Next Article in Journal
Wild Carnivore Survey of Echinococcus Species in Slovenia
Previous Article in Journal
The Trophic Niche of Two Sympatric Species of Salamanders (Plethodontidae and Salamandridae) from Italy
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Animals
Volume 12
Issue 17
10.3390/ani12172222
animals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Dose–Response Effects of Bamboo Leaves on Rumen Methane Production, Fermentation Characteristics, and Microbial Abundance In Vitro

by
Seong Uk Jo
1,2,†,
Shin Ja Lee
2,3,†,
Hyun Sang Kim
2,
Jun Sik Eom
2,
Youyoung Choi
1,2,
Yookyung Lee
4 and
Sung Sill Lee
1,2,3,*
1
Division of Applied Life Science (BK21), Gyeongsang National University, Jinju 52828, Korea
2
Institute of Agriculture & Life Science (IALS), Gyeongsang National University, Jinju 52828, Korea
3
Institute of Agriculture and Life Science & University-Centered Labs, Gyeongsang National University, Jinju 52828, Korea
4
Animal Nutrition and Physiology Team, National Institute of Animal Science, RDA, Jeonju 55365, Korea
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Animals 2022, 12(17), 2222; https://doi.org/10.3390/ani12172222
Submission received: 22 July 2022 / Revised: 19 August 2022 / Accepted: 23 August 2022 / Published: 29 August 2022
(This article belongs to the Section Animal Nutrition)
Browse Figures
Review Reports Versions Notes

Abstract

:

Simple Summary

Due to economic, environmental, and nutritional considerations, mitigating enteric methane production from ruminants is an important issue. Nutritionists have recently shown that feeding livestock natural feed additives could ameliorate this problem, due to the antimicrobial activities of the biologically active components in the additives. Bamboo is widely distributed in Asia and is currently being used in construction and paper pulp production, which results in a significant amount of bamboo leaves as by-products. The present study investigated whether bamboo leaves feeding can decrease methane production in ruminants. Here we found that bamboo leaves supplementation in vitro caused a 12.7–34.2% reduction in methane production after 12 and 48 h. Further studies are needed to demonstrate the effect of bamboo leaves supplementation in vivo, to determine its potential for mitigating methane production from ruminants.

Abstract

Ruminants produce large amounts of methane as part of their normal digestive processes. Recently, feed additives were shown to inhibit the microorganisms that produce methane in the rumen, consequently reducing methane emissions. The objective of this study was to evaluate the dose–response effect of Phyllostachys nigra var. henonis (PHN) and Sasa borealis supplementation on in vitro rumen fermentation, methane, and carbon dioxide production, and the microbial population. An in vitro batch culture system was used, incubated without bamboo leaves (control) or with bamboo leaves (0.3, 0.6, and 0.9 g/L). After 48 h, total gas, methane, and carbon dioxide production decreased linearly with an increasing dose of bamboo leaves supplementation. The total volatile fatty acid, acetate, and acetate-to-propionate ratio were affected quadratically with increasing doses of bamboo leaves supplementation. In addition, propionate decreased linearly. Butyrate was increased linearly with increasing doses of PHN supplementation. The absolute values of total bacteria and methanogenic archaea decreased linearly and quadratically with an increasing dose of PHN treatment after 48 h. These results show that bamboo leaves supplementation can reduce methane production by directly affecting methanogenic archaea, depressing the metabolism of methanogenic microbes, or transforming the composition of the methanogenic community. These results need to be validated using in vivo feeding trials before implementation.

1. Introduction

Greenhouse gas emissions from the livestock industry are estimated to constitute 14.5–19% of global emissions [1]. Livestock enteric methane and carbon dioxide emissions contribute approximately 80% of the sector’s total emissions [2,3]. In addition, enteric methane emissions lose 6–12% of gross energy or 8–14% of digestible energy in ruminants’ energy intake [4,5]. Thus, reducing enteric methane emissions from livestock is an important aim for livestock nutritionists who consider the economy. Bambusoideae comprise 75 genera and 1642 bamboo species. It is one of the fastest-growing plants, with a growth rate of 7.5–100 cm/day and a short life cycle [6,7]. Bamboo is distributed across approximately 31.5 million hectares of land and is common in China, Korea, Japan, and Southeast Asia [8,9]. Bamboo is used for construction and paper pulp production, which results in significant amounts of bamboo leaves as a by-product. Therefore, the agro-industrial residues are useful as animal feed or additives to promote environmental sustainability of production systems [10,11]. The leaves of many bamboo species are used as feed for livestock in Japan, Pakistan, Nepal, and Africa. Previous studies have isolated biologically active compounds (flavonoids and polyphenols) from bamboo leaves, which have suitable properties for use in new applications [12,13]. These compounds have been found to possess useful characteristics, including antibacterial, antioxidant, and anti-inflammatory activities [14,15,16]. Phyllostachys nigra var. henonis (PHN) and Sasa borealis (SAB) have been shown to contain the biologically active compounds orientin, vitexin, luteolin, vittariflavone, and tricin [13] and isoorientin, tricin, and apigenin [12], respectively. Recently, many studies have shown that the biologically active compounds of by-products have the potential to mitigate methane production by modulating the ruminal microbial population [17,18]. In addition, recent studies have evaluated bamboo leaves as a feed additive for broiler chickens [19], a substitute for hay for sheep [20], a methane-reducing agent for goats [21], and a heat stress alleviator for Holstein dairy cows [22]. However, limited experimental data exist on the effects of bamboo leaves supplementation on livestock fermentation, methane production, and microbial population.
We hypothesized that bamboo leaves have biologically active compounds that would alter the microbial population of livestock to reduce enteric methane production without negatively affecting its fermentation. Therefore, we investigated the chemical composition of PHN and SAB and investigated their effects on in vitro methane production, rumen fermentation characteristics (e.g., pH, dry matter (DM) digestibility, and volatile fatty acid (VFA) production), and rumen microbial populations.

2. Materials and Methods

All experimental management and protocols related to animals used in this study were reviewed and approved by Gyeongsang National University Animal Research Ethical Committee (GNU-191011-E0050).

2.1. Collection of Bamboo Leaves Samples

Immature and mature leaves samples from eight trees of two bamboo (PHN and SAB) were harvested and pooled for leaves of each individual species over two consecutive months (May and June). After sampling, samples classified by species of origin were freeze-dried (Model PVTFD 10R, Ilshinbiobase CO., Ltd., Dongducheon, Korea) and stored in air-tight bags at −80 °C in a freezer until use for experiments.

2.2. Chemical Composition, Total Polyphenol, Flavonoid and Antioxidant Activity

The chemical composition of substrates used in in vitro experiments is shown in Table 1. Substrates and bamboo leaves were ground using a 1 mm screen with a Wiley mill for chemical, polyphenol, and flavonoid analysis and for in vitro experiments. The chemical composition of the substrate and bamboo leaves was analyzed by the AOAC [23], Van Soest [24], and Licitra [25] methods. Total polyphenol and flavonoid of bamboo leaves were analyzed by the Folin–Ciocalteu method [26] and the aluminum chloride method [27]. During the analysis, 2,2-diphenyl-1-picrylhydrazyl (DPPH) and 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid (ABTS) radical scavenging activity were used by modifying the method of Brand-Williams et al. [28] and Re et al. [29], respectively. The results were calculated as IC50, which is the minimum concentration required to scavenge 50% of the DPPH and ABTS radicals. The detailed procedures of such total polyphenol and flavonoid and radical scavenging activity analyses were the same as those of Lee et al. [18] and Seleshe et al. [30]. Substrates and bamboo leaves were analyzed in 3 replicates for chemical composition, total polyphenol, flavonoid, and antioxidant activity.

