ISSN: 0973-7510
E-ISSN: 2581-690X
, Vinod Joshi1 , Annette Angel1, Bennet Angel1, Vikram Singh Chauhan2, Shareef Mohammed Buvvaji1, Poorna Khaneja1, Ambreen Shafaat Khan1, Shilpa Barthwal1, Neha Singh1, Bhawna Sharma1, Ramesh Joshi3, Monika Dheer1, Khushbu Kumari1, Aarya Chitransh1 and Reshu Chauhan1Hepatitis C virus infection is one of the main causes of liver disease that can lead to liver cirrhosis and finally to the chronic development of Hepatocellular Carcinoma (HCC). With 8 different HCV genotypes circulating, it becomes necessary to characterize the pathogenesis caused by each one of the HCV genotypes infecting population of a particular setting. Present study aims to identify the circulating Hepatitis C virus (HCV) genotypes in the different areas of State of Uttar Pradesh, India and understand their clinical etiology and related co-morbidities. The patients reporting to Sharda Hospital, Uttar Pradesh, India who were diagnosed positive for HCV were included in the study. The informed consent was obtained and then blood was drawn. In-house primers, for all the 8 genotypes were prepared and RT-PCR was performed. The amplified product was subjected to Agarose gel electrophoresis to identify the genotypes present in individual samples. Total 30 serum samples were taken. Of these, 21 (70%) showed presence of multiple genotypes, while 7 (23.33%) showed positivity for single genotype and two did not show any bands. Presence of multiple genotypes in individual patient has been reported for the first time. The pathological consequences of multiple genotypes within one host need to be studied further in terms of increased risk of developing a chronic liver disease. Further studies are being undertaken to study association of specific HCV genotype and multiple genotypes, Core, NS3 and NS5 viral proteins with the disease progression to develop predictors of liver cirrhosis and HCC.
Genotypes, Hepatitis C virus, Hepatocellular carcinoma, India
The Hepatitis C virus (HCV) infection is increasing in different regions of the world at the rate of 58 million infections per year and has become one of the main reasons of mortality due to liver infections.1-7 Every year almost 6-12.5 million people in India get infected due to the HCV infection.8 Out of this, around 27% are reported cases of cirrhosis and 25% of patients are reported cases of Hepatocellular Carcinoma (HCC).9 There is inflammation of the liver initially and then the patients eventually end up with the development of chronic liver cirrhosis, i.e. scarring of the whole liver and other complications related to it. Studies have reported that it takes almost sixteen years to develop fibrosis after acquiring HCV infection.10 It was found that the rate of fibrosis was less below the age 30 and higher in older patients.10 Only few patients are able to eliminate the virus during the initial stage, however the chances that virus may still remain active in the infected cells is also there. Till date, eight types of HCV genotypes have been reported which when sequenced showed 30% difference.11 The main genotypes reported are HCV genotype 1 and HCV genotype 3 followed by Genotype 2, 4 and 6.12-16 The other HCV genotypes 5 and 7 are also reported but are limited to certain geographical regions.16 Recently, Genotype 8 has been identified from Punjab, India in the year 2018.12
Though the different genotypes have been reported, yet the possibility of multiple types in an individual patient has not been much reported. One study has indicated 2-10% presence of multiple infections of HCV genotypes.17 The present study has been undertaken to study the occurrence of multiple genotypes and then correlate it with the clinical symptoms to address to the severity of this disease.
