore; o, microbasic p-mastigophore.

Table 10. Cnidoms of the species of Isohalcurias gen. nov.

		Isohalcurias carlgreni comb. nov.			Isohalcurias citreum sp. nov.			Isohalcurias malum sp. nov.
		NSMT–Co 1697			CMNH–ZG 10221			NSMT–Co 1699
		Length × Width (µm)	frequency	N	Length × Width (µm)	frequency	N	Length × Width (µm)	frequency	N
Tentacle
basitrichs		13.1–38.4 × 2.4–7.8	numerous	30	27.0–34.8 × 2.6–4.1	numerous	61	15.8–19.9 × 3.0–3.5	rare	3
basitrichs		13.1–38.4 × 2.4–7.8	numerous	30	47.4 × 5.2	rare	1	28.9–39.1 × 2.7–4.4	numerous	37
spirocysts		20.6–26.3 × 2.6–3.7	numerous	101	22.5–42.9 × 2.6–5.9	numerous	43	21.8–41.2 × 4.0–7.3	numerous	25
microbasic b-mastigophores								30.1–36.3 × 3.4–6.0	numerous	11
Actinopharynx
basitrichs	S	8.4–12.9 × 1.5–2.4	numerous	19	22.6–30.8 × 3.0–4.3	numerous	62	25.7–36.2 × 3.2–4.5	numerous	37
	L	20.6–27.8 × 2.7–3.9	numerous	13	22.6–30.8 × 3.0–4.3	numerous	62	25.7–36.2 × 3.2–4.5	numerous	37
spirocysts		21.0–25.5 × 4.3–5.9	few	5	22.6–33.9 × 4.1–7.9	numerous	51	31.5–52.0 × 5.8–9.6	numerous	64
microbasic p-mastigophores		19.3–23.7 × 4.5–6.3	numerous	13	23.4–29.2 × 5.2–7.0	numerous	39	29.0–35.2 × 5.3–7.2	numerous	16
microbasic b-mastigophores		20.6–23.9 × 5.4–6.4	rare	3	25.6–28.6 × 4.3–5.4	rare	4	30.1–37.1 × 5.6–7.4	few	6
Column
basitrichs	S	7.3–11.3 × 1.5–2.6	numerous	23	23.6–34.1 × 2.3–3.5	numerous	24	23.8–34.2 × 2.7–4.1	numerous	37
	L	23.4–31.6 × 2.2–3.8	numerous	57	23.6–34.1 × 2.3–3.5	numerous	24	23.8–34.2 × 2.7–4.1	numerous	37
spirocysts		15.7–27.5 × 3.9–5.2	numerous	13	24.7–32.3 × 4.2–7.0	numerous	69	27.8–37.1 × 4.2–6.1	numerous	27
Filament
basitrichs	S	7.3–11.9 × 1.5–2.8	numerous	38	7.0–12.5 × 1.5–2.8	numerous	47	9.9–19.8 × 1.7–4.4	numerous	48
	L	24.5–25.3 × 3.9–4.2	rare	2	25.9–30.1 × 2.7–4.2	numerous	24	26.7–28.0 × 3.8–5.0	rare	2
spirocysts					7.5–31.4 × 1.6–6.9	numerous	71	28.3–33.3 × 5.4–7.1	rare	4
microbasic p-mastigophores		14.4–26.3 × 5.0–8.4	numerous	41	23.2–27.7 × 5.4–7.6	numerous	28	25.2–34.8 × 5.6–9.2	numerous	52
microbasic b-mastigophores		23.6–25.3 × 6.2–7.8	rare	3

Remarks. This species was described as Halcurias carlgreni in McMurrich (1901) [49] and reported from Japan in 2004 [11]. H. carlgreni was characterized by the ectoderm of the column containing numerous spirocysts [11]. Our specimens corresponded well with these descriptions, so we identified them as H. carlgreni.

However, as mentioned above, Halcurias became paraphyletic to Synactinernus. The clade, including Halcurias carlgreni, H. citreum sp. nov., and H. malum sp. nov., did not contain Halcurias pilatus, the type species (Figure 4). Thus, these species should be moved to the new genus Isohalcurias, and thus, H. carlgreni becomes Isohalcurias carlgreni comb. nov.

Isohalcurias citreum sp. nov.

(Japanese name: oo-kawari-ginchaku.)

urn:lsid:zoobank.org:act:AB02934A-BFDF-400B-8432-E33092D96DE9

Figure 13 and Figure 14; Table 10.

Halcurias levis (nomen nudum) Uchida, 2004: 16, Figures 3 and 4, pl. 1F.

Material examined. Holotype. NSMT–Co 1831: specimen dissected, tissues embedded in paraffin, histological sections prepared, nematocysts prepared, collected on 28 January 2017 from Kuju-kushima (off Kuroshima), Nagasaki Pref., 35 m in depth, bycatch with fishes by gill net, kept in the tank of Saikai National Park Kuju-kushima Aquarium, and preserved on 14 April 2017 by Takato Izumi. Paratype. CMNH 10221: specimen dissected, tissues embedded in paraffin, histological sections prepared, nematocysts prepared, collected on 7 October 2008 from Aishima Island, Hagi, Yamaguchi Pref., 47 m in depth, collected by scuba diving by Kensuke Yanagi. Other specimen. CMNH–ZG10222: specimen dissected, tissues embedded in paraffin, histological sections prepared, nematocysts prepared, collected on 17 May 2018 off Yaku-shima Island (30°09.39′ N, 130°38.03′ E; St. 3) at 200–255 m in depth, using beam trawl, during research cruise of R/V Toyoshio-Maru, by Itaru Kobayashi.

Description. External anatomy. Body cylindrical (Figure 14A,B), up to ca. 150 mm in height and ca. 100 mm in width in a living specimen and 34–90 mm in height and 20–35 mm in width in a preserved specimen. Column surface smooth and without nematocysts batteries. Whole body bright yellow in color. Nematocysts sparsely distributed on column. Upper part of column narrower, same color as column, simple and not thrown into any lobes. Tentacles simple, all marginal, 30–50 mm in length, no thickenings including their aboral base, bright yellow in color, and 68 in number; inner and outer ones alternatingly bared (Figure 14A). The tips of tentacles pointed. Basal disk in aboral end (Figure 14A), yellowish opaque and mesenterial insertion inapparently visible. Oral disk diameter narrower than column, hemi-transparent, bright yellow. Mouth at center of oral disk, highly swelled, lip-like, groove on surface, bright yellow.