2.3. Animals and In Vitro Experiments

The whole rumen inoculum was obtained from two fistulated non-lactating Hanwoo (440 ± 20 kg)-fed Timothy hay (Table 1) and corn-based concentrate (moisture content, 13.01%; crude protein, 9.32%; ether extracts, 2.80%; crude ash, 1.35%; neutral detergent fiber (NDF), 35.14%, and acid detergent fiber (ADF), 5.04%) mixtures at a 6:4 ratio (DM basis), with free access to mineral block and water. The rumen inoculum was collected before morning feeding, transferred to the laboratory within 15 min, filtered with 4 layers of cheesecloth, and then mixed with McDougall’s buffer at a 1:2 ratio (vol/vol) to make a fluid mixture under constant O2-free N2 flushing at 39 °C. The bamboo leaves were used at four inclusion rates: 0 g/L (CON), 0.3 g/L (PHNL and SABL), 0.6 g/L (PHNM and SABM), and 0.9 g/L (PHNH and SABH). The fluid mixture (20 mL) was transferred to serum bottles (50 mL) under a stream of O2-free N2; substrates (0.3 g of Timothy) and bamboo leaves supplementation were placed into a nylon bag, which was sealed with butyl rubber and then crimped aluminum caps. Timothy was used as a control because it has a similar chemical composition to bamboo leaves and is a commonly used feed for ruminants. The amount of Timothy was chosen based on a previous study [18]. The serum bottles were incubated in a shaking incubator (120 rpm) at 39 °C for 6, 12, 24, 48, and 72 h. The in vitro batch culture experiments were replicated in four separate communities. Each in vitro batch culture experiment was a completely randomized block design and performed in two runs.
The actual trial design was:
5 incubation times × 7 treatments × 4 repetitions × 2 runs

2.4. In Vitro Fermentation and Gas Profiles

After incubation, the headspace measurement pressure of the serum bottle was measured using a pressure transducer (Laurel Electronics, inc., Costa Mesa, CA, USA), and the total gas production was converted according to Theodorou et al. [31].
The equation used was:
V = P/24.103 (n = 144, R2 = 0.999)
where V is the gas volume (mL), and P is the measured pressure (psi).
The headspace gas samples were collected in a vacuum tube, and then they were determined by gas chromatography (Agilent Technologies HP 5890, Waldbronn, Germany) equipped with a thermal conductivity detector on Carboxen 1006 PLOT capillary column (30 × 0.53 mm; Supelco, Bellefonte, PA, USA). The concentration of methane and carbon dioxide production was converted according to López et al. [32].
The equation used was:
Methane and carbon dioxide production (mL)
= Concentration (mL/mL) × {Total gas (mL) + Headspace (30 mL)}
Ruminal pH of the fluid sample was determined by a pH meter (S210 SevenCompact, Mettler-Toledo, Greifensee, Switzerland) and collected and stored at −80 °C in a freezer for VFA and microbial population analysis. The VFA concentration was determined by high-performance liquid chromatography (HPLC; L-2200, Hitachi, Tokyo, Japan) following the method described by Adesogan et al. [33]. The apparent DM digestibility was determined following the nylon bag digestion method. Briefly, the residues were washed in a water bath and dried in a dry oven at 105 °C for 24 h.

2.5. The DNA Extraction and Real-Time Polymerase Chain Reaction

The genomic DNA of the 48 h rumen fluid sample (1.8 mL) was physically disrupted by the bead-beating method and extracted using a commercial DNA extraction kit (QIAamp Fast DNA stool Mini Kit, Qiagen, Valencia, CA, USA) according to the manufacturer’s recommendations. The genomic DNA yield, purity, and quality were determined by NanoDrop (Thermo Scientific, Wilmington, DE, USA).
Real-time polymerase chain reaction (RT-PCR) assays to determine the absolute abundance of total bacteria, methanogenic archaea, ciliate protozoa, fungi, hydrogen, and formate producing (Ruminococcus albus (R. albus), Ruminococcus flavefaciens (R. flavefaciens)), butyrate-producing (Butyrivibrio fibrisolvens (B. fibrisolvens), Butyrivibrio proteoclasticus (B. proteoclasticus)), succinate and propionate producing (Fibrobacter succinogenes (F. succinogenes), Prevotella ruminicola (P. ruminicola)) were performed using an RT-PCR Machine (CFX96 Real-Time system, Bio-Rad, Hercules, CA, USA). Information on sequence, size, efficiency, and PCR conditions references of target rumen microbes are shown in Table 2. Real-time PCR assays were measured in triplicate, a total reaction mixture of 20 μL. The total reaction mixture included 2 μL 10 × buffer (BioFACT, Daejeon, Korea), 0.5 μL 10 mM dNTP Mix (BioFACT, Daejeon, Korea), 1 μL forward primer (10 μM), 1 μL reverse primer (10 μM), 1 μL genomic DNA diluted 10-fold, 1 μL Evagreen (SolGent, Daejeon, Korea), 0.1 μL taq polymerase (BioFACT, Daejeon, Korea), and 13.4 μL PCR-grade water. For absolute quantification of each microbe, a standard curve obtains with a 10-fold dilution of plasmids containing the respective target gene sequence. For absolute quantification of each microorganism, a standard curve obtained by a plasmid containing each target gene sequence with 10-fold serial dilutions was used, and all the detailed manufacturing processes of each microbe plasmid were performed according to Kim et al. [34] and Hamid et al. [35]. All the reactions were performed in triplicate.

2.6. Statistical Analysis

Data were analyzed using the Interactive Matrix Language (IML) procedure and a completely randomized block design. Statistical analyses were conducted using SAS software (version 9.4, SAS Institute, Cary, NC, USA).
The statistical model used was:
Yijkl = μ + αi + βj + γk + εijkl,
where Yijkl represents the experimental data, µ the overall mean, αi the random effect of the fermentation run (I = 2), βj the fixed effect of dietary treatments, γk the fixed effect of incubation times, and εijkl the unexplained random error. Polynomial contrasts were used to test the linear and quadratic effects of the treatments (i.e., bamboo leaves inclusion rate). Differences between means were identified using Tukey’s multiple comparison test, and significance was defined as p < 0.05.

3. Results

3.1. Chemical Composition and Antioxidant Activity

The chemical composition and antioxidant activities of the bamboo leaves of two cultivars (PHN and SAB) are shown in Table 3. The chemical compositions of the two cultivars are different: SAB had a higher percentage of crude protein, crude fiber, NDF, and NDICP, and a lower percentage of ether extract, crude ash, ADF, and ADFIP than PHN. In addition, SAB had higher total polyphenol and flavonoid content than PHN. The PHN and SAB cultivars contained 31.04 and 44.54 mg CE/g extract of polyphenols and 16.73 and 19.6 mg QE/g extract of flavonoids, respectively. Moreover, PHN leaves possessed ABTS, DPPH free radical scavenging properties, and higher antioxidant activities compared to SAB leave.