The patients who were referred to Sharda Hospital with liver inflammation during the period of March 2022 to July 2023 were taken for the study. Once the Ab-HCV positivity was confirmed in their blood samples, the blood was brought to the laboratory under strict biosafety protocol and then serum was separated and stored at -80°C until further experimentation. The consent for the study was taken both orally/verbally from each individual patient and for patients with older age admitted in ICU, the consent was taken by thumb impression. The serum was then subjected to viral RNA extraction employing the QIAamp viral RNA mini kit (m/s Qiagen, CA) following the manufactures instructions. The RNA was then subjected for amplification using the One step RT-PCR kit (m/s Ambion, USA). For the amplification, In-house primers were designed for all the eight genotypes. These were then commercially synthesized by m/s Eurofins, India. The cycling conditions are as follows: Reverse transcription at 55oC for 30 minutes, Primer Annealing and extension of 50 cycles, each of 95oC for 15 seconds, 95oC for 35 seconds, 50oC for 60 seconds. The final extension at 72oC for 30 seconds. The PCR products were then run on 2% agarose gel, and then observed in Gel Documentation System.
Table 1 shows the primers designed in-house (Centre of Excellence in Virology & Immunology, Sharda University, U.P., India) for all the eight genotypes. The NCBI was searched for the reference HCV genomes for all the 8 genotypes. The following were selected: For Genotype 1: NC_004102.1, for Genotype 2: NC_009823.1, for Genotype 3: NC_009824.1, for Genotype 4: NC_009825.1, for Genotype 5: NC_009826.1, for Genotype 6: NC_009827.1, for Genotype 7: NC_030791.1 and for Genotype 8 – MH590698.1. Using the NCBI primer designing software, the region of 7400-7600 bp which encodes for NS5 protein was selected.
Table (1):
Showing the In-house primer designing of different HCV genotypes
| HCV genotypes | Primer type | Sequences 5’ to 3’ | Expected size (in bp) |
|---|---|---|---|
| Genotype 1 | Forward primers | CAGCACACGACATCTTCCGT | 184 |
| Reverse primers | GCATTACGGGCGACAATACG | ||
| Genotype 2 | Forward primers | GTTGGGGCTCTACCTGCTC | 161 |
| Reverse primers | CGATTCAGGCCTTTCCAC | ||
| Genotype 3 | Forward primers | TGTCACTAACGGTGGACCAA | 249 |
| Reverse primers | TTCAGCTGGACGGCTCTAAT | ||
| Genotype 4 | Forward primers | GGCAGCTTTGATTCTTCAGC | 178 |
| Reverse primers | CCGATGACGGATCTTATTCG | ||
| Genotype 5 | Forward primers | AGAGCAAGGGGTGATGAGC | 156 or 1212 |
| Reverse primers | GACGCGGCTTCATATTCTTC | ||
| Genotype 6 | Forward primers | AACAGTGGACCAGGAACCAG | 199 |
| Reverse primers | GGCTGATAAGGTGTTTGTGGA | ||
| Genotype 7 | Forward primers | TCTGGTGCTGACTGTTGACC | 153 |
| Reverse primers | TCCGCCATTAGTCTGGATTC | ||
| Genotype 8 | Forward primers | CCATGAGCCAGAGTCCAAGT | 175 |
| Reverse primers | GTCTTTTCCCCCATCATCTG |
A total of 30 HCV positive samples were collected during the period. The amplified template when run on Agarose Gel Electrophoresis indicated presence of multiple bands in 70% (21 patients) of the patients. (Table 2). While only 7 (23.33%) showed positivity for single genotype. There were 2 which did not show any bands. The gel images are shown in the Figures 1 to 4.