Internal anatomy. Twenty (ten pairs of) macrocnemes on actinopharynx: twelve, including four directives, in the first cycle and eight in the second cycle (Figure 14C). Macrocnemes in the second cycle born in the endocoel of the first cycle mesenteries, an arrangement obeying the rule of mesenterial arrangement of Actinernidae. Mesenteries in third and fourth cycle microcnemes. Each tentacle between either exo- or endocoelic. Tentacular longitudinal muscle and circular muscle too weak to observe in histological section (Figure 14E); retractor muscles diffused, weak, and pinnate (Figure 14D,F). Muscle processes well branched, around 9–17 in each muscle pennon (Figure 14D). Parietal muscles of macrocnemes well developed and distinct. Parietal muscle weak, with simple or slightly branched processes, around 10 in each side (Figure 14D,F). Mesoglea thickest in body wall, and even thick in mesenteries and actinopharynx, far thicker than ectoderm and endoderm (Figure 14C,D). Actinopharynx, with siphonoglyphs on one side, always connected to actinopharynx, and the other 19 longitudinal grooves are as deep as siphonoglyphs (Figure 14C). Sphincter muscle absent. On the aboral end, basilar muscle absent. Dioecious, matured ovaries in NSMT–Co 1831 (Figure 14F). Mesenteries in second to third cycle fertile.

Cnidom. Basitrichs, spirocysts, and microbasic p-mastigophores. Spirocysts are numerou in the column (Figure 13, Table 10).

Etymology. Citreum means lemon in Latin. This name is derived from the fluorescent lemon-yellow color of this species.

Remarks. Uchida (2004) [11] described this species as Halcurias levis. However, this species name became nomen nudum for the same reason as H. japonicus. The specimens we collected correspond well to the description of Uchida [11] morphologically, so we report them as this species provisionally.

Figure 14. External and internal morphology of Isohalcurias citreum sp. nov. (NSMT–Co 1831). (A) Lateral view of a living specimen; (B) lateral view of a fixed specimen; (C) transverse section of dissected specimen; (D) enlarged transverse section of upper column; (E) enlarged longitudinal section of lower column. (F) enlarged transverse section of lower column; Abbreviations: a, actinopharynx; fi, filament; ma, macrocneme; me, mesoglea; ov, ovary; pa, parietal muscle; rm, retractor muscle; s, siphonoglyph; te, tentacle. Scale bars indicate 1 cm in (A–C) and 1 mm in (D,E).

This species was accommodated in the clade of Isohalcurias but cannot be obviously separated from I. carlgreni comb. nov. in the phylogenetic tree (Figure 10). However, there were several differences between these halcuriids, e.g., body sizes, presence or absence of nematocyst batteries, development of retractor muscles, and so forth (see Table 11). Judging by the common view on phylogenetic analyses of sea anemones with the combination of several molecular markers [13,50,51], it is probable that any simple DNA marker phylogenetic analysis method of the present day cannot distinguish I. carlgreni and I. citreum sp. nov. in a phylogenetic tree. In conclusion, this study described this species as Isohalcurias citreum sp. nov. by morphology.

This species had been discovered only in Syoga-se, off Wakayama Pref. [11,52,53], but we newly confirmed it in the Sea of Japan (CMNH–ZG 10221), Goto-Nada Sea (NSMT–Co 1831), and the East China Sea (CMNH–ZG 10222).

Isohalcurias malum sp. nov.

(New Japanese name: ringo-kawari-ginchaku.)

urn:lsid:zoobank.org:act:6E2B09F5-3C94-4BAD-B690-E12C13E9711B

Figure 13 and Figure 15; Table 10.

Material examined. Holotype. CMNH–ZG 10223: specimen dissected, tissues embedded in paraffin, histological sections prepared, nematocysts prepared, originally collected on 15 May 2005 from Ryukyu Trough off Kume-jima Island (25°30.96′ N, 126°29.21′ E; St. OT-14), at 372–375 m in depth, using beam trawl, during research cruise of R/V Hakuho-Maru by Kensuke Yanagi. Paratypes. NSMT–Co 1699: specimen dissected, tissues embedded in paraffin, histological sections prepared, nematocysts prepared, originally collected n 24 May 2015, west off Cape Sata (31°02.06′ N, 130°33.37′ E; St. 7), at 202 m in depth, using biological dredge, during research cruise of R/V Toyoshio-Maru by Mikihito Arai and Akito Ogawa; CMNH–ZG 10224: specimen dissected, tissues embedded in paraffin, nematocysts prepared, collected on 23 May 2019, west off Amami-Oshima Island (28°22.42′ N, 129°15.14′ E), at 315 m in depth, using beam trawl, during research cruise of R/V Toyoshio-Maru by Itaru Kobayashi. Other specimen: CMNH–ZG 10225: whole specimen, originally collected on January 2018 at Uragami, Wakayama Prefecture, at 100–130 m by Isao Hirabayashi, and fixed by Takuma Fujii and Kensuke Yanagi from the tank at the Kushimoto Marine Park on 22 May 2018.

Description. External anatomy. Body cylindrical (Figure 15A), up to ca. 50 mm in height and ca. 30 mm in width in a living specimen and 25–40 mm in height and 10–20 mm in width in a preserved specimen. Column surface smooth and without nematocysts batteries, pale red to pale orange ectoderm layer, and sometimes fine dark red or orange patches on the middle column. Aboral end of column pale yellow. Nematocysts sparsely distributed on column. Upper part of column a little expanded, same color as column, simple and not thrown into lobes. Tentacles simple, all marginal, 10–20 mm in length, no thickenings including their aboral base, bright red to orange in color (more blight color on distal side), and 68 in number on oral disk; inner and outer ones alternatingly bared. The tips of tentacles pointed. Basal disk in aboral end (Figure 15A), yellowish opaque and mesenterial insertion inapparently visible. Oral disk diameter broader than column, hemi-transparent, pale white. Mouth at center of oral disk, highly swelled, lip-like, groove on surface, bright orange.

Internal anatomy. Twenty (ten pairs of) macrocnemes on actinopharynx: twelve, including four directives, in the first cycle and eight in the second cycle (Figure 15B). Macrocnemes in the second cycle born in the endocoel of the first cycle mesenteries, an arrangement obeying the rule of mesenterial arrangement of Actinernidae. Mesenteries in third and fourth cycle microcnemes (Figure 15B). Each tentacle between either exo- or endocoelic. Tentacular longitudinal muscle and circular muscle too weak to observe in histological section (Figure 15D); retractor muscles diffused but obviously developed and pinnate (Figure 15C,E). Muscle processes well branched, around 10–20 in each muscle pennon (Figure 15C). Parietal muscles of macrocnemes well developed and distinct. Parietal muscle processes well branched, around 10 in each side (Figure 15E). Mesoglea thickest in body wall and actinopharynx (Figure 15B,E), far thicker than ectoderm and endoderm. Mesoglea a little thinner than the other parts, but generally thicker than ectoderm and endoderm (Figure 15C,D). Actinopharynx, with siphonoglyphs on one side, always connected to actinopharynx, and the other 11 longitudinal grooves are as deep as siphonoglyphs (Figure 15B). Sphincter muscle absent. On the aboral end, basilar muscle absent (Figure 15G). Dioecious, matured ovaries in NSMT–Co 1699 (Figure 15F). Mesenteries in second to third cycle fertile.