3.2. Effects of Bamboo Leaves on pH of Rumen Fluid and Dry Matter Digestibility

The pH of rumen fluid and DM digestibility results are shown in Table 4. The pH of rumen fluid ranged from 6.19 to 7.20 and increased linearly (p < 0.05) with increasing doses of bamboo leaves supplementation at 12 and 24 h. The highest pH was observed for SABH treatment at 12 h and PHNL treatment at 48 h (p < 0.05). Dry matter digestibility was affected quadratically (p < 0.05) with increasing doses of SAB supplementation at 12 and 24 h. Moreover, DM digestibility was significantly decreased following PHNL treatment (p < 0.05) compared to the CON group at 24 h.

3.3. Effects of Bamboo Leaves on Gas Profiles

In Table 5, total gas production decreased linearly (p < 0.01) with increasing doses of bamboo leaves supplementation, and the CON group was the highest (p < 0.05). The greatest decrease (p < 0.05) was observed in the PHN supplementation. After 12 and 48 h, methane and carbon dioxide production and proportions were decreased linearly (p < 0.05) with increasing doses of bamboo leaves supplementation.

3.4. Effects of Bamboo Leaves on Volatile Fatty Acids Profiles

The VFA profile results are shown in Table 6. After 24 h, the total VFA, acetate, and acetate-to-propionate ratio were affected linearly and quadratically (p < 0.05) with increasing doses of bamboo leaves supplementation. Moreover, propionate was decreased linearly (p < 0.05) with increasing doses of bamboo leaves supplementation. After 24 and 48 h, propionate and the acetate-to-propionate ratio were affected linearly (p < 0.05) with increasing doses of bamboo leaves supplementation, whereas butyrate was increased linearly (p < 0.05) with increasing doses of PHN supplementation.

3.5. Effects of Bamboo Leaves on the Abundance of Microbial Community

Regarding microbial counts, the abundance of total bacteria and methanogenic archaea were significantly lower (p < 0.05) following PHNM and PHNH treatments compared to the CON group, and were decreased linearly (p < 0.05) and quadratically (p < 0.05) with increasing doses of PHN supplementation at 48 h (Figure 1). Compared to the CON group, the abundance of ciliate protozoa was significantly higher (p < 0.05) in SABL treatment and was increased linearly (p < 0.05) and quadratically (p < 0.05) with increasing doses of SAB supplementation. No significant changes in ciliate protozoa abundance were observed in PHN supplementation (p < 0.05) change. None of the bamboo leaves supplementations significantly affected (p < 0.05) the abundance of fungi. The abundance of R. albus, R. flavefaciens, B. proteoclasticus, and B. fibrisolvens was decreased linearly (p < 0.05) with increasing doses of PHN supplementation, while SAB supplementation had no effect (p > 0.05) (Figure 2). The abundance of P. ruminicola was decreased linearly (p < 0.05) with increasing doses of PHN supplementation, while the abundance of F. succinogenes was not affected (p > 0.05).

4. Discussion

The leaves of various trees contain biologically active compounds [42]. Of the plant’s secondary metabolites, polyphenols and flavonoids are abundant in bamboo leaves. Plant secondary metabolites may improve ruminal fermentation, stimulate microbial metabolism, modulate the microbial population, and mitigate methane production in the rumen [43,44,45,46]. Therefore, nutritious bamboo leaves containing biologically active compounds can potentially be used as feed additives for ruminants. Teh et al. [47] reported a positive correlation between flavonoid content and antioxidant activity (i.e., DPPH and ABTS radical scavenging activity). However, in our study, SAB leaves had higher flavonoid levels and lower antioxidant activities compared to PHN leaves.
Based on the in vitro batch cultures, the pH of rumen fluid increased linearly in a dose-dependent manner. This result was supported by the observation that polyphenols and flavonoids slowed the digestion of fiber in the rumen [48]. Most acetate- and butyrate-producing fibrolytic bacteria are sensitive to the pH of rumen fluid below 5.0–5.5 [49]. As confirmed in this study, bamboo leaves supplementation negatively affected fibrolytic bacteria (R. albus, R. flavefaciens, and F. succinogenes). Furthermore, pH changes are associated with rumen digestion and fermentation, because they can occur through the accumulation of VFA. Here, bamboo leaves supplementation induced a shift in the VFA pattern and affected the pH. Notably, bamboo leaves supplementation caused a shift in ruminal fermentation to a greater acetate concentration and acetate-to-propionate ratio and a reduced concentration of propionate after 24 h. This would have a negative effect on methane mitigation, because the formation of acetate results in the production of hydrogen [50], while the formation of propionate creates a hydrogen sink, reducing the availability of hydrogen to methanogen [51]. In addition, decreased ruminal propionate production should decrease blood glucose concentration via gluconeogenesis and then decrease milk lactose [52]. The DM digestibility by bamboo leaves supplementation was approximately 4.9–11.2% improved than the CON group, which may be influenced by plant secondary metabolites [53].
Methane production was not affected by bamboo leaves supplementation after 24 h incubation, but 12 and 48 h reduced approximately 12.7–34.2% more than the CON group, without compromising total VFA production. Jafari et al. [21] reported that different amounts of bamboo leaves (15, 25, and 50% of Alfalfa hay, which was used as substrate in Jafari’s study and was replaced by bamboo leaves) reduced methane production by 29–62%. The greater reduction observed here may be due to differences in substrate addition and replacement, or the study by Jafari et al. [21] showed a linearly decreasing trend in total VFA with increasing doses of bamboo leaves, or both. Furthermore, it may be because the chemical compositions of plants are influenced by their geographic origin, harvest stage, and age [54,55]. The lower abundance of methanogenic archaea following PHN supplementation may support this result. This result is in agreement with a previous study that reported a decreased number of methanogenic archaea in response to direct inhibition of polyphenols and flavonoids of PHN [56]. SAB supplementation did not affect the number of methanogenic archaea but did slightly decrease methane production, which may be due to the depressed metabolism of methanogenic microbes, the transformed composition of the methanogenic community, or both [57]. In addition, the lower abundance of hydrogen-producing bacteria (R. albus and R. flavefaciens) was reduced by PHN supplementation. This result is supported by flavonoids having antibacterial properties against gram-positive bacteria [58]. Wann et al. [59] observed that fibrolytic bacteria numbers increased linearly in vivo with an increase in the concentration of bamboo leaves (from 0–150 g/d per head). Our results did not increase the abundance of fibrolytic organisms (Fungi, Ruminococcus, and Fibrobacter), which may be due to the drying method of the bamboo leaves used in this study. Freeze drying has a higher antioxidant capacity for secondary metabolites than sun drying [60]. This result is also supported by the lower abundance of hydrogen-producing bacteria (R. albus and R. flavefaciens) following PHN supplementation.
Previous studies [61,62] have observed a shift to butyrate production instead of propionate production following natural feed additives supplementation, which is in keeping with our findings following PHN supplementation at 48 h. However, the abundance of butyrate-producing bacteria (B. proteoclasticus and B. fibrisolvens) was not decreased, suggesting that this result is due to the changed butyrate-producing bacteria that produce another metabolite, as reported by Oh et al. [63], or increased butyrate production at the expense of acetate, or both. According to Janssen [64], since the butyrate production pathway competes for dihydrogen, more butyrate production reduces hydrogen, which is accompanied by a reduction in methane production. In addition, rumen epithelial cells use butyrate as a major energy source, and butyrate stimulates its development to improve feed utilization [65]. The reason for the mitigated methane production following SAB supplementation is not clear. However, this result may be explained by the reduction of carbon dioxide, an important substrate of methanogenic bacteria, during methane production following SAB supplementation.