Table (2):
Analysis of the Genotyping present in the HCV patients
No. |
Sample code |
HCV G1 |
HCV G2 |
HCV G3 |
HCV G4 |
HCV G5 |
HCV G6 |
HCV G7 |
HCV G8 |
Total Genotypes observed |
|---|---|---|---|---|---|---|---|---|---|---|
1. |
ACVI/06/01 |
√ |
√ |
√ |
3 |
|||||
2. |
ACVI/07/02 |
√ |
√ |
√ |
3 |
|||||
3. |
ACVI/11/03 |
√ |
√ |
√ |
3 |
|||||
4. |
ACVI/12/04 |
√ |
√ |
2 |
||||||
5. |
ACVI/18/05 |
√ |
1 |
|||||||
6. |
ACVI/20/06 |
– |
√ |
– |
– |
– |
– |
– |
– |
1 |
7. |
ACVI/21/07 |
√ |
√ |
2 |
||||||
8. |
ACVI/22/08 |
√ |
1 |
|||||||
9. |
ACVI/23/09 |
√ |
√ |
√ |
3 |
|||||
10. |
ACVI/24/10 |
√ |
1 |
|||||||
11. |
ACVI/25/11 |
√ |
√ |
√ |
3 |
|||||
12. |
ACVI/27/12 |
√ |
√ |
2 |
||||||
13. |
ACVI/28/13 |
√ |
√ |
2 |
||||||
14. |
ACVI/36/14 |
√ |
√ |
2 |
||||||
15. |
ACVI/42/15 |
√ |
√ |
2 |
||||||
16. |
ACVI/44/16 |
√ |
√ |
√ |
√ |
4 |
||||
17. |
ACVI/51/17 |
√ |
√ |
2 |
||||||
18. |
ACVI/58/18 |
√ |
√ |
√ |
3 |
|||||
19. |
ACVI/62/19 |
√ |
√ |
2 |
||||||
20. |
ACVI/80/20 |
√ |
√ |
2 |
||||||
21. |
ACVI/81/21 |
√ |
1 |
|||||||
22. |
ACVI/82/22 |
√ |
1 |
|||||||
23. |
ACVI/83/23 |
√ |
√ |
2 |
||||||
24. |
ACVI/88/24 |
– |
– |
– |
– |
– |
– |
– |
– |
0 |
25. |
ACVI/89/25 |
– |
– |
– |
– |
– |
– |
– |
– |
0 |
26. |
ACVI/100/26 |
√ |
1 |
|||||||
27. |
ACVI/105/27 |
√ |
√ |
2 |
||||||
28. |
ACVI/107/28 |
√ |
√ |
2 |
||||||
29. |
ACVI/108/29 |
√ |
√ |
2 |
||||||
30. |
ACVI/109/30 |
√ |
√ |
2 |
Figure 1. Agarose Gel showing bands for HCV patient ACVI/21/07 (Bands visible in G2, G4)
Figure 2. Agarose Gel showing bands for HCV patient ACVI/06/01 (Bands visible in G2, G3 and G5)
Figure 3. Agarose Gel showing bands for HCV patient ACVI/28/13 (Bands visible in G4 and G6)
Figure 4. Agarose Gel showing bands for HCV patient ACVI/22/08 (Bands visible in G4)
The clinical symptoms presented by these HCV patients infected with multiple genotypes were compared with those with individual genotypes (Table 3). It was observed that 33.33% (7) of the patients with multiple genotypes had Grade I fatty liver compared to presence of only 1 such case in single genotype infected patients. Hepatomegaly 19.04% (4), Splenomegaly 9.52, abdominal pain 9.52% (2) and Liver cirrhosis 4.76% (1) was also observed in multiple genotype infected HCV patients compared to single genotype infected HCV patients (Hepatomegaly 0, Splenomegaly 1, abdominal pain 1 and Liver cirrhosis 1 case respectively.) Two cases each of Blood transfusion were seen in both the categories while one case of Intravenous drug use was observed in patients with multiple genotypes. Other complications observed in patients with multiple genotype infection were Pleural effusion, Transaminitis, Renal calculi, angina pectoris, Pyrexia, Diabetes, Uterus cyst, Steatosis, and alcohol intake (Table 3).