Cnidom. Basitrichs, spirocysts, microbasic p-mastigophores, and microbasic b-mastigophores. Spirocysts are numerous in the column (Figure 13, Table 10).

Etymology. Malum means apple in Latin. This name is derived from the red and yellow color pattern of this species, which resembles apples.

Remarks. See Table 11 for a comparison with the other species of Isohalcurias and some species possibly assignable to this genus; since they have spirocysts on their columns [46,47], these species of Halcurias are possibly assignable to the genus Isohalcurias. However, molecular phylogenetic analyses of them have not been carried out. Thus, new combinations were not proposed for these species in this study.

Figure 15. External and internal morphology of Isohalcurias malum sp. nov. (NSMT–Co 1699). (A) Lateral view of a living specimen (photographed by Mikihito Arai); (B) transverse section of dissected specimen; (C) enlarged view of retractor muscle; (D) transverse section of tentacle; (E) enlarged transverse section of upper column; (F) enlarged transverse section of lower column; (G) longitudinal section of basal disc. Abbreviations: a, actinopharynx; bd, basal disc; ma, macrocneme; me, mesoglea; mi, microcneme; ov, ovary; pa, parietal muscle; rm, retractor muscle; s, siphonoglyph; te, tentacle. Scale bars indicate 1 cm in (A,B), 1 mm in (G), 500 µm in (C,E,F), and 200 µm in (D).

According to the Uchida’s taxonomic key [11], these sea anemones are most similar to Halcurias minimus Carlgren, 1928, because they have a column without longitudinal muscles, an actinopharynx containing large spirocysts, a column containing spirocysts (though no nematocyst batteries), and tentacles with two types of basitrichs. However, there are several differences between these anemones and H. minimus: there are no nematocyst batteries on this species, while they are sparsely distributed on the column of H. minimus [11,46]; the size of H. minimus is 0.8 cm [46], approximately one-fourth of the size of our specimens. Moreover, H. minimus only inhabits the deep sea of the circum-antiboreal region, far distant from the localities of this anemone, so it is unlikely that the same species lives in Japan, especially in the seas of the temperate zone. Thus, we concluded that these anemones represent a new species, Isohalcurias malum sp. nov.

Table 11. Comparison of Isohalcurias malum sp. nov. and the other species of Isohalcurias gen. nov., including a species possibly assignable to the genus.

	Isohalcurias malum sp. nov.	Isohalcurias carlgreni (McMurrich, 1901) comb. nov.	Isohalcurias citreum sp. nov.	* Halcurias minimus Carlgren, 1928	* Halcurias sudanensis Riemann-Zürneck, 1983
Characters
Size (height)	25–40 mm	11–50 mm	34–90 mm	8 mm	30 mm
Retractor muscle	Distinct Pinnate	Distinct Strongly pinnate	Weak Strongly pinnate	Distinct Pinnate	Weak Slightly Pinnate
Parietal muscle	Distinct with well-branched muscular processes	Weak with simple muscular processes	Weak with simple muscular processes	Weak with simple muscular processes	Weak with simple muscular processes
Basitrichs of tentacles	2 types	1 type	2 types	2 types	1 type
Spirocysts in actinopharynx	Present	Present	Present	Absent	Present
Spirocysts in column	Present	Present	Present	Present (but sparse)	Present
Long basitrichs in filaments	Absent	Absent	Absent	Unknown	Absent
References	The present study	[11,49] The present study	[11] The present study	[11,46]	[47]

* Species without molecular phylogenetic information.

4. Conclusions

Our taxonomic and phylogenetic study resulted in these conclusions.

The superfamily Actinernoidea Stephenson, 1922, is classified into three families, Actinernidae, Halcuriidae, and Isactinernidae fam. nov.
Actinernidae Stephenson, 1922, was polyphyletic—the genus Synactinernus Carlgren, 1918, was in the clade of Halcuriidae Carlgren, 1918, and thus, it does not belong to the actinernid sea anemones anymore. The other three genera, Actinernus Verrill, 1879, Isactinernus Carlgren, 1918, and Synhalcurias Carlgren, 1914, appeared to be monophyletic but were divided into two families, Actinernidae and Isactinernidae fam. nov., because of a lack of common features.
The genus Halcurias McMurrich, 1893, was paraphyletic—it was divided into two clades because this genus was paraphyletic to Synactinernus. The taxon including the type species remains as Halcurias, and the other became a new genus, Isohalcurias gen. nov. Isohalcurias can be distinguished from Halcurias by the presence of spirocysts in columns and developing pinnate retractor muscles.
Four new species of Actinernoidea were described, and thus, there are 11 Japanese species of Actinernoidea in total. As a consequence of our study, over a half of Actinernoidea species (11 species out of 23) have been confirmed in Japan.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/d15060773/s1, Figure S1: Maximum likelihood tree of the superfamily Actinernoidea based on the combined dataset of nuclear 18S, 28S, and 5.8S rDNA; and ITS1/ITS2; Figure S2: Bayesian tree of the superfamily Actinernoidea based on the combined dataset of nuclear 18S, 28S, and 5.8S rDNA; and ITS1/ITS2; Figure S3: Maximum likelihood tree of the superfamily Actinernoidea based on the combined dataset of mitochondrial 12S and 16S; Figure S4: Bayesian tree of the superfamily Actinernoidea based on the combined dataset of mitochondrial 12S and 16S.

Author Contributions

Conceptualization, T.I. and T.F. (Takuma Fujii); methodology, T.I. and T.F. (Takuma Fujii); software, T.I.; validation, T.I., T.F. (Takuma Fujii) and K.Y.; formal analysis, T.I.; investigation, T.I., T.F. (Takuma Fujii) and K.Y.; resources, T.I., T.F. (Takuma Fujii) and K.Y.; data curation, T.I. and K.Y.; writing—original draft preparation, T.I.; writing—review and editing, T.F. (Takuma Fujii), K.Y. and T.F. (Toshihiko Fujita); visualization, T.I.; supervision, K.Y. and T.F. (Toshihiko Fujita); project administration, T.I. and K.Y.; funding acquisition, T.I., T.F. (Takuma Fujii), K.Y. and T.F. (Toshihiko Fujita). All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by JSPS KAKENHI (Grants Number JP17J03267 and 20J00120 to the first author, 24-3048, JP17K15198, JP17H01913, and JP21H03651 to the second author, and JP25440221 to the third author); Grant-in-Aid for JSPS Fellow PD (202000120) to the first author; “Establishment of Research and Education Network on Biodiversity and Its Conservation in the Satsunan Islands” project of Kagoshima University granted by the Ministry of Education, Culture, Sports, Science and Technology, Japan, to the second author; and the National Museum of Nature and Science project research “Geological, biological, and anthropological histories in relation to the Kuroshio Current” to the fourth author.