5. Conclusions

Bamboo leaves are rich in polyphenols and flavonoids and possess antioxidant activities. Experimental data on the effects of bamboo leaves supplementation on rumen fermentation, methane production, and microbial populations are limited. Based on the data obtained from the present study, it could be concluded that bamboo leaves did not negatively affect DM digestibility and VFA production but did reduce total gas, methane, and carbon dioxide production and alter the microbial population. Dietary inclusion of bamboo leaves could serve as a promising additive for mitigating enteric methane production, however; further studies are needed to demonstrate the effect of bamboo leaves supplementation in vivo for mitigating enteric greenhouse gas production from ruminants.

Author Contributions

Conceptualization, S.U.J., S.J.L. and S.S.L.; Formal analysis, S.U.J., Y.C., J.S.E. and H.S.K.; Data curation, Y.C.; Funding acquisition, Y.L.; Investigation, J.S.E. and H.S.K.; Writing—original draft preparation, S.U.J. and S.J.L.; Writing—review and editing, S.S.L. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Institute of Animal Science, Ministry of Rural Development Administration, Republic of Korea (Research Project PJ01477803).

Institutional Review Board Statement

This study was conducted in accordance with the guidelines of the Animal Care and Use Committee of Gyeongsang National University (Gyeongsangnam-do, Jinju, Korea; GNU-191011-E0050).