Table (3):
Clinical conditions of HCV infected patients taken for the study
No. |
Patient Code |
Age |
F/M |
Complaints/Symptoms |
|---|---|---|---|---|
1. |
ACVI/06/01 |
50 |
M |
Not identified |
2. |
ACVI/07/02 |
53 |
F |
Grade I fatty liver, right hepatic simple cyst, palpitation |
3. |
ACVI/11/03 |
60 |
F |
Grade I fatty liver |
4. |
ACVI/12/04 |
51 |
M |
Liver cirrhosis, alcoholic, Jaundice, mouth bleeding |
5. |
ACVI/18/05 |
72 |
M |
Liver inflammation, alcoholic, smoker, bloating after meals, burning sensation on urination, vomiting after meals, renal problems, lower back pain, pain during micturition |
6. |
ACVI/20/06 |
75 |
F |
Hepatitis C related chronic liver disease with ascites and splenomegaly, umbilical hernia, severe anemia, dyspnea, abdominal pain |
7. |
ACVI/21/07 |
50 |
F |
Abdominal pain, Joint pain, lower back pain, Tobacco use |
8. |
ACVI/22/08 |
55 |
M |
Pyrexia, dyspnea, Alcoholic, allergic symptoms |
9. |
ACVI/23/09 |
55 |
M |
Swollen neck, Grade I prostatomegaly |
10. |
ACVI/24/10 |
32 |
F |
Low BP, typhoid, back pain, body aches, weakness, heart palpitations after eating, fatigue |
11. |
ACVI/25/11 |
51 |
M |
Grade I fatty liver with hepatomegaly, splenomegaly, B/L pleural effusion |
12. |
ACVI/27/12 |
45 |
F |
Grade I fatty liver, mild hepatomegaly, Radiating pain, Abdominal pain, nausea after meals, intestinal infection |
13. |
ACVI/28/13 |
30 |
F |
Loss of appetite, Blood transfusion case, skin allergy, anxiety, chronic diarrhea |
14. |
ACVI/36/14 |
40 |
M |
Abdominal pain, Alcohol use, shooting pain on right side, Beer on daily basis |
15. |
ACVI/42/15 |
40 |
M |
Grade I fatty liver, Bloating, fatigue, loose motions |
16. |
ACVI/44/16 |
30 |
M |
Transaminitis |
17. |
ACVI/51/17 |
45 |
M |
Liver related problems, constipation, foot swelling, Hookah use, Bidi use |
18. |
ACVI/58/18 |
64 |
M |
Alcohol use, bloating, B/L renal calculi, angina pectoris, BPH |
19. |
ACVI/62/19 |
65 |
F |
Grade I fatty liver, loss of appetite, bloating, insomnia |
20. |
ACVI/80/20 |
37 |
M |
Past case |
21. |
ACVI/81/21 |
50 |
M |
Fatty liver Grade I, Abdominal pain, Headache, Head lump, dizziness, High BP, HTN, Cholesterol |
22. |
ACVI/82/22 |
30 |
F |
Blood transfusion case, Thyroid, Hysterectomy |
23. |
ACVI/83/23 |
40 |
M |
Accidental Case (23 yrs. ago), Bed sores with continuous bleeding, Pyrexia |
24. |
ACVI/88/24 |
42 |
F |
Diabetes, BP patient, Cholesterol, Abdominal pain, liver inflammation, chills at night with fever, Dizziness |
25. |
ACVI/89/25 |
52 |
F |
Uterus Cyst, bleeding from past 2 1//2 months, Back pain, Fatigue, Bloating, Hookah use, Blur vision |
26. |
ACVI/100/26 |
33 |
F |
Blood transfusion, Abdominal pain because of gallstones |
27. |
ACVI/105/27 |
35 |
M |
Abdominal pain, indigestion, Bloating, loose motions after meals, Steatosis, Pain upon micturition |
28. |
ACVI/107/28 |
35 |
M |
Subacute intestinal obstruction, Hepatomegaly, Splenomegaly, Bidi use, Alcoholic, Abdominal pain, Bloating, Intravenous drug user |
29. |
ACVI/108/29 |
47 |
M |
Dyspnea, Pyrexia, Bidi use, Alcohol, Blood transfusion, cystectomy |
30. |
ACVI/109/30 |
45 |
F |
Grade I fatty liver with borderline hepatomegaly, Fever, Joint pain, Bloating, Shoulder pain |