Institutional Review Board Statement

Not applicable.

Data Availability Statement

All data can be found within the manuscript.

Acknowledgments

We acknowledge the people, ships, and institutions below for their help in obtaining specimens: R/V Hakuho-Maru and Tansei-Maru (JAMSTEC) and their crews for the collection of Actinernus robustus; Tomoharu Kimura (Uozu Aquarium), Masato Todate (Takeshima Aquarium), Isao Hirabayashi (Kushimoto Marine Park), and fishing boat Koei-Maru for providing Halcurias hiroomii; Takeya Moritaki (Toba Aquarium), Mitsuko Chikuchishin/Naoko Dewa (Kagoshima City Aquarium), and fishing boats Kiei-Maru and Koei-Maru for collecting/providing Isactinernus robustus; T. Moritaki, fishing boat Jinsho-Maru, Junji Okuno (CMNH), and Masaaki Fujimoto (Nature and Fishing Network) for collecting/providing Isohalcurias carlgreni; Eriko Awau/Mayumi Deki (Saikai National Park Kujukushima Aquarium), T/V Toyoshio-Maru (Hiroshima University) and crew, and Itaru Kobayashi (NSMT) for providing Isohalcurias citreum; Akihito Omori (Marine Biological Station, Sado Island Center for Ecological Sustainability, Niigata University) for the collection of Halcurias fragum; T/V Toyoshio-Maru and crew, Mikihito Arai/Akito Ogawa/I. Kobayashi (NSMT), and Takuo Higashiji/Atsushi Kaneko (Okinawa Churaumi Aquarium) for collecting/providing Isohalcurias malum. We thank Yuji Ise (then Sugashima Marine Biological Laboratory, Nagoya University) and Takuma Haga (NSMT) for teaching us molecular analyses. Finally, we acknowledge James Davis Reimer, who revised our English in this article thoroughly.

Conflicts of Interest

The authors declare no conflict of interest.