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Johnson, K.A.; Johnson, D.E. Methane Emissions from Cattle. J. Anim. Sci. 1995, 73, 2483–2492. [Google Scholar] [CrossRef]
  2. Opio, C.; Gerber, P.; Mottet, A.; Falcucci, A.; Tempio, G.; MacLeod, M.; Vellinga, T.; Henderson, B.; Steinfeld, H. Greenhouse Gas Emissions from Ruminant Supply Chains—A Global Life Cycle Assessment; Food and Agriculture Organization of the United Nations: Rome, Italy, 2013; ISBN 9-25-107945-5. [Google Scholar]
  3. Gerber, P.J.; Steinfeld, H.; Henderson, B.; Mottet, A.; Opio, C.; Dijkman, J.; Falcucci, A.; Tempio, G. Tackling Climate Change through Livestock: A Global Assessment of Emissions and Mitigation Opportunities; Food and Agriculture Organization of the United Nations (FAO): Rome, Italy, 2013; ISBN 925107920X. [Google Scholar]
  4. Johnson, D.E.; Ward, G.M. Estimates of Animal Methane Emissions. Environ. Monit. Assess. 1996, 42, 133–141. [Google Scholar] [CrossRef] [PubMed]
  5. Czerkawski, J.W. Methane Production in Ruminants and Its Significance. World Rev. Nutr. Diet. 1969, 11, 240–282. [Google Scholar] [PubMed]
  6. Chen, D.; Zhou, J.; Zhang, Q. Effects of Heating Rate on Slow Pyrolysis Behavior, Kinetic Parameters and Products Properties of Moso Bamboo. Bioresour. Technol. 2014, 169, 313–319. [Google Scholar] [CrossRef] [PubMed]
  7. Bahari, S.A.; Krause, A. Utilizing Malaysian Bamboo for Use in Thermoplastic Composites. J. Clean. Prod. 2016, 110, 16–24. [Google Scholar] [CrossRef]
  8. Song, X.; Zhou, G.; Jiang, H.; Yu, S.; Fu, J.; Li, W.; Wang, W.; Ma, Z.; Peng, C. Carbon Sequestration by Chinese Bamboo Forests and Their Ecological Benefits: Assessment of Potential, Problems, and Future Challenges. Environ. Rev. 2011, 19, 418–428. [Google Scholar] [CrossRef]
  9. Benton, A. Priority Species of Bamboo. In Bamboo; Springer: Berlin/Heidelberg, Germany, 2015; pp. 31–41. [Google Scholar]
  10. Véras, R.M.L.; Gois, G.C.; Nascimento, D.B.; Magalhães, A.L.R.; Teodoro, A.L.; Pinto, C.S.; Oliveira, L.P.; Campos, F.S.; Andrade, A.P.; Lima, I.E. Potential Alternative Feed Sources for Ruminant Feeding from the Biodiesel Production Chain By-Products. S. Afr. J. Anim. Sci. 2020, 50, 69–77. [Google Scholar]
  11. Serrapica, F.; Masucci, F.; Raffrenato, E.; Sannino, M.; Vastolo, A.; Barone, C.M.A.; Di Francia, A. High Fiber Cakes from Mediterranean Multipurpose Oilseeds as Protein Sources for Ruminants. Animals 2019, 9, 918. [Google Scholar] [CrossRef]
  12. Park, H.-S.; Lim, J.H.; Kim, H.J.; Choi, H.J.; Lee, I.-S. Antioxidant Flavone Glycosides from the Leaves of Sasa borealis. Arch. Pharm. Res. 2007, 30, 161–166. [Google Scholar] [CrossRef]
  13. Kim, C.Y.; Lee, H.J.; Jung, S.H.; Lee, E.H.; Cha, K.H.; Kang, S.W.; Pan, C.-H.; Um, B.-H. Rapid Identification of Radical Scavenging Phenolic Compounds from Black Bamboo Leaves Using High-Performance Liquid Chromatography Coupled to an Online ABTS+-Based Assay. J. Korean Soc. Appl. Biol. Chem. 2009, 52, 613–619. [Google Scholar] [CrossRef]
  14. Formato, M.; Piccolella, S.; Zidorn, C.; Vastolo, A.; Calabrò, S.; Cutrignelli, M.I.; Pacifico, S. UHPLC-ESI-Q q TOF Analysis and In Vitro Rumen Fermentation for Exploiting Fagus sylvatica Leaf in Ruminant Diet. Molecules 2022, 27, 2217. [Google Scholar] [CrossRef]
  15. Liu, M.-H.; Ko, C.-H.; Ma, N.; Tan, P.-W.; Fu, W.-M.; He, J.-Y. Chemical Profiles, Antioxidant and Anti-Obesity Effects of Extract of Bambusa textilis McClure Leaves. J. Funct. Foods 2016, 22, 533–546. [Google Scholar] [CrossRef]
  16. Xie, J.; Lin, Y.-S.; Shi, X.-J.; Zhu, X.-Y.; Su, W.-K.; Wang, P. Mechanochemical-Assisted Extraction of Flavonoids from Bamboo (Phyllostachys edulis) Leaves. Ind. Crops Prod. 2013, 43, 276–282. [Google Scholar] [CrossRef]
  17. Huang, H.; Szumacher-Strabel, M.; Patra, A.K.; Ślusarczyk, S.; Lechniak, D.; Vazirigohar, M.; Varadyova, Z.; Kozłowska, M.; Cieślak, A. Chemical and Phytochemical Composition, In Vitro Ruminal Fermentation, Methane Production, and Nutrient Degradability of Fresh and Ensiled Paulownia Hybrid Leaves. Anim. Feed Sci. Technol. 2021, 279, 115038. [Google Scholar] [CrossRef]
  18. Lee, S.J.; Kim, H.S.; Eom, J.S.; Choi, Y.Y.; Jo, S.U.; Chu, G.M.; Lee, Y.; Seo, J.; Kim, K.H.; Lee, S.S. Effects of Olive (Olea europaea L.) Leaves with Antioxidant and Antimicrobial Activities on In Vitro Ruminal Fermentation and Methane Emission. Animals 2021, 11, 2008. [Google Scholar] [CrossRef]
  19. Kim, S.-H.; Lee, I.-C.; Kang, S.-S.; Moon, C.-J.; Kim, S.-H.; Shin, D.-H.; Kim, H.-C.; Yoo, J.-C.; Kim, J.-C. Effects of Bamboo Charcoal and Bamboo Leaf Supplementation on Performance and Meat Quality in Chickens. J. Life Sci. 2011, 21, 805–810. [Google Scholar] [CrossRef]
  20. Mekuriaw, Y.; Urge, M.; Animut, G. Intake, Digestibility, Live Weight Changes and Rumen Parameters of Washera Sheep Fed Mixtures of Lowland Bamboo (Oxytenanthera abyssinica) Leaves and Natural Pasture Grass Hay at Different Ratios. Pakistan J. Nutr. 2012, 11, 322–331. [Google Scholar] [CrossRef]
  21. Jafari, S.; Goh, Y.M.; Rajion, M.A.; Ebrahimi, M. Effects of Polyphenol Rich Bamboo Leaf on Rumen Fermentation Characteristics and Methane Gas Production in an in Vitro Condition. Indian J. Anim. Res. 2020, 54, 322–326. [Google Scholar] [CrossRef]
  22. Li, Y.; Fang, L.; Xue, F.; Mao, S.; Xiong, B.; Ma, Z.; Jiang, L. Effects of Bamboo Leaf Extract on the Production Performance, Rumen Fermentation Parameters, and Rumen Bacterial Communities of Heat-Stressed Dairy Cows. Anim. Biosci. 2021, 34, 1784. [Google Scholar] [CrossRef]
  23. AOAC International. AOAC: Official Methods of Analysis; Association of Official Analytical Chemists, Inc.: Arlington, VA, USA, 1990; Volume 1, pp. 69–90. [Google Scholar]
  24. Van Soest, P.J.; van Robertson, J.B.; Lewis, B.A. Methods for Dietary Fiber, Neutral Detergent Fiber, and Nonstarch Polysaccharides in Relation to Animal Nutrition. J. Dairy Sci. 1991, 74, 3583–3597. [Google Scholar] [CrossRef]
  25. Licitra, G.; Hernandez, T.M.; Van Soest, P.J. Standardization of Procedures for Nitrogen Fractionation of Ruminant Feeds. Anim. Feed Sci. Technol. 1996, 57, 347–358. [Google Scholar] [CrossRef]
  26. Singleton, V.L.; Rossi, J.A. Colorimetry of Total Phenolics with Phosphomolybdic-Phosphotungstic Acid Reagents. Am. J. Enol. Vitic. 1965, 16, 144–158. [Google Scholar]
  27. Meda, A.; Lamien, C.E.; Romito, M.; Millogo, J.; Nacoulma, O.G. Determination of the Total Phenolic, Flavonoid and Proline Contents in Burkina Fasan Honey, as Well as Their Radical Scavenging Activity. Food Chem. 2005, 91, 571–577. [Google Scholar] [CrossRef]