Hepatitis C viral infection is now considered a cause of serious global concern due to the rise in the liver related morbidity and mortality.18-20 The serious complications arise in the form of cirrhosis followed by carcinoma of the liver, then liver failure and finally death.21 With the increase in the advancement of the disease, 8 different genotypes have been identified.12 Since the virus is a blood borne disease, hence chances of varied genotype infections are possible.22-24 However, this has not been explored fully in case of Hepatitis C virus, as observed in another member of the Flavivirus family i.e. Dengue virus.25 There have been some studies in the past wherein technique to detect multiple genotypes and subtype have been attempted but many limitations have been found.11
The present study has been conducted to identify the presence of multiple genotypes in patients infected with HCV infection in a cohort of population of Uttar Pradesh, India. The study indicated that there are chances that multiple genotypic HCV infection can occur and that patients with severity of disease, tend to have multiple genotypic infection of HCV virus. This can be justified by the fact that Grade I fatty liver was observed to be more in patients with multiple genotypes as indicated in our studies. A study done by Wu and co-workers have found presence of Genotype 3 and correlating with presence of fatty liver.26 Another study has reported Genotype 3 present in patient with steatosis condition.27
To conclude, we hereby report occurrence of multiple genotypes in HCV infected patients and also association of a specific genotype with the disease severity. The presence of more than one genotypes with close proteomic similarities could lead to poor adaptive immune responses against specific HCV proteins. Further studies are in progress to address crucial issue of translation of HCV into HCC.
ACKNOWLEDGMENTS
None.
CONFLICT OF INTEREST
The authors declare that there is no conflicts of interest.
AUTHORS’ CONTRIBUTION
All authors listed have made a substantial, direct, and intellectual contribution to the work, and approved it for publication.
FUNDING
This study was funded by the Indian Council of Medical Research, New Delhi, India (Grant ID number: 2020-2521).
DATA AVAILABILITY
All datasets generated or analyzed during this study are included in the manuscript.
ETHICS STATEMENT
This study was approved by the Institutional Ethical Committee, Sharda University, India (File No. SU/SMS&R/76-A/2021/40 dated 11/02/2021).
INFORMED CONSENT
Written informed consent was obtained from the participants before enrolling in the study.
- Hanafiah KM, Groeger J, Flaxman AD, Wiersma ST. Global epidemiology of hepatitis C virus Infection:new estimates of age-specific antibody to HCV seroprevalence. Hepatology. 2013;57(4):1333-1342.
Crossref - Shepard CW, Finelli L, Alter MJ. Global epidemiology of hepatitis C virus infection. Lancet Infect Dis. 2005;5(9):558-567.
Crossref - Global surveillance and control of hepatitis C. Report of a WHO consultation organized in collaboration with the Viral Hepatitis Prevention Board, Antwerp, Belgium. J Viral Hepat. 1999;6(1):35-47.
Crossref - Wasley A, Alter MJ. Epidemiology of hepatitis C:geographic differences and temporal trends. Semin Liver Dis. 2000;20(1):1-16.
Crossref - Sy T, Jamal MM. Epidemiology of hepatitis C virus (HCV) infection. Int J Med Sci. 2006;3(2):41-46.
Crossref - Alter MJ. Epidemiology of hepatitis C virus infection. World J Gastroenterol. 2007;13(17):2436-2441.
Crossref - Yen T, Keeffe EB, Ahmed A. The epidemiology of hepatitis C virus infection. J Clin Gastroenterol. 2003;36(1):47-45.
Crossref - Chattopadhyay S. Hepatitis C. A major health problem of India. Curr Sci. 2002;83:9. https://www.currentscience.ac.in/Volumes/83/09/1058.pdf
- Roudot-Thoraval F. Epidemiology of hepatitis C virus infection. Clin Res Hepatol Gastroenterol. 2021;45(3):101596.
Crossref - Hissar SS, Kumar M, Tyagi P, et al. Natural history of hepatic fibrosis progression in chronic hepatitis C virus infection in India. J Gastroenterol Hepatol. 2009;24(4):581-587.
Crossref - Fernandez-Caso B, Fernandez-Caballero JA, Chueca N, et al. Infection with multiple hepatitis C virus genotypes detected using commercial tests should be confirmed using next generation sequencing. Sci Rep. 2019;9(1):9264.
Crossref - Borgia SM, Hedskog C, Parhy B, et al. Identification of a Novel Hepatitis C Virus Genotype from Punjab, India:Expanding Classification of Hepatitis C Virus Into 8 Genotypes. J Infect Dis. 2018;218(11):1722-1729.
Crossref - Raghuraman S, Shaji RV, Sridharan G, et al. Distribution of the different genotypes of HCV among patients attending a tertiary care hospital in South India. J Clin Virol. 2003;26(1):61-69.
Crossref - Rockstroh J, Grint D, Bosecke C. Increase in acute hepatitis C virus (HCV) incidence across Europe: which region and patient groups are affected? J Int AIDS Soc. 2012;15(S4):18116.
Crossref - Afridi SQ, Zahid MN, Shabbir MZ, et al. Prevalence of HCV genotypes in district Mardan. Virol J. 2013;10:10-90.
Crossref - Messina JP, Humphreys I, Flaxman A, et al. Global distribution and prevalence of hepatitis C virus genotypes. Hepatology. 2015;61(1):77-87.
Crossref - Balwi MA. Prevalence of mixed hepatitis C virus (HCV) genotypes among recently diagnosed dialysis patients with HCV infection. Saudi J Kidney Dis Transpl. 2011;22(4):712-716.
- Satsangi S, Chawla YK. Viral hepatitis:Indian scenario. Med J Armed Forces India. 2016;72(3):204-210.
Crossref - Sievert W, Altraif I, Razavi HA, et al. A systematic review of hepatitis C virus epidemiology in Asia, Australia and Egypt. Liver Int. 2011;31(suppl 2):61-80.
Crossref - Cooke GS, Lemoine M, Thursz M, et al. Viral hepatitis and the Global Burden of Disease:a need to regroup. J Viral Hepat. 2013;20(9):600-601.
Crossref - Lauer GM, Walker BD. Hepatitis C virus infection. N Engl J Med. 2001;345(1):41-52.
Crossref - Shahanas SM, Verma R, Kumar K, et al. A Study on the Prevalence of HCV Genotypes and the Effect of Direct-Acting Antiviral Therapy on Clinical and Laboratory Parameters in HCV-Infected Patients at a Tertiary Care Center in North India. Ind J Comm Med. 2024;49(1):203-208.
Crossref - Gower E, Estes C, Blach S, et al. Global epidemiology and genotype distribution of the hepatitis C virus infection. J Hepatol. 2014;61(Suppl 1):S45-57.
Crossref - Gadhia PK, Patel M, Daryani K, Vaniawala S. Prevalence of HCV and Its Correlation with HCV Genotypes. Eur J Med Hlth Sc. 2021;3(4):133-136.
Crossref - Angel B, Angel A, Joshi V. Multiple dengue virus types harbored by individual mosquitoes. Acta Trop. 2015;150:107-110.
Crossref - Wu YJ, Chen LS, Qiang WG. Effects of fatty liver and related factors on the efficacy of combination antiviral therapy in patients with chronic hepatitis C. Liver Int. 2006;26(2):166-172.
Crossref - Yoon EJ, Hu KQ. Hepatitis C Virus (HCV) Infection and Hepatic Steatosis. Int J Med Sci. 2006;3(2):53-56. doi:10.7150/ijms.3.53.
Crossref
© The Author(s) 2024. Open Access. This article is distributed under the terms of the Creative Commons Attribution 4.0 International License which permits unrestricted use, sharing, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.