References

Fautin, D.G. Catalog to families, genera, and species of orders Actiniaria and Corallimorpharia (Cnidaria: Anthozoa). Zootaxa 2016, 4145, 1–449. [Google Scholar] [CrossRef] [PubMed]
Yanagi, K. Chapter 4, Actiniaria. In How to Study Sessile Organisms: Revised; The Sessile Organisms Society of Japan: Tokyo, Japan; Kouseisha Kouseikaku: Tokyo, Japan, 2017; pp. 53–87. [Google Scholar]
Shick, J.M. A Functional Biology of Sea Anemones; Chapman & Hall: London, UK, 1991; 395p. [Google Scholar]
Carlgren, O. A survey of the Ptychodactiaria, Corallimorpharia and Actiniaria. Kungl. Sven. Vetensk. Handl. 1949, 1, 1–121. [Google Scholar]
Andres, A. Prodromus neapolitanae actiniarum faunae addito generalis actiniarum bibliographiae catalogo. Mitt. Zool. Sta. Neapel 1881, 2, 305–371. [Google Scholar]
Gusmão, L.C.; Berniker, L.; Van Deusen, V.; Harris, O.; Rodríguez, E. Halcampulactidae (Actiniaria, Actinostoloidea), a new family of burrowing sea anemones with external brooding from Antarctica. Polar Biol. 2019, 42, 1271–1286. [Google Scholar] [CrossRef]
Carlgren, O. Die Mesenterienanordnung der Halcuriiden. In Kungliga Fysiografiska Sällskapet Lundlingar; Academy of Natural Sciences, Medicine and Technology: Lund, Sweden, 1918; Volume 29, pp. 1–37. [Google Scholar]
Stephenson, T.A. On the classification of Actiniaria. Part III.-Definitions connected with the forms dealt with in Part II. Quar. J. Microscop. Sci. 1922, 66, 247–319. [Google Scholar]
Carlgren, O. Zur Kenntnis der Hexacorallen. Zool. Anzeig. 1925, 65, 87–99. [Google Scholar]
Fautin, D.G.; den Hartog, J.C. An unusual sea anemone from slope depths of the tropical west Pacific: Range extension and redescription of Isactinernus quadrilobatus Carlgren, 1918 (Cnidaria: Actiniaria: Actinernidae). Zool. Verhandel. 2003, 345, 103–116. [Google Scholar]
Uchida, H. Actinologica Japonica (1) on the actiniarian family Halcuriidae from Japan. Kuroshio Biosph. 2004, 1, 7–16. [Google Scholar]
Uchida, H. Actinologia Japonica (2) on the actiniarian family Actinernidae from Japan. Kuroshio Biosph. 2007, 3, 17–32. [Google Scholar]
Rodríguez, E.; Barbeitos, M.S.; Brugler, M.R.; Crowley, L.M.; Grajales, A.; Gusmão, L.; Häussermann, V.; Reft, A.; Daly, M. Hidden among sea anemones: The first comprehensive phylogenetic reconstruction of the Order Actiniaria (Cnidaria, Anthozoa, Hexacorallia) reveals a novel group of hexacorals. PLoS ONE 2014, 9, e96998. [Google Scholar] [CrossRef]
Izumi, T.; Fujii, T.; Yanagi, K.; Higashiji, T.; Fujita, T. Redescription of Synactinernus flavus for the First Time after a Century and Description of Synactinernus churaumi sp. nov. (Cnidaria: Anthozoa: Actiniaria). Zool. Sci. 2019, 36, 528–538. [Google Scholar] [CrossRef]
Izumi, T.; Yanagi, K. Description of the second species of Synhalcurias Carlgren, 1914, Synhalcurias kahakui sp. nov. (Actiniaria: Actinernidae) with redescription of S. elegans (Wassilieff, 1908). Zootaxa 2021, 5048, 561–574. [Google Scholar] [CrossRef]
Presnell, J.K.; Schreibman, M.P. Humason’s Animal Tissue Techniques, 5th ed.; Johns Hopkins University Press: Baltimore, MD, USA, 1997; 572p. [Google Scholar]
Daly, M.; Endara, L.A.; Burleigh, J.G. Peeking behind the page: Using natural language processing to identify and explore the characters used to classify sea anemones. Zool. Anzeig-J. Comp. Zool. 2015, 256, 54–60. [Google Scholar] [CrossRef]
Yanagi, K.; Fujii, T.; Hirose, M. Redescription of the sea anemone Exocoelactis actinostoloides (Cnidaria: Anthozoa: Actiniaria) based on a topotypic specimen collected from Tokyo Bay, Japan. Species Divers. 2015, 20, 199–209. [Google Scholar] [CrossRef]
Rasband, W.S. ImageJ, U.S. 1997–2012; National Institutes of Health: Bethesda, MD, USA. Available online: http://imagej.nih.gov/ij/ (accessed on 7 October 2020).
Mariscal, R.N. Nematocysts. In Coelenterate Biology: Reviews and New Perspectives; Muscatine, L., Lenhoff, H.M., Eds.; Academic Press: New York, NY, USA, 1974; pp. 129–178. [Google Scholar]
Sinniger, F.; Reimer, J.D.; Pawlowski, J. The Parazoanthidae (Hexacorallia: Zoantharia) DNA taxonomy: Description of two new genera. Mar. Biodivers. 2010, 40, 57–70. [Google Scholar] [CrossRef]
Apakupakul, K.; Siddall, M.E.; Burreson, E.M. Higher level relationships of leeches (Annelida: Clitellata: Euhirudinea) based on morphology and gene sequences. Mol. Phylogenetics Evol. 1999, 12, 350–359. [Google Scholar] [CrossRef]
Geller, J.B.; Walton, E.D. Breaking up and getting together: Evolution of symbiosis and cloning by fission in sea anemones (genus Anthopleura). Evolution 2001, 55, 1781–1794. [Google Scholar]
Medina, M.; Collins, A.G.; Silberman, J.D.; Sogin, M.L. Evaluating hypotheses of basal animal phylogeny using complete sequences of large and small subunit rRNA. Proc. Nat. Acad. Sci. USA 2001, 98, 9707–9712. [Google Scholar] [CrossRef]
Medlin, L.; Elwood, H.J.; Stickel, S.; Sogin, M.L. The characterization of enzymatically amplified eukaryotic 16S-like rRNA-coding regions. Gene 1988, 71, 491–499. [Google Scholar] [CrossRef] [PubMed]
Sinniger, F.; Montoya-Burgos, J.I.; Chevaldonné, P.; Pawlowski, J. Phylogeny of the order Zoantharia (Anthozoa, Hexacorallia) based on the mitochondrial ribosomal genes. Mar. Biol. 2005, 147, 1121–1128. [Google Scholar] [CrossRef]
Littlewood, D.T.J.; Curini-Galletti, M.; Herniou, E.A. The interrelationships of Proseriata (Platyhelminthes: Seriata) tested with molecules and morphology. Mol. Phylogenetics Evol. 2000, 16, 449–466. [Google Scholar] [CrossRef] [PubMed]
Williams, S.T.; Reid, D.G.; Littlewood, D.T.J. A molecular phylogeny of the Littorininae (Gastropoda: Littorinidae): Unequal evolutionary rates, morphological parallelism and biogeography of the Southern Ocean. Mol. Phylogenet. Evol. 2003, 28, 60–86. [Google Scholar] [CrossRef]
Williams, S.T.; Ozawa, T. Molecular phylogeny suggests polyphyly of both the turban shells (family Turbinidae) and the superfamily Trochoidea (Mollusca: Vetigastropoda). Mol. Phylogenetics Evol. 2006, 39, 33–51. [Google Scholar] [CrossRef]
Heath, D.D.; Rawson, P.D.; Hilbish, T.J. PCR-based nuclear markers identify alien blue mussel (Mytilus spp.) genotypes on the west coast of Canada. Canad. J. Fisheries Aquat. Sci. 1995, 52, 2621–2627. [Google Scholar] [CrossRef]
Katoh, K.; Standley, D.M. MAFFT multiple sequence alignment software version 7, improvements in performance and usability. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef]
Castresana, J. Gblocks Server 2002. Available online: http://molevol.cmima.csic.es/castresana/Gblocks_server.html (accessed on 7 January 2021).
Tanabe, A.S. Kakusan4 and Aminosan: Two programs for comparing nonpartitioned, proportional and separate models for combined molecular phylogenetic analyses of multilocus sequence data. Mol. Ecol. Resour. 2011, 11, 914–921. [Google Scholar] [CrossRef]
Stamatakis, A. RAxML-VI-HPC: Maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics 2006, 22, 2688–2690. [Google Scholar] [CrossRef]
Ronquist, F.; Huelsenbeck, J.P. MrBayes 3, Bayesian phylogenetic inference under mixed models. Bioinformatics 2003, 19, 1572–1574. [Google Scholar] [CrossRef]
Stephenson, T.A. Coelenterata. Part I.—Actiniaria. Nat. Hist. Rep. Br. Antarct. Exped. 1910 1918, 5, 1–68. [Google Scholar]
Izumi, T.; Fujii, T.; Yanagi, K. Introduction to the latest classification system of Actiniaria and proposals for Japanese names of higher taxa. TAXA 2019, 46, 54–63. [Google Scholar]
Verrill, A.E. Notice of recent additions to the marine fauna of the eastern coast of North America, No. 5. Am. J. Sci. 1879, 17, 472–474. [Google Scholar] [CrossRef]
Uchida, H. Actiniaria. In Guide to Seashore Animals of Japan with Color Pictures and Keys; Nishimura, S.H.-S., Ed.; Hoikusha: Osaka, Japan, 1992; Volume I, pp. 126–146. [Google Scholar]
Carlgren, O. On the genus Porponia and related genera, Scottish National Antarctic Expedition. Transact. R. Soc. Edinb. 1914, 50, 49–71. [Google Scholar] [CrossRef]
Hertwig, R. Die Actinien der Challenger Expedition; Gustav Fischer: Jena, Germany, 1882; 119p. [Google Scholar]
Sanamyan, K.; Sanamyan, N. Comments on the nomenclatural status and validity of several family-series nomina in Actiniaria (Cnidaria, Anthozoa). Bionomina 2020, 19, 100–109. [Google Scholar] [CrossRef]
McMurrich, J.P. Report on the Actiniæ Collected by the United States Fish Commission Steamer Albatross during the Winter of 1887–1888. In Proceedings of the United States National Museum; Government Printing Office: Washington, DC, USA, 1893; Volume 16, pp. 119–216. [Google Scholar]
Rodríguez, E.; Mendoza, M.; Häussermann, V. New records and rescription of Halcurias pilatus and Halcurias mcmurrichi (Actiniaria, Endocoelantheae). J. Mar. Biol. Assoc. UK 2013, 93, 2089–2100. [Google Scholar] [CrossRef]
Rodríguez, E.; Lauretta, D. Halcurias uchidai sp. nov. (Cnidaria: Actiniaria): Putting a name with a face of a deep-sea anemone and amending a nomenclature lapsus. Zootaxa 2023, 5258, 146–150. [Google Scholar] [CrossRef]
Carlgren, O. Actiniaria der Deutschen Tiefsee-Expedition. Wissensch. Ergeb. Deutsch. Tiefsee-Exped. Damp. “Valdivia” 1898–1899 1928, 22, 125–266. [Google Scholar]
Riemann-Zürneck, K. Halcurias sudanensis n. sp. aus dem Tiefwasser-Benthos des Roten Meeres (Actiniaria: Halcuriidae). Senckenberg. Biol. 1983, 63, 427–434. [Google Scholar]
WoRMS. Available online: https://www.marinespecies.org/ (accessed on 7 January 2023).
McMurrich, J.P. Contributions on the morphology of the Actinozoa VI. Halcurias pilatus and Endocoelactis. Biol. Bull. 1901, 2, 155–163. [Google Scholar] [CrossRef]
Daly, M.; Gusmão, L.C.; Reft, A.J.; Rodríguez, E. Phylogenetic signal in mitochondrial and nuclear markers in sea anemones (Cnidaria, Actiniaria). Integr. Comp. Biol. 2010, 50, 371–388. [Google Scholar] [CrossRef]
Titus, B.M.; Benedict, C.; Laroche, R.; Gusmão, L.C.; Van Deusen, V.; Chiodo, T.; Meyer, C.P.; Berumen, M.L.; Bartholomew, A.; Yanagi, K.; et al. Phylogenetic relationships among the clownfish-hosting sea anemones. Mol. Phylogenetics Evol. 2019, 139, 106526. [Google Scholar] [CrossRef]
Uchida, H.; Soyama, I. Sea Anemones in Japanese Waters; TBS-Britannica: Tokyo, Japan, 2001; 157p. [Google Scholar]
Yamana, Y. Habitation density survey of Halcurias sp. (ookawari-ginchaku) prefecture-designated natural monument. Wakayama Pref. Mus. Nat. Hist. 2016, 34, 53–72. [Google Scholar]