  28. Brand-Williams, W.; Cuvelier, M.-E.; Berset, C. Use of a Free Radical Method to Evaluate Antioxidant Activity. LWT-Food Sci. Technol. 1995, 28, 25–30. [Google Scholar] [CrossRef]
  29. Re, R.; Pellegrini, N.; Proteggente, A.; Pannala, A.; Yang, M.; Rice-Evans, C. Antioxidant Activity Applying an Improved ABTS Radical Cation Decolorization Assay. Free Radic. Biol. Med. 1999, 26, 1231–1237. [Google Scholar] [CrossRef]
  30. Seleshe, S.; Lee, J.S.; Lee, S.; Lee, H.J.; Kim, G.R.; Yeo, J.; Kim, J.Y.; Kang, S.N. Evaluation of Antioxidant and Antimicrobial Activities of Ethanol Extracts of Three Kinds of Strawberries. Prev. Nutr. Food Sci. 2017, 22, 203. [Google Scholar]
  31. Theodorou, M.K.; Williams, B.A.; Dhanoa, M.S.; McAllan, A.B.; France, J. A Simple Gas Production Method Using a Pressure Transducer to Determine the Fermentation Kinetics of Ruminant Feeds. Anim. Feed Sci. Technol. 1994, 48, 185–197. [Google Scholar] [CrossRef]
  32. López, S.; Dhanoa, M.S.; Dijkstra, J.; al Bannink, A.; Kebreab, E.; France, J. Some Methodological and Analytical Considerations Regarding Application of the Gas Production Technique. Anim. Feed Sci. Technol. 2007, 135, 139–156. [Google Scholar] [CrossRef]
  33. Adesogan, A.T.; Krueger, N.; Salawu, M.B.; Dean, D.B.; Staples, C.R. The Influence of Treatment with Dual Purpose Bacterial Inoculants or Soluble Carbohydrates on the Fermentation and Aerobic Stability of Bermudagrass. J. Dairy Sci. 2004, 87, 3407–3416. [Google Scholar] [CrossRef]
  34. Kim, H.; Kim, B.; Cho, S.; Kwon, I.; Seo, J. Dietary Lysophospholipids Supplementation Inhibited the Activity of Lipolytic Bacteria in Forage with High Oil Diet: An in Vitro Study. Asian-Australas. J. Anim. Sci. 2020, 33, 1590. [Google Scholar] [CrossRef]
  35. Hamid, M.M.A.; Moon, J.; Yoo, D.; Kim, H.; Lee, Y.K.; Song, J.; Seo, J. Rumen Fermentation, Methane Production, and Microbial Composition Following in Vitro Evaluation of Red Ginseng Byproduct as a Protein Source. J. Anim. Sci. Technol. 2020, 62, 801. [Google Scholar] [CrossRef]
  36. Denman, S.E.; McSweeney, C.S. Development of a Real-Time PCR Assay for Monitoring Anaerobic Fungal and Cellulolytic Bacterial Populations within the Rumen. FEMS Microbiol. Ecol. 2006, 58, 572–582. [Google Scholar] [CrossRef]
  37. Khafipour, E.; Li, S.; Plaizier, J.C.; Krause, D.O. Rumen Microbiome Composition Determined Using Two Nutritional Models of Subacute Ruminal Acidosis. Appl. Environ. Microbiol. 2009, 75, 7115–7124. [Google Scholar] [CrossRef] [Green Version]
  38. Sylvester, J.T.; Karnati, S.K.R.; Yu, Z.; Morrison, M.; Firkins, J.L. Development of an Assay to Quantify Rumen Ciliate Protozoal Biomass in Cows Using Real-Time PCR. J. Nutr. 2004, 134, 3378–3384. [Google Scholar] [CrossRef]
  39. Wang, R.; Cao, W.; Cerniglia, C.E. A Universal Protocol for PCR Detection of 13 Species of Foodborne Pathogens in Foods. J. Appl. Microbiol. 1997, 83, 727–736. [Google Scholar] [CrossRef]
  40. Stevenson, D.M.; Weimer, P.J. Dominance of Prevotella and Low Abundance of Classical Ruminal Bacterial Species in the Bovine Rumen Revealed by Relative Quantification Real-Time PCR. Appl. Microbiol. Biotechnol. 2007, 75, 165–174. [Google Scholar] [CrossRef]
  41. Paillard, D.; McKain, N.; Chaudhary, L.C.; Walker, N.D.; Pizette, F.; Koppova, I.; McEwan, N.R.; Kopečný, J.; Vercoe, P.E.; Louis, P. Relation between Phylogenetic Position, Lipid Metabolism and Butyrate Production by Different Butyrivibrio-Like Bacteria from the Rumen. Antonie Van Leeuwenhoek 2007, 91, 417–422. [Google Scholar] [CrossRef]
  42. Su, B.; Chen, X. Current Status and Potential of Moringa Oleifera Leaf as an Alternative Protein Source for Animal Feeds. Front. Vet. Sci. 2020, 7, 53. [Google Scholar] [CrossRef]
  43. Szumacher-Strabel, M.; Cieślak, A. Potential of Phytofactors to Mitigate Rumen Ammonia and Methane Production. J. Anim. Feed Sci. 2010, 19, 319–337. [Google Scholar] [CrossRef]
  44. Patra, A.K.; Saxena, J. A New Perspective on the Use of Plant Secondary Metabolites to Inhibit Methanogenesis in the Rumen. Phytochemistry 2010, 71, 1198–1222. [Google Scholar] [CrossRef]
  45. Balcells, J.; Aris, A.; Serrano, A.; Seradj, A.R.; Crespo, J.; Devant, M. Effects of an Extract of Plant Flavonoids (Bioflavex) on Rumen Fermentation and Performance in Heifers Fed High-Concentrate Diets. J. Anim. Sci. 2012, 90, 4975–4984. [Google Scholar] [CrossRef] [PubMed]
  46. Broudiscou, L.-P.; Papon, Y.; Broudiscou, A.F. Effects of Dry Plant Extracts on Feed Degradation and the Production of Rumen Microbial Biomass in a Dual Outflow Fermenter. Anim. Feed Sci. Technol. 2002, 101, 183–189. [Google Scholar] [CrossRef]
  47. Teh, S.-S.; Bekhit, A.E.-D.; Birch, J. Antioxidative Polyphenols from Defatted Oilseed Cakes: Effect of Solvents. Antioxidants 2014, 3, 67–80. [Google Scholar] [CrossRef] [PubMed]
  48. Cone, J.W. Degradation of Starch in Feed Concentrates by Enzymes, Rumen Fluid and Rumen Enzymes. J. Sci. Food Agric. 1991, 54, 23–34. [Google Scholar] [CrossRef]
  49. Hoover, W.H. Chemical Factors Involved in Ruminal Fiber Digestion. J. Dairy Sci. 1986, 69, 2755–2766. [Google Scholar] [CrossRef]
  50. Moss, A.R.; Jouany, J.-P.; Newbold, J. Methane Production by Ruminants: Its Contribution to Global Warming. Annales de Zootechnie 2000, 49, 231–253. [Google Scholar] [CrossRef]
  51. Henderson, C. The Influence of Extracellular Hydrogen on the Metabolism of Bacteroides ruminicola, Anaerovibrio lipolytica and Selenomonas ruminantium. Microbiology 1980, 119, 485–491. [Google Scholar] [CrossRef]
  52. Stein, D.R.; Allen, D.T.; Perry, E.B.; Bruner, J.C.; Gates, K.W.; Rehberger, T.G.; Mertz, K.; Jones, D.; Spicer, L.J. Effects of Feeding Propionibacteria to Dairy Cows on Milk Yield, Milk Components, and Reproduction. J. Dairy Sci. 2006, 89, 111–125. [Google Scholar] [CrossRef]
  53. Hussain, I.; Cheeke, P.R. Effect of Dietary Yucca Schidigera Extract on Rumen and Blood Profiles of Steers Fed Concentrate- or Roughage-Based Diets. Anim. Feed Sci. Technol. 1995, 51, 231–242. [Google Scholar] [CrossRef]
  54. Zdunic, G.; Godjevac, D.; Savikin, K.; Petrovic, S. Comparative Analysis of Phenolic Compounds in Seven Hypericum Species and Their Antioxidant Properties. Nat. Prod. Commun. 2017, 12, 1805–1811. [Google Scholar] [CrossRef]
  55. Makarova, K.; Sajkowska-Kozielewicz, J.J.; Zawada, K.; Olchowik-Grabarek, E.; Ciach, M.A.; Gogolewski, K.; Dobros, N.; Ciechowicz, P.; Freichels, H.; Gambin, A. Harvest Time Affects Antioxidant Capacity, Total Polyphenol and Flavonoid Content of Polish St John’s Wort’s (Hypericum perforatum L.) Flowers. Sci. Rep. 2021, 11, 3989. [Google Scholar] [CrossRef] [PubMed]
  56. Bodas, R.; Prieto, N.; García-González, R.; Andrés, S.; Giráldez, F.J.; López, S. Manipulation of Rumen Fermentation and Methane Production with Plant Secondary Metabolites. Anim. Feed Sci. Technol. 2012, 176, 78–93. [Google Scholar] [CrossRef]
  57. Machmüller, A.; Soliva, C.R.; Kreuzer, M. Effect of Coconut Oil and Defaunation Treatment on Methanogenesis in Sheep. Reprod. Nutr. Dev. 2003, 43, 41–55. [Google Scholar] [CrossRef] [Green Version]
  58. Cushnie, T.P.T.; Lamb, A.J. Antimicrobial Activity of Flavonoids. Int. J. Antimicrob. Agents 2005, 26, 343–356. [Google Scholar] [CrossRef]
  59. Wann, C.; Wanapat, M.; Mapato, C.; Ampapon, T.; Huang, B. Effect of Bamboo Grass (Tiliacora triandra, Diels) Pellet Supplementation on Rumen Fermentation Characteristics and Methane Production in Thai Native Beef Cattle. Asian-Australas. J. Anim. Sci. 2019, 32, 1153. [Google Scholar] [CrossRef]
  60. Saifullah, M.; McCullum, R.; McCluskey, A.; Vuong, Q. Effects of Different Drying Methods on Extractable Phenolic Compounds and Antioxidant Properties from Lemon Myrtle Dried Leaves. Heliyon 2019, 5, e03044. [Google Scholar] [CrossRef]
  61. Demeyer, D.I.; Van Nevel, C.J.; Van de Voorde, G. The Effect of Defaunation on the Growth of Lambs Fed Three Urea Containing Diets. Archiv für Tierernaehrung 1982, 32, 595–604. [Google Scholar] [CrossRef]
  62. Johnson, R.R. Influence of Carbohydrate Solubility on Non-Protein Nitrogen Utilization in the Ruminant. J. Anim. Sci. 1976, 43, 184–191. [Google Scholar] [CrossRef]
  63. Oh, S.; Shintani, R.; Koike, S.; Kobayashi, Y. Ginkgo Fruit Extract as an Additive to Modify Rumen Microbiota and Fermentation and to Mitigate Methane Production. J. Dairy Sci. 2017, 100, 1923–1934. [Google Scholar] [CrossRef]
  64. Janssen, P.H. Influence of Hydrogen on Rumen Methane Formation and Fermentation Balances through Microbial Growth Kinetics and Fermentation Thermodynamics. Anim. Feed Sci. Technol. 2010, 160, 1–22. [Google Scholar] [CrossRef]
  65. Scheppach, W. Effects of Short Chain Fatty Acids on Gut Morphology and Function. Gut 1994, 35, S35–S38. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Animals 12 02222 g001 550
Figure 1. Effects of bamboo leaves addition on the population of general bacteria (a), methanogenic archaea (b), ciliate protozoa (c), and fungi (d) (Log copy number of DNA/mL of rumen fluid) at 48 h incubation time. Error bars are standard error of the mean (n = 4). abcd Means with different superscripts in the same row indicate significant differences (p < 0.05). Orthogonal contrasts for linear and quadratic effects were considered statistically significant at * p < 0.050, ** p < 0.010, and *** p < 0.001.
Figure 1. Effects of bamboo leaves addition on the population of general bacteria (a), methanogenic archaea (b), ciliate protozoa (c), and fungi (d) (Log copy number of DNA/mL of rumen fluid) at 48 h incubation time. Error bars are standard error of the mean (n = 4). abcd Means with different superscripts in the same row indicate significant differences (p < 0.05). Orthogonal contrasts for linear and quadratic effects were considered statistically significant at * p < 0.050, ** p < 0.010, and *** p < 0.001.
Animals 12 02222 g001
Animals 12 02222 g002 550
Figure 2. Effects of bamboo leaves addition on the population of Ruminococcus albus (a), flavefaciens (b), Fibrobacter succinogenes (c), Butyrivibrio fibrisolvens (d), proteoclasticus (e), and Prevotella ruminicola (f) (Log copy number of DNA/mL of culture) at 48 h incubation time. Error bars are standard error of the mean (n = 4). abc Means with different superscripts in the same row indicate significant differences (p < 0.05). Orthogonal contrasts for linear and quadratic effects were considered statistically significant at * p < 0.050 and *** p < 0.001.
Figure 2. Effects of bamboo leaves addition on the population of Ruminococcus albus (a), flavefaciens (b), Fibrobacter succinogenes (c), Butyrivibrio fibrisolvens (d), proteoclasticus (e), and Prevotella ruminicola (f) (Log copy number of DNA/mL of culture) at 48 h incubation time. Error bars are standard error of the mean (n = 4). abc Means with different superscripts in the same row indicate significant differences (p < 0.05). Orthogonal contrasts for linear and quadratic effects were considered statistically significant at * p < 0.050 and *** p < 0.001.
Animals 12 02222 g002
Table
Table 1. Chemical composition of control diet (dry matter basis, %).
Table 1. Chemical composition of control diet (dry matter basis, %).
Items 1Timothy HaySD 2
Chemical composition
Dry matter94.110.64
Ether extract5.480.12
Crude protein10.460.68
Crude ash5.930.06
Crude fiber30.110.23
NDF62.270.22
ADF38.140.75
1 NDF, neutral detergent fiber; ADF, acid detergent fiber. 2 SD, standard deviation of 3 replicates.
Table
Table 2. Primers for real-time polymerase chain reaction assays.
Table 2. Primers for real-time polymerase chain reaction assays.
Target SpeciesPrimer 1SequenceSize (bp) 2Efficiency 3References
General bacteriaFCGGCAACGAGCGCAACCC1301.98[36,37]
RCCATTGTAGCACGTGTGTAGCC
Methanogenic archaeaFGAGGAAGGAGTGGACGACGGTA2321.92[38]
RACGGGCGGTGTGTGCAAG
Ciliate protozoaFGCTTTCGWTGGTAGTGTATT2231.91[38]
RCTTGCCCTCYAATCGTWCT
FungiFGAGGAAGTAAAAGTCGTAACAAGGTTTC1201.83[36]
RCAAATTCACAAAGGGTAGGATGATT
Ruminococcus albusFCCCTAAAAGCAGTCTTAGTTCG1761.93[39]
RCCTCCTTGCGGTTAGAACA
Ruminococcus flavefaciensFCGAACGGAGATAATTTGAGTTTACTTAGG1321.81[36]
RCGGTCTCTGTATGTTATGAGGTATTACC
Fibrobacter succinogenesFGTTCGGAATTACTGGGCGTAAA1211.88[36]
RCGCCTGCCCCTGAACTATC
Butyrivibrio fibrisolvensFACCGCATAAGCGCACGGA651.89[40]
RCGGGTCCATCTTGTACCGATAAAT
Butyrivibrio proteoclasticusFTCCGGTGGTATGAGATGGGC1852.22[41]
RGTCGCTGCATCAGAGTTTCCT
Prevotella ruminicolaFGCGAAAGTCGGATTAATGCTCTATG782.04[37]
RCCCATCCTATAGCGGTAAACCTTTG
1 F, forward; R, reverse. 2 bp, base pair. 3 efficiency is calculated as [10−1/slope].
Table
Table 3. Chemical composition and antioxidant activity of bamboo leaves (DM basis, %).
Table 3. Chemical composition and antioxidant activity of bamboo leaves (DM basis, %).
Items 1Phyllostachys nigra Var. HenonisSD 2Sasa borealisSD
Chemical composition
Dry matter (DM)45.390.2454.840.22
Ether extract2.490.560.650.15
Crude protein (CP)13.150.3214.820.20
Crude ash12.120.117.990.05
Crude fiber21.080.0724.190.38
NDF65.60.8470.580.88
ADF38.020.3035.570.27
NDICP