Figure 1. Schematic diagram of the development of mesenterial arrangement. All diagrams show the mesenterial arrangements in transversal sections. Arrows show the order of development. (A) Stage with eight macrocnemes in the first mesenterial cycle. Species of Edwardsiidae have this arrangement even in adults; (B) stage with twelve macrocnemes in six pairs. All macrocnemes of this stage are in the first mesenterial cycle; (C,D) arrangements at more developed stages. (C) Arrangement of Actinernoidea. (D) Arrangement of general Enthemonae. Abbreviations: d, dorsal directive (indicated in red); Edc, endocoel (in gray); Exc, exocoel (in white); ld, dorso-lateral mesentery (in orange); lv, ventro-lateral mesentery (in green); RM, retractor muscle; v, ventral directive (in blue); 2, mesenteries in the second cycle; 3, mesenteries in the third cycle. Revised from Yanagi (2017) [2].

Figure 3. Maximum likelihood tree of the superfamily Actinernoidea based on the combined dataset of mitochondrial 12S and 16S; nuclear 18S, 28S, and 5.8S rDNA; and ITS1/ITS2 (total 4614 bp). The lineages of the species that had been classified in the family Actinernidae are colored in pink, and the lineages of species of the family Halcuriidae are in orange. The bar in pink indicates the genus Synactinernus (Actinernidae), and two orange bars indicate the genus Halcurias (Halcuriidae). The numbers above or below branches indicate ML bootstrap support values, followed by BI posterior probabilities of the nodes (bootstrap values of ≥50% and posterior probabilities of ≥0.9 are shown). Note that the names of OTUs are based on the previous classification of Actinernoidea; compare with Figure 4 for the new species names.

Figure 4. Maximum likelihood tree of the superfamily Actinernoidea based on the combined dataset of mitochondrial 12S and 16S; nuclear 18S, 28S, and 5.8S rDNA; and ITS1/ITS2 (total 4614 bp) following the new actinernoidean classification system. All clades of a genus rearranged in the present study are indicated in boxes in different colors, and those of families are indicated by bars. The numbers above or below branches indicate ML bootstrap support values, followed by BI posterior probabilities of the nodes (bootstrap values of ≥50% and posterior probabilities of ≥0.9 are shown). Node in A indicates the base of the clade of families Actinernidae and Isactinernidae; node B indicates that of the clade of family Isactinernidae; node C indicates that of the clade of family Halcuriidae; and node D indicates that of genera Halcurias and Synactinernus in Halcuriidae.

Table 1. Nominal genera and species of Actinernidae in the world and distribution records in Japan. Species with * indicates that the name is a nomen nudum.

Family	Species	Distribution
Actinernidae
	Actinernus antarcticus (Carlgren, 1914)	Antarctica
	Actinernus elongatus (Hertwig, 1882)	Antarctica, Chile, New Zealand, Argentina
	Actinernus mercedae Gusmão, (López-González & Rodríguez, 2021)	South Atlantic
	Actinernus michaelsarsi Carlgren, 1918	North Atlantic (Spainish Waters)
	Actinernus nobilis Verrill, 1879	Northwest Atlantic
	Actinernus robustus (Hertwig, 1882)	Nortwest Pacific (Japanese Waters)
	Isactinernus quadrilobatus Carlgren, 1918	West Pacific (including Japanese Waters)
	Synactinernus churaumi Izumi & Fujii in [14]	Nortwest Pacific (Japanese Waters)
	Synactinernus flavus Carlgren, 1918	Nortwest Pacific (Japanese Waters)
	Synhalcurias elegans (Wassilieff, 1908)	Nortwest Pacific (Japanese Waters)
	Synhalcurias kahakui Izumi & Yanagi, 2021	Nortwest Pacific (Japanese Waters)
Halcuriidae
	Halcurias carlgreni McMurrich, 1901	Nortwest Pacific (Japanese Waters)
	Halcurias capensis Carlgren, 1928	South Africa
	Halcurias endocoelactis Stephenson, 1918	West Pacific (New Zealand)
	Halcurias japonicus Uchida, 2004 *	Nortwest Pacific (Japanese Waters)
	Halcurias levis Uchida, 2004 *	Nortwest Pacific (Japanese Waters)
	Halcurias minimus Carlgren, 1928	South Indian Ocean (Kercuelen Islands)
	Halcurias pilatus McMurrich, 1893	Northwest Atlantic
	Halcurias sudanensis Riemann-Zürneck, 1983	The Red Sea
	Halcurias uchidai Rodríguez & Lauretta, 2023	Northwest Atlantic
	Carlgrenia desiderata Stephenson, 1918	Northeast Atlantic

Table 2. Primers and protocols of polymerase chain reactions of every molecular marker.

Marker		Primer	Sequences (5′-3′)	PCR protocol	Reference
12S		12S1a	TAAGTGCCAGCAGACGCGGT	(95 °C for 4 min) + 4 × [(94 °C for 30 s) → (50 °C for 1 min) → (72 °C for 2 min)] +30 × [(94 °C for 30 s) → (55 °C for 1 min) → (72 °C for 2 min)] + (72 °C for 4 min)	[26]
12S		12S3r	ACGGGCAATTTGTACTAACA		[26]
16S		ANEM16SA	CACTGACCGTGATAATGTAGCGT	(95 °C for 4 min) + 30 × [(95 °C for 30 s) → (46 °C for 45 s) → (72 °C for 1 min)] + (72 °C for 5 min)	[23]
		ANEM16SB	CCCCATGGTAGCTTTTATTCG		[23]
		16Sant1a	GCCATGAGTATAGACGCACA	(95 °C for 4 min) + 30 × [(95 °C for 30 s) → (46 °C for 45 s) → (72 °C for 1 min)] + (72 °C for 5 min)	[26]
		16SbmoH	CGAACAGCCAACCCTTGG		[26]
18S	PCR	18SA	AACCTGGTTGATCCTGCCAGT	(94 °C for 4 min) + 35 × [(94 °C for 20 s) → (57 °C for 20 s) → (72 °C for 1 min 45 s)] + (72 °C for 7 min)	[22,25]
	PCR	18SB	TGATCCTTCCGCAGGTTCACCT
	Only Sequence	18SL	CCAACTACGAGCTTTTTAACTG
		18SC	CGGTAATTCCAGCTCCAATAG
		18SY	CAGACAAATCGCTCCACCAAC
		18SO	AAGGGCACCACCAGGAGTGGAG
28S	PCR1	F63sq	AATAAGCGGAGGAAAAGAAAC	(94 °C for 5 min) + 30 × [(94 °C for 30 s) → (45 °C for 1 min) → (72 °C for 3 min)] + (72 °C for 10 min)	[24]
	PCR1	R2077sq	GAGCCAATCCTTWTCCCGARGTT		[24]
	PCR2	LSU5	TAGGTCGACCCGCTGAAYTTAAGCA	(94 °C for 5 min) + 30 × [(94 °C for 30 s) → (45 °C for 1 min) → (72 °C for 3 min)] + (72 °C for 10 min)	[27,28,29]
	PCR2	LSU1600R	AGCGCCATCCATTTTCAGG
	Only Sequence	LSU330F	CAAGTACCGTGAGGGAAAGTTG
		LSU900F	CCGTCTTGAAACACGGACCAAG
		ECD2S	CTTGGTCCGTGTTTCAAGACGG
ITS1/2		ITSF	GTTTCCGTAGGTGAACCTG	(94 °C for 5 min) + 30 × [(94 °C for 35 s) → (55 °C for 45 s) → (72 °C for 2 min)] + (72 °C for 1 min)	[30]
ITS1/2		ITSR	CTCGTCTGATCTGAGGTCG		[30]

Table 3. Base sequences in the phylogenetic analyses. Sequences indicated in bold were deposited to GenBank in the present study. The names of OTUs are based on the previous classification of Actinernoidea. Edwardsia timida was chosen as the outgroup of phylogenetic analysis of Acrtinernoidea. OTUs indicated in gray are obtained from GenBank. Note that the names of OTUs are based on the previous classification of Actinernoidea: Halcurias japonicus is described in this article as Halcurias hiroomii sp. nov., Halcurias levis as Isohalcurias citreum sp. nov., Halcurias sp. 1 as Halcurias fragum sp. nov., Halcurias sp. 2 as Isohalcurias malum sp. nov., and Halcurias carlgreni is renamed to Isohalcurias carlgreni comb. nov.

Higher Taxon	Family	Genus	Species	Localities	Voucher Numbers	12S	16S	18S	28S	5.8S/ITS1/ITS2
Actiniaria
Anenthemonae
Actinernoidea	Actinernidae	Actinernus	robustus	Ryukyu-Trough	-	LC768522	-	LC484632	LC768597	-
		Isactinernus	quadrilobatus	Kumano-nada	NSMT-Co 1662	-	LC484643	LC484638	LC768598	LC768624
		Synhalcurias	elegans	Kumano-nada	NSMT-Co 1693	-	-	LC768573	LC768599	LC768625
		Synhalcurias	elegans	Okinawa	-	LC768523	LC768547	LC768574	LC768600	LC768626
		Synhalcurias	kahakui	Ogasawara	NSMT-Co 1695	LC768524	LC768548	-	LC768601	LC768627
		Synactinernus	flavus	Goto-nada	NSMT-Co 1660	LC768525	LC484639	LC484633	LC768602	LC768628
		Synactinernus	flavus	Goto-nada	-	LC768526	LC484640	LC484634	LC768603	LC768629
		Synactinernus	flavus	Goto-nada	-	LC768527	LC768549	LC768575	LC768604	-
		Synactinernus	flavus	Goto-nada	-	LC768528	LC768550	LC768576	-	-
		Synactinernus	flavus	Goto-nada	-	LC768529	LC768551	LC768577	-	-
		Synactinernus	flavus	Goto-nada	-	LC768530	LC768552	LC768578	-	-
		Synactinernus	flavus	Wakayama	CMNH-ZG 09732	LC768531	LC768553	LC484635	LC768605	-
		Synactinernus	churaumi	Off Ishigaki Island	NSMT-Co 1661	LC768532	LC484641	LC484636	LC768606	LC768630
		Synactinernus	churaumi	Off Ishigaki Island	-	LC768533	LC484642	LC484637	LC768607	LC768631
		Synactinernus	churaumi	Off Ishigaki Island	-	-	LC768554	LC768579	-	-
		Synactinernus	churaumi	Off Ishigaki Island	-	LC768534	LC768555	LC768580	-	-
	Actinernidae	Actinernus	antarcticus	-		KJ482930	KJ482966	KJ483023	KJ483126	-
		Isactinernus	quadrolobatus	-		KJ482932	KJ482968	KJ483024	KJ483105	-
		Synhalcurias	elegans	-		KJ482942	-	KJ483021	KJ483120	-
	Halcuriidae	Halcurias	japonicus	Toyama-Bay	CMNH-ZG 10212	-	LC768556	LC768581	LC768608	LC768632
		Halcurias	japonicus	Toyama-Bay	NSMT–Co 1824	-	LC768557	LC768582	LC768609	LC768633
		Halcurias	japonicus	Toyama-Bay	CMNH-ZG 10213	-	LC768558	LC768583	LC768610	LC768634
		Halcurias	japonicus	Ise-Bay	CMNH-ZG 10214	-	LC768559	LC768584	LC768611	LC768635
		Halcurias	japonicus	Wakayama	CMNH-ZG 10215	LC768535	LC768560	LC768585	LC768612	LC768636
		Halcurias	sp. 1	Sado Island	-	LC768536	LC768561	LC768586	LC768613	LC768637
		Halcurias	sp. 1	Sado Island	CMNH-ZG 10216	LC768537	LC768562	LC768587	LC768614	-
		Halcurias	sp. 1	Wakayama	CMNH-ZG 10217	LC768538	LC768563	LC768588	LC768615	LC768638
		Halcurias	carlgreni	Suo-Oshima	NSMT-Co 1697	LC768539	LC768564	LC768589	LC768616	LC768639
		Halcurias	carlgreni	Suo-Oshima	NSMT-Co 1698	LC768540	LC768565	LC768590	LC768617	LC768640
		Halcurias	carlgreni	Kumano-nada	CMNH-ZG 10218	LC768541	LC768566	LC768591	LC768618	-
		Halcurias	carlgreni	Ukishima Island	CMNH-ZG 10219	-	LC768567	LC768592	LC768619	LC768641
		Halcurias	carlgreni	Ukishima Island	CMNH-ZG 10220	-	LC768568	-	-	-
		Halcurias	levis	Kuju-kushima	CMNH-ZG 10221	LC768542	LC768569	LC768593	LC768620	LC768642
		Halcurias	levis	Wakayama	-	LC768543	LC768570	LC768594	-	LC768643
		Halcurias	levis	Off Yaku Island	CMNH-ZG 10222	LC768544	-	LC768595	LC768621	LC768644
		Halcurias	sp. 2	Off Cape-Sata	NSMT-Co 1699	LC768545	LC768571	-	LC768622	LC768645
		Halcurias	sp. 2	Wakayama	CMNH-ZG 10225	LC768546	LC768572	LC768596	LC768623	LC768646
	Halcuriidae	Halcurias	pilatus	-		KJ482931	KJ482967	KJ483020	KJ483109	-
Edwardsioidea	Edwardsiidae	Edwardsia	timida	-		GU473281	-	GU473315	KJ483088	KT852241

Table 4. The substitution models of phylogenetic analyses on each marker.

	Mitochondrial		Nuclear
	12S rDNA	16S rDNA	18S rDNA	28S rDNA	5.8S rDNA/ITS1/ITS2
ML analysis	GTR + Gamma	GTR + Gamma	GTR + Gamma	GTR + Gamma	GTR + Gamma
Bayesian inference	HKY85 + Gamma	K80 + Gamma	K80 + Gamma	GTR + Gamma	K80 + Gamma

Table 7. Comparison of Isohalcurias gen. nov. and the other genera of Halcuriidae.

	Isohalcurias gen. nov.	Halcurias McMurrich, 1893	Synactinernus Carlgren, 1918	Carlgrenia Stephenson, 1918
Type species	Isohalcurias carlgreni (McMurrich, 1901) comb. nov.	Halcurias pilatus McMurrich, 1893	Synactinernus flavus Carlgren, 1918	Synhalcurias elegans (Wassilieff, 1908)
Characters
Edge of oral disc	Simple, not forming any lobes	Simple, not forming any lobes	Forming eight lobes	Simple, not forming any lobes
Number of macrocnemes	20 (10 pairs)	20 (10 pairs)	36 (18 pairs)	12 (6 pairs)
Shape of retractor muscle	Pinnate	Simple	Simple	Strongly restricted
Spirocysts of column	Present	Absent	Present	Unknown
References	The present study	[4,11,43]	[7,10,12]	[12,36]

Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).

Share and Cite

MDPI and ACS Style

Izumi, T.; Fujii, T.; Yanagi, K.; Fujita, T. Fluorescent Anemones in Japan—Comprehensive Revision of Japanese Actinernoidea (Cnidaria: Anthozoa: Actiniaria: Anenthemonae) with Rearrangements of the Classification. Diversity 2023, 15, 773. https://doi.org/10.3390/d15060773

AMA Style

Izumi T, Fujii T, Yanagi K, Fujita T. Fluorescent Anemones in Japan—Comprehensive Revision of Japanese Actinernoidea (Cnidaria: Anthozoa: Actiniaria: Anenthemonae) with Rearrangements of the Classification. Diversity. 2023; 15(6):773. https://doi.org/10.3390/d15060773

Chicago/Turabian Style

Izumi, Takato, Takuma Fujii, Kensuke Yanagi, and Toshihiko Fujita. 2023. "Fluorescent Anemones in Japan—Comprehensive Revision of Japanese Actinernoidea (Cnidaria: Anthozoa: Actiniaria: Anenthemonae) with Rearrangements of the Classification" Diversity 15, no. 6: 773. https://doi.org/10.3390/d15060773

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Menu

Fluorescent Anemones in Japan—Comprehensive Revision of Japanese Actinernoidea (Cnidaria: Anthozoa: Actiniaria: Anenthemonae) with Rearrangements of the Classification^†

Abstract

1. Introduction

2. Materials and Methods

2.1. Sample Collection and Preservation

2.2. Morphological Observation and Preparation of Histological Sections

2.3. Observation of Cnidae

2.4. PCR and DNA Sequences

2.5. Phylogenetic Analyses

3. Results and Discussions

3.1. Phylogeny

3.2. Descriptions

4. Conclusions

Supplementary Materials

Author Contributions

Funding

Institutional Review Board Statement

Data Availability Statement

Acknowledgments

Conflicts of Interest

References

Share and Cite

Article Metrics

Article Access Statistics

Further Information

Guidelines

MDPI Initiatives

Follow MDPI

Article Menu

Fluorescent Anemones in Japan—Comprehensive Revision of Japanese Actinernoidea (Cnidaria: Anthozoa: Actiniaria: Anenthemonae) with Rearrangements of the Classification †

Abstract

1. Introduction

2. Materials and Methods

2.1. Sample Collection and Preservation

2.2. Morphological Observation and Preparation of Histological Sections

2.3. Observation of Cnidae

2.4. PCR and DNA Sequences

2.5. Phylogenetic Analyses

3. Results and Discussions

3.1. Phylogeny

3.2. Descriptions

4. Conclusions

Supplementary Materials

Author Contributions

Funding

Institutional Review Board Statement

Data Availability Statement

Acknowledgments

Conflicts of Interest

References

Share and Cite

Article Metrics

Article Access Statistics

Further Information

Guidelines

MDPI Initiatives

Follow MDPI

Fluorescent Anemones in Japan—Comprehensive Revision of Japanese Actinernoidea (Cnidaria: Anthozoa: Actiniaria: Anenthemonae) with Rearrangements of the Classification^†