(CP basis, %)		12.830.0614.260.07
ADICP
(CP basis, %)		5.260.132.920.09
Total polyphenol
(mg CE/g extract)		31.045.8344.546.07
Total flavonoid
(mg QE/g extract)		16.730.5219.60.49
IC50 for DPPH
(µg/mL)		115.586.06125.433.83
IC50 for ABTS
(µg/mL)		47.430.6154.172.53
1 NDF, neutral detergent fiber; ADF, acid detergent fiber; NDICP, neutral detergent insoluble crude protein; ADICP, acid detergent insoluble crude protein; CE, catechin equivalent; QE, quercetin equivalent; IC50, half maximal inhibitory concentration. 2 SD, standard deviation of 3 replicates.
Table
Table 4. Effects of bamboo leaves on pH and dry matter digestibility in in vitro incubation.
Table 4. Effects of bamboo leaves on pH and dry matter digestibility in in vitro incubation.
Incubation Time (h)CON 1Treatment 2SEM 3 p
Value		Contrasts 4
PHNSABPHN SetSAB Set
PHNLPHNMPHNHSABLSABMSABHLQLQ
pH
126.91 d7.03 c7.09 bc7.08 bc7.14 ab7.12 abc7.20 a0.02<0.0001**********
246.59 b6.72 a6.69 a6.71 a6.77 a6.72 a6.73 a0.020.0003*********
486.19 b6.30 a6.27 ab6.25 ab6.23 ab6.20 ab6.20 ab0.020.0218ns*nsns
Dry matter digestibility (%)
631.131.431.532.434.333.433.31.320.5560nsnsnsns
1238.7 b43.0 ab40.8 ab42.6 ab42.9 ab43.5 a42.0 ab1.010.0392nsns**
2453.156.253.957.056.956.654.11.320.2069nsnsns*
4865.5 a61.8 b64.9 ab63.5 ab64.0 ab64.6 ab65.4 ab0.790.0466nsnsnsns
7268.766.467.566.467.367.869.30.850.1797nsnsnsns
1 CON, control (without bamboo leaves). 2 PHN, Phyllostachys nigra var. henonis; SAB, Sasa borealis; PHN and SAB dose levels of 0.3 g/L (PHNL and SABL), 0.6 g/L (PHNM and SABM), and 0.9 g/L (PHNH and SABH). 3 SEM, standard error of the mean. 4 orthogonal contrasts for L, linear and Q, quadratic effects. The levels of significance were assigned as follow, ns, non-significant; *, p < 0.050; **, p < 0.010; ***, p < 0.001. abc Means (n = 4) with different superscripts in the same column differ significantly (p < 0.05).
Table
Table 5. Effects of bamboo leaves on gas profiles in in vitro incubation.
Table 5. Effects of bamboo leaves on gas profiles in in vitro incubation.
Incubation Time (h)CON 1Treatment 2SEM 3 p
Value		Contrasts 4
PHNSABPHN SetSAB Set
PHNLPHNMPHNHSABLSABMSABLLQLQ
Total gas (mL∙g−1 DM 5)
1287.0 a82.1 b82.0 b81.2 b82.2 b81.2 b77.5 c0.77<0.0001*******ns
24121 a115 ab115 abc112 bc116 ab115 bc109 c1.310.0002***ns***ns
48156 a147 ab147 b146 b151 ab147 b147 ab1.970.0146*****ns
Methane (mL∙g−1 DM)
127.40 a5.84 ab4.87 b5.83 ab6.26 ab6.15 ab5.57 b0.370.0051******ns
2414.812.713.714.614.214.113.80.790.6162ns*nsns
4823.7 a20.7 ab19.1 b18.5 b19.1 ab19.7 b19.4 ab0.730.0010***ns***
Methane/Total gas (%)
128.52 a7.12 ab5.94 b7.19 ab7.62 ab7.57 ab7.19 ab0.490.0488ns**ns
2412.211.011.913.012.312.312.70.640.4616ns*nsns
4815.2 a14.1 ab13.0 ab12.7 b12.6 b13.5 ab13.9 ab0.530.0249**nsns*
Carbon dioxide (mL∙g−1 DM)
1235.5 a27.3 ab22.6 b26.7 b30.7 ab28.5 ab27.2 ab1.890.0044******ns
2455.045.949.052.151.850.949.42.900.4603ns*nsns
4880.0 a70.8 ab63.5 b60.7 b63.5 b65.5 b67.6 b2.520.0005***ns***
Carbon dioxide/Total gas (%)
1240.8 a33.3 ab27.6 b32.9 ab37.4 ab35.1 ab35.0 ab2.390.0272**nsns
2445.739.842.746.644.644.345.42.440.5343ns*nsns
4851.3 a48.1 ab43.3 ab41.6 b42.0 b44.7 ab46.1 ab1.850.0123***nsns*
1 CON, control (without bamboo leaves). 2 PHN, Phyllostachys nigra var. henonis; SAB, Sasa borealis; PHN and SAB dose levels of 0.3 g/L (PHNL and SABL), 0.6 g/L (PHNM and SABM), and 0.9 g/L (PHNH and SABH). 3 SEM, standard error of the mean. 4 orthogonal contrasts for L, linear and Q, quadratic effects. 5 DM, dry matter. The levels of significance were assigned as follow, ns, non-significant; *, p < 0.050; **, p < 0.010; ***, p < 0.001. abc Means (n = 4) with different superscripts in the same column differ significantly (p < 0.05).
Table
Table 6. Effects of bamboo leaves on volatile fatty acid profiles in in vitro incubation.
Table 6. Effects of bamboo leaves on volatile fatty acid profiles in in vitro incubation.
Incubation Time (h)CON 1Treatment 2SEM 3 p
Value		Contrasts 4
PHNSABPHN SetSAB Set
PHNLPHNMPHNHSABLSABMSABHLQLQ
Total VFA (mM)
1254.854.354.754.854.954.654.50.4790.9634nsnsnsns
2473.4 bc73.7 bc76.6 ab73.1 c78.0 a77.4 a75.0 abc0.7410.0002ns**ns***
4878.478.278.478.280.380.583.61.2590.0534nsns*ns
Acetate (mM)
1235.335.035.535.535.235.034.90.3540.7824nsnsnsns
2445.6 c47.4 bc49.7 ab46.8 bc52.1 a50.9 a48.9 abc0.765<0.0001*******
4851.5 b51.2 b51.3 b51.7 ab54.3 ab53.0 ab56.4 a1.0170.0115nsns*ns
Propionate (mM)
1213.0 ab12.7 ab12.5 b12.8 ab13.1 a12.8 ab12.5 ab0.1270.0188ns**ns
2419.3 a18.4 bc18.8 b18.3 c18.0 c18.4 bc18.1 c0.108<0.0001***ns******
4818.8 ab17.1 c17.0 c17.2 bc17.8 abc18.0 abc19.0 a0.3700.0023**ns*
Butyrate (mM)
126.436.646.746.576.656.807.070.1400.1014nsns**ns
248.43 a7.88 b8.09 ab7.94 ab7.87 b8.07 ab8.05 ab0.1170.0463*nsns*
488.09 b9.94 a10.12 a9.29 ab8.17 b9.40 ab8.20 b0.3120.0002*****nsns
Acetate-to-propionate ratio
122.71 b2.77 ab2.84 a2.78 ab2.69 b2.72 b2.78 ab0.0260.0064*ns*ns
242.36 c2.57 bc2.64 b2.56 bc2.90 a2.77 ab2.71 ab0.046<0.0001*********
482.74 b2.99 ab3.02 ab3.02 ab3.06 a2.94 ab2.96 ab0.0640.0445***nsns
1 CON, control (without bamboo leaves). 2 PHN, Phyllostachys nigra var. henonis; SAB, Sasa borealis; PHN and SAB dose levels of 0.3 g/L (PHNL and SABL), 0.6 g/L (PHNM and SABM), and 0.9 g/L (PHNH and SABH). 3 SEM, standard error of the mean. 4 orthogonal contrasts for L, linear and Q, quadratic effects. The levels of significance were assigned as follow, ns, non-significant; *, p < 0.050; **, p < 0.010; ***, p < 0.001. abc Means (n = 4) with different superscripts in the same column differ significantly (p < 0.05).
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Jo, S.U.; Lee, S.J.; Kim, H.S.; Eom, J.S.; Choi, Y.; Lee, Y.; Lee, S.S. Dose–Response Effects of Bamboo Leaves on Rumen Methane Production, Fermentation Characteristics, and Microbial Abundance In Vitro. Animals 2022, 12, 2222. https://doi.org/10.3390/ani12172222

AMA Style

Jo SU, Lee SJ, Kim HS, Eom JS, Choi Y, Lee Y, Lee SS. Dose–Response Effects of Bamboo Leaves on Rumen Methane Production, Fermentation Characteristics, and Microbial Abundance In Vitro. Animals. 2022; 12(17):2222. https://doi.org/10.3390/ani12172222

Chicago/Turabian Style

Jo, Seong Uk, Shin Ja Lee, Hyun Sang Kim, Jun Sik Eom, Youyoung Choi, Yookyung Lee, and Sung Sill Lee. 2022. "Dose–Response Effects of Bamboo Leaves on Rumen Methane Production, Fermentation Characteristics, and Microbial Abundance In Vitro" Animals 12, no. 17: 2222. https://doi.org/10.3390/ani12172222

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop