https://orcid.org/0000-0003-0569-8105
Figures
Abstract
The tripartite motif (TRIM) protein family is the largest subfamily of E3 ubiquitin ligases, playing a crucial role in the antiviral process. In this study, we found that TRIM72, a member of the TRIM protein family, was increased in neuronal cells and mouse brains following rabies lyssavirus (RABV) infection. Over-expression of TRIM72 significantly reduced the viral titer of RABV in neuronal cells and mitigated the pathogenicity of RABV in mice. Furthermore, we found that TRIM72 over-expression effectively prevents the assembly and/or release of RABV. In terms of the mechanism, TRIM72 promotes the K48-linked ubiquitination of RABV Matrix protein (M), leading to the degradation of M through the proteasome pathway. TRIM72 directly interacts with M and the interaction sites were identified and confirmed through TRIM72-M interaction model construction and mutation analysis. Further investigation revealed that the degradation of M induced by TRIM72 was attributed to TRIM72’s promotion of ubiquitination at site K195 in M. Importantly, the K195 site was found to be partially conserved among lyssavirus’s M proteins, and TRIM72 over-expression induced the degradation of these lyssavirus M proteins. In summary, our study has uncovered a TRIM family protein, TRIM72, that can restrict lyssavirus replication by degrading M, and we have identified a novel ubiquitination site (K195) in lyssavirus M.
Author summary
Rabies, caused by lyssaviruses, most often by rabies virus, the most lethal zoonotic disease, is responsible for approximately 59000 human deaths globally each year. Lyssavirus M protein displays an essential role in lyssavirus assembly and budding. Here, we found that TRIM family protein TRIM72 directly interacts with lyssavirus M thereby promoting the K48-linked ubiquitination of M, leading to the degradation of M through the proteasome pathway, restricting lyssavirus assembly and/or release. Moreover, we identified a novel important ubiquitination site (K195) in lyssavirus M. Prior to our study, there had been no reports of a direct interaction between TRIM72 and viral proteins, an antiviral function of TRIM72 was proved in our study. TRIM72 may interact and ubiquitinate other viral proteins from various viruses, which warrants further investigation. This research contributes to our understanding of how TRIM72 and other TRIM proteins play a role in defending against viral invasions and may inspire further research in this field.
Citation: Sui B, Zheng J, Fu Z, Zhao L, Zhou M (2024) TRIM72 restricts lyssavirus infection by inducing K48-linked ubiquitination and proteasome degradation of the matrix protein. PLoS Pathog 20(2): e1011718. https://doi.org/10.1371/journal.ppat.1011718
Editor: Ricardo Rajsbaum, Rutgers New Jersey Medical School, UNITED STATES
Received: September 29, 2023; Accepted: February 19, 2024; Published: February 26, 2024
Copyright: © 2024 Sui et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Data Availability: All relevant data are within the manuscript and its Supporting Information files.
Funding: This study was supported by the National Natural Science Foundation of China (grant number 32102648 to B.K.S.), the Fundamental Research Funds for the Central Universities (grant number 2662023PY005 to L.Z.), the National Key Research and Development Program of China (grant number 2022YFD1800100 to M.Z.), the China Postdoctoral Science Foundation (grant number BX2021109 to B.K.S., grant number 2021M691170 to B.K.S.). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: The authors have declared that no competing interests exist.
Introduction
Lyssavirus, a genus of the family Rhabdoviridae, is a single-stranded negative-sense RNA virus that encodes five viral proteins: nucleoprotein (N), phosphoprotein (P), matrix protein (M), glycoprotein (G) and large RNA polymerase protein (L). The lyssavirus genus is currently composed of 17 viral species [1], typical lyssavirus species include Rabies lyssavirus (RABV), Australian bat lyssavirus (ABLV), Duvenhage lyssavirus (DUVV), European bat lyssavirus (EBLV), Lagos bat lyssavirus (LBV) and Mokola lyssavirus (MOKV), etc [2, 3]. Among those lyssaviruses, RABV is the most well-known lyssavirus and is responsible for causing rabies, resulting in approximately 59000 human deaths globally each year [4–6]. The RABV M plays a pivotal role in various aspects of the virus’s life cycle, including virus assembly/budding [7], and regulation of the balance between virus transcription and replication [8]. Moreover, RABV M also plays an important role in inhibiting the NF-κB pathway activation [9].
Post-translational modifications (PTMs) of proteins, which involve to the addition or removal of covalent functional groups, play a crucial role in regulating protein structure, localization and activity [10]. Common PTMs include phosphorylation, acetylation, ubiquitination, methylation, glycosylation, etc [11]. Ubiquitination is an essential PTM process that covalently conjugates single or multiple ubiquitin molecules to one or more lysine residues of a substrate protein [12]. This process is catalyzed by three types of enzymes: ubiquitin-activating enzymes (E1), ubiquitin-conjugating enzymes (E2) and ubiquitin-protein ligases (E3) [13]. The ubiquitin-proteasome system plays a crucial role in degrading abnormal proteins and short-lived proteins within cells to maintain normal biochemical processes; it consists of ubiquitin, three types of ubiquitin-associated enzymes (E1, E2 and E3) and the proteasome [14].
More than 600 E3 ligases have been characterized and are classified into 3 different classes: homologous to E6-AP carboxyl terminus (HECT), really interesting new gene (RING) and RING-between RING (RBR) [15]. RING proteins are the largest class of E3 ligases and among them the tripartite motif (TRIM) family of proteins was the largest subfamily of RINGs. TRIM proteins are involved in many biological processes, including transcriptional regulation, cell proliferation and differentiation, apoptosis, DNA damage repair, intracellular signal transduction and immune response, etc [16, 17]. TRIM proteins are characterized by the presence of an N-terminal tripartite or RBBC motif comprised of a RING domain, either one or two B-boxes (B1 and B2) and a coiled-coil (CC) domain, followed by a highly variable C-terminal domain [18, 19]. The C-terminal variable functional region of the TRIM protein plays a crucial role in substrate recognition thereby conferring functional specificity, the PRY-SPRY domain is the most common C-terminal domain among known TRIM proteins [20, 21].
As a member of the TRIM protein family, TRIM72 (also known as MG53) is a RING-mediated E3 ubiquitin ligase that consists of five domains: the RING domain, B-box domain, coiled-coil domain, PRY domain and SPRY domain [22]. The RING domain contains the E3 ubiquitin ligase activity responsible for mediating the ubiquitination of numerous proteins. For instance, TRIM72 directly interacts with Ras-related C3 botulinum toxin substrate 1 (RAC1) through its coiled-coil domain and suppresses RAC1 activity by catalyzing the Lys48 (K48)-linked polyubiquitination of RAC1 at Lys5 residue in HCC cells [23]; Additionally, TRIM72 induces ubiquitination of insulin receptor substrate 1 (IRS-1) with the assistant of an E2-conjugating enzyme UBE2H [24, 25]. The B-box domain, a zinc ion binding domain, plays a critical role in TRIM activity. A previous study has demonstrated that the B-box domain also regulates the interaction between TRIM72 and FAK8 [24]. The conserved coiled-coil domain of TRIM72 is critical for TRIM72 homodimerization [26]. Furthermore, the PRY-SPRY domain was shown to bind with Orai1 and regulate extracellular Ca2+ entry [27]. Consequently, TRIM72 is a multifunctional protein involved in various biochemical processes within cells. Our previous study revealed that TRIM25 can restrict RABV replication, indicating that proteins in the TRIM family play an important role in RABV infection [28]. Recently, a study demonstrated that TRIM72 could protect mice from lethal influenza virus infection [29], indicating its potential antiviral function. However, the relationship between TRIM72 and the lyssaviruses remains unclear.
In this present study, we present the major discovery that RABV infection induces the up-regulation of TRIM72 in neuronal cells and mouse brains. Over-expression of TRIM72 restricts the release of RABV in neuronal cells and reduces the pathogenicity of RABV in mice. We have determined that TRIM72 induces the degradation of RABV-M through the proteasome pathway. Our functional domain truncation analysis of TRIM72 indicates that the TRIM72-SPRY domain interacts with RABV-M. Furthermore, through the construction of a TRIM72-SPRY-M interaction model and mutation analysis, we have confirmed that TRIM72 ubiquitinates a specific site, K195, in M, thereby leading to its degradation. Significantly, we found that the K195 ubiquitination site is partially conserved among lyssavirus, and TRIM72 interacts with lyssavirus M proteins, ultimately resulting in the degradation of lyssavirus M proteins. Consequently, our study reveals a previously unrecognized TRIM72-ubiquitination-proteosome-mediated antiviral response and identified a novel ubiquitination site (K195) in lyssavirus M proteins.
Results
RABV infection induces TRIM72 up-regulation in mouse brains and neuronal cells
To determine the relationship between RABV and TRIM72, we assessed the TRIM72 level in RABV-infected mouse brains and neuronal cells. For the in vivo experiments, 8-week-old C57 BL/6 mice were infected with 100 fluorescence focus units (FFU) RABV (CVS-B2c strain) via intranasal infection. As a negative control (Mock), the same volume of DMEM was treated. Brains were collected on the 12th day post-infection. The mRNA level and protein level of TRIM72 were analyzed by qPCR and western blotting respectively. The mRNA level and protein level of TRIM72 were dramatically increased in RABV-infected mouse brains compared to the control group (Fig 1A and 1B). For the in vitro experiments, primary neuron cells were isolated and cultured, and then the neuron cells were infected with RABV at varying multiplicities of infection (MOI) for 36 hours (h) and the mRNA level and protein level of TRIM72 were analyzed by qPCR and western blotting. As shown in Fig 1C and 1D, the mRNA and protein levels of TRIM72 were gradually increased along with the RABV infection dose increased. Then mRNA level and protein level of TRIM72 were also analyzed in N2a cells (mouse neuroblastoma cell line) and SK-N-SH cells (human neuroblastoma cell line). As shown in Figs 1E, 1F, S1A and S1B, the mRNA level and protein level of TRIM72 or human TRIM72 (hTRIM72) gradually increased along with the RABV infection dose increased in N2a cells or SK-N-SH cells. These results indicate that RABV infection induces the up-regulation of TRIM72 in both mouse and neuronal cells.
(A-B) 8-week-old female C57 BL/6 mice were intranasally infected with 100 fluorescence focus units (FFU) RABV (CVS-B2c) or mock-infected. The mouse brains were collected at 12th d post-infection, the mRNA level of TRIM72 was analyzed by qPCR (A), and the protein levels of TRIM72 and RABV-N were analyzed by western blotting with anti-TRIM72 antibody and anti-RABV-N antibody (B). (C-D) Primary mouse neuron cells were isolated and cultured, then infected with RABV at different MOI for 36 h. The mRNA level of TRIM72 was analyzed by qPCR (C), and the protein levels of TRIM72 and RABV-N were analyzed by western blotting with anti-TRIM72 antibody and anti-RABV-N antibody (D). (E-F) N2a cells were infected with RABV at different MOI for 36 h. The mRNA level of TRIM72 was analyzed by qPCR (E), and the protein levels of TRIM72 and RABV-N were analyzed by western blotting with anti-TRIM72 antibody and anti-RABV-N antibody (F). (G) Empty vector (pCAGGS) or TRIM72-flag over-expression vector (pCA-Trim72-flag) were transfected into N2a cells respectively for 48 h, and then the TRIM72-flag level was analyzed by western blotting with anti-flag antibody. (H) Trim72-/- N2a cells were constructed, then the TRIM72 level was analyzed in WT and Trim72-/- N2a cells by western blotting with an anti-TRIM72 antibody. (I) Empty vector or TRIM72-flag over-expression vectors were transfected into N2a cells respectively for 12 h, then infected with RABV (MOI = 0.01) for the indicated time, and the viral titers in the supernatant were analyzed. (J) WT and Trim72-/- N2a cells were infected with RABV (MOI = 0.01) for the indicated time respectively, and the viral titers in the supernatant were analyzed. (K) WT and Trim72-/- N2a cells were transfected with empty vector or TRIM72-flag over-expression vectors for 12 h, then infected with RABV (MOI = 0.01) for 48 h and the viral titers in the supernatant were analyzed. (L) Trim72 and Trim72(-) were inserted into the genome of a recombinant RABV (rRABV), named rRABV-TRIM72 and rRABV-TRIM72(-) respectively. (M) N2a cells were infected with different types of rRABVs (MOI = 3) for 36 h, then the TRIM72 level was analyzed by western blotting with an anti-TRIM72 antibody. (N) N2a cells were infected with different types of rRABVs (MOI = 0.01) and their growth kinetics were compared. Statistical analysis of grouped comparisons was carried out by student’s t-test (*P < 0.05; **P<0.01; ***P<0.001; ****P<0.0001). The bar graph represents means ± SD, n = 3. Western blot data are representative of at least two independent experiments.
TRIM72 suppresses RABV replication in neuronal cells
To further investigate the relationship between TRIM72 and RABV, over-expression plasmids of TRIM72-flag and TRIM72 knockout N2a cell line (Trim72-/-) were constructed. We then transfected the TRIM72 over-expression vector into N2a cells for 48 h, and the TRIM72-flag overexpression level was analyzed by western blotting and indirect immunofluorescence. In comparison to the empty vector group, the TRIM72 level was dramatically increased in the TRIM72 over-expression group (Figs 1G and S1C). To confirm the deficiency of TRIM72 in TRIM72-/- N2a cells, the TRIM72 expression level was also analyzed by comparing the expression of TRIM72 between WT and TRIM72-/- N2a cells by western blotting. No TRIM72 protein expression was detected in TRIM72-/- N2a cells (Fig 1H), indicating that TRIM72 is well knocked out in the constructed TRIM72-/- N2a cells. In addition, no effect on cell viability was observed after over-expressing or knocking out TRIM72 (S1D and S1E Fig). Next, an empty vector or TRIM72 over-expression vector was transfected into N2a cells for 12 h and then infected the cells with RABV (MOI = 0.01). The supernatants of RABV-infected cells were collected at 24 h and 48 h post-infection, then viral titers were analyzed. From the results we can see RABV titer was dramatically decreased post TRIM72 over-expression no matter at 24 h or 48 h post-infection (Fig 1I). Moreover, to find out the proper expression level of exogenous TRIM72 that matches the endogenous expression level of TRIM72 during viral infection, a dose-dependent TRIM72 expression experiment was carried out by transfecting different concentrations of TRIM72 expressing vectors (0.25 μg, 0.5 μg, 0.75 μg, and 1.0 μg) into N2a cell, and the expression levels of TRIM72 was determined to compare with the expression level of TRIM72 during RABV infection. It was found that the TRIM72 expression level in N2a cells transfected with 0.5 μg of TRIM72 expressing vector presents a comparable level of TRIM72 in RABV infected N2a cells at 48 h post-infection (S1F Fig). Meanwhile, a dose-dependent viral inhibition study was also carried out by transfecting different concentrations of TRIM72 into N2a cells, and the viral titers were then determined to assess the inhibitory effect on RABV infection by different expression levels of TRIM72. As shown in S1G Fig, a significant decrease of viral titer was observed in N2a cells transfected with 0.5 μg of TRIM72 expressing vector, which is determined as a comparable expression level of TRIM72 with that during RABV infection. To analyze the effect of Trim72 deficiency on RABV replication in N2a cells, WT N2a cells and Trim72-/- N2a cells were infected with RABV (MOI = 0.01) respectively, and the cell supernatants were collected at 24 h and 48 h post-infection and viral titers were analyzed. From the results, we can see that RABV titer dramatically increased in the Trim72-/- group compared with the WT group both at 24 h and 48 h post-infection (Fig 1J). Furthermore, the impact of TRIM72 deficiency on RABV was abolished by over-expression of TRIM72 (Fig 1K). Moreover, we found that human TRIM72 (hTRIM72) over-expression dramatically reduced the RABV titer in SK-N-SH cells (S1H and S1I Fig). To further analyze the function of TRIM72 in restricting RABV, the recombinant RABVs (rRABVs) were constructed. The recombinant viruses were derived from the CVS-B2c strain, including unaltered rRABV, rRABV harboring TRIM72 coding sequence (rRABV-Trim72) and rRABV harboring the TRIM72 sequence which ATG mutation to CTG (rRABV-Trim72(-)) (Fig 1L). N2a cells were infected with those rRABVs (MOI = 3) for 36 h, then the TRIM72 expression level was analyzed by western blotting. As expected, the TRIM72 protein level was extremely higher in rRABV-TRIM72 infected N2a cells than in rRABV or rRABV-TRIM72(-) infected cells (Fig 1M). Subsequently, virus growth kinetics experiments were performed in N2a cells, and N2a cells were infected with the rRABVs (MOI = 0.01) separately, the supernatants were collected at the indicated time points post rRABVs infection for analysis of virus titers. The virus titer was significantly lower in the rRABV-TRIM72 infected cells than in rRABV- and rRABV-TRIM72(-)-infected cells (Fig 1N). Above all, over-expression of TRIM72 reduced the viral titer of RABV in neuronal cells.
TRIM72 reduces RABV pathogenicity in vivo
To investigate the role of TRIM72 in RABV infection in vivo, the pathogenicity of rRABV, rRABV-Trim72 and rRABV-Trim72(-) in the C57 BL/6 mouse model was compared. Mice were infected intranasally with rRABV, rRABV-Trim72, or rRABV-Trim72(-) at a dose of 100 FFU/mouse. Then the body weight, clinical score and survival were monitored. The body weight of the mice infected with rRABV or rRABV-Trim72(-) decreased dramatically from day 7 to day 13 post-infection (p.i.), whereas the body weight of those mice infected with rRABV-Trim72 showed a slight decrease from day 13 to day 17 p.i. (Fig 2A). The rabies clinical symptoms of rRABV- or rRABV-Trim72(-) -infected mice were appeared from day 6 to day 13, whereas the mice infected with rRABV-TRIM72 display mild symptoms from day 11 to day 17 (Fig 2B). Finally, 80% of the mice infected with rRABV-Trim72 survived, and only 10% and 20% survival ratio for rRABV- and rRABV-Trim72(-) -infected mice, respectively (Fig 2C).
(A-C) Female C57 BL/6 mice (8-week-old, n = 10) were intranasally infected with 100 FFU rRABV, rRABV-Trim72, rRABV-Trim72(-), or were mock-infected. Body weight change (A), clinical score (B), and survival ratio (C) were monitored daily for continuous 3 weeks. (means ± SEM; ***P<0.001; ***P<0.0001; body weight change and the clinical score were analyzed by Two-way ANOVA test; survival ratio was analyzed by log-rank test). (D-H) At indicated time points, different brain parts of the infected mice were collected to analyze the levels of RABV N mRNA by qPCR. (n = 5; means ± SEM; *P < 0.05; **P<0.01; ***P<0.001; ***P<0.0001 by student’s Two-way ANOVA test). (I) At the 12th day post-infection, mouse brains were collected, sectioned, and analyzed by immunohistochemistry using antibodies against RABV P. Scale bar, 100 μm. IHC data are representative of three sections.
To analyze the viral loads in the brains of mice infected with rRABV, rRABV-Trim72 and rRABV-Trim72(-), the RABV viral N mRNA levels were analyzed in different brain parts followed by intranasal viral infection (100 FFU/mouse). On day 6, day 9 and day12 p.i., the brains infected with different viruses were collected and divided into 5 parts (Cerebrum, Thalamus, Midbrain, Cerebellum and Brainstem), then the N mRNA levels in different brain parts were analyzed by qPCR. Dramatically reduced RABV N mRNA levels in rRABV-Trim72-infected different mice brain parts were presented compared with rRABV- or rRABV-Trim72(-)-infected mouse brains at day 9 and day 12 p.i. (Fig 2D–2H). Then the immunohistochemistry assay was performed by using an anti-RABV-P antibody to analyze the RABV protein level in different brain parts post virus infection for 12 days. Almost no RABV-P antigen was observed in rRABV-Trim72 infected brain parts, whereas comparable levels of RABV-P antigen have been observed in rRABV- or rRABV-Trim72(-)-infected mice brain parts (Fig 2I). Above all, over-expression of TRIM72 dramatically reduced the pathogenicity of RABV in mice.
TRIM72 restricts RABV assembly and/or release
Our results demonstrate that TRIM72 inhibits RABV in vitro and in vivo, while the mechanism remains unclear. TRIM proteins play essential roles in various biological processes, especially in innate immune response [30]. Thus the effect of TRIM72 on type I interferon (IFN) system was initially analyzed. As shown in S2A–S2E Fig, the mRNA levels of IFN-β and some important ISGs such as ISG15 or IFIT1/2/3 were decreased post TRIM72-flag over-expression during RABV infection. Reversely, the mRNA levels of IFN-β, ISG15 or IFIT1/2/3 were increased in Trim72-/- N2a cells during RABV infection (S2F–S2J Fig). Furthermore, the restriction effect of TRIM72 on RABV was analyzed in Vero cell which is defective in the interferon synthesis system [31, 32]. As shown in S2K Fig, TRIM72-flag over-expression in Vero cells reduces the viral titer. Moreover, the virus growth kinetics experiments were performed in Vero cells, and Vero cells were infected with the rRABVs (MOI = 0.01) separately, the supernatants were collected at the indicated time points post rRABVs infection for analysis of virus titers. The virus titer was significantly lower in the rRABV-TRIM72 infected cells than in rRABV- and rRABV-TRIM72(-) infected cells (S2L Fig). Above all, these results indicate that TRIM72 plays a negative control on the type I IFN system and the IFN system is not the major mechanism for the restriction effect of TRIM72 on the viral titer of RABV.
Therefore, the effects of TRIM72 over-expression on the different stages of the RABV life cycle were analyzed. First, the TRIM72-flag over-expression vector or an empty vector was individually transfected into N2a cells for 36 h and then the cells were infected with RABV (MOI = 0.1) for 1 h at 4°C, the cells were collected and the viral genomic RNA (vRNA) level was analyzed by qPCR to evaluate the effect of TRIM72 on RABV attachment. As shown in Fig 3A, there is no obvious difference in viral genomic RNA levels between the control group and the TRIM72-flag over-expression group, indicating that TRIM72 did not affect RABV attachment. Next, the effect of TRIM72 over-expression on RABV entry was analyzed, TRIM72-flag over-expression vector or empty vector was individually transfected into N2a cells for 36 h and then infected with RABV (MOI = 0.1) for 2 h at 37°C, the cells were collected and the vRNA levels were analyzed by qPCR. There is no obvious difference in vRNA levels between the control group and the TRIM72 over-expression group (Fig 3B), indicating that TRIM72 did not affect RABV entry. Then TRIM72-flag over-expression vector or empty vector was individually transfected into N2a cells for 12 h and then RABV was infected (MOI = 0.01), the cells were collected at 24 h and 48 h post-infection, and the RABV N mRNA level and vRNA level were analyzed by qPCR. As shown in Fig 3C and 3D, there is almost no difference in RABV N mRNA level and vRNA level between the TRIM72 over-expression group and the empty vector group. These results indicate that TRIM72 over-expression does not affect RABV transcription and replication. Then virus-spreading assay was performed to analyze the impact of TRIM72 on RABV spreading between cells. N2a cells were infected with rRABV, rRABV-Trim72, or rRABV-Trim72(-) individually (MOI = 0.001), then the cell culture medium containing 1% agar was added to cover the N2a cells for 48 h. Fluorescence in isothiocyanate (FITC)-conjugated anti-RABV-P protein antibody (FITC-P) was stained post removed from the cell culture medium and the fluorescence plaque was analyzed. There is almost no difference in the size of fluorescence plaque and the number of infected cells in these N2a cells (Fig 3E and 3F), indicating that TRIM72 does not affect RABV spreading between cells.
(A) TRIM72-flag over-expression vector or empty vector were transfected into N2a cells respectively for 36 h, then infected with RABV (MOI = 0.1) for 1 h at 4°C, the cells were collected and the viral genomic RNA (vRNA) levels were analyzed by qPCR. (B) TRIM72-flag over-expression vector or empty vector was transfected into N2a cells individually for 36 h then infected with RABV (MOI = 0.1) for 2 h at 37°C, the cells were collected and the vRNA levels were analyzed by qPCR. (C-D) TRIM72-flag over-expression vector or empty vector were transfected into N2a cells individually for 12 h and then infected with RABV (MOI = 0.01) for the indicated time points, the cells were collected and the levels of RABV-N-mRNA (D) and vRNA (E) were analyzed by qPCR. (E-F) N2a cells were infected with rRABV, rRABV-Trim72, or rRABV-Trim72(-) at MOI 0.001. Then the cells were covered with culture medium containing 1% agar and incubated for 48 h. The viral spread was compared and the infected cell numbers were calculated within the fluorescence focus. Scale bar, 100 μm. (G) pCAGGS or pCA-Trim72-myc together with pCA-M-HA and pCA-G-flag were co-transfected into HEK-293T cells respectively for 48 h, and the protein levels of M-HA and G-flag in the supernatants and cells were analyzed by western blotting. Western blot data are representative of at least two independent experiments.
Our results clearly show that TRIM72 over-expression dramatically reduced the RABV titer in N2a cells (Figs 1I and S1I). However, TRIM72 over-expression almost does not affect RABV attachment, entry, transcription, replication and spreading in N2a cells. Therefore, we hypothesized that TRIM72 might affect RABV assembly and/or release. To investigate the hypothesis, a virus-like particle (VLP) system was constructed as previously reported to analyze the effect of TRIM72 over-expression on RABV assembly and/or release [33, 34]. TRIM72-myc over-expression vector or empty vector together with RABV-M-HA and RABV glycoprotein (G)-flag overexpression vectors were co-transfected into 293T cells for 48 h and the VLP production in the supernatants was analyzed using western blotting. As shown in Fig 3G, the protein levels of M and G in the supernatants were dramatically decreased post-TRIM72 over-expression compared to the control group, indicating that TRIM72 restricts VLP production. As our speculation, these results confirm our hypothesis that TRIM72 over-expression restricts RABV assembly and/or release.
TRIM72 induces proteasomal degradation of RABV-M by promoting its K48-linked ubiquitination
Our results revealed that TRIM72 restricts RABV assembly and/or release. However, an interesting observation was the significant decrease in M protein levels following TRIM72 over-expression (Fig 3G). Given that TRIM72 is an E3 ubiquitin ligase, we speculated that its inhibitory effect on RABV may be responsible for its E3 ubiquitin ligase function, leading to the degradation of the viral proteins. To explore this hypothesis, over-expression vectors of RABV viral proteins (N, P, M, G), together with TRIM72-myc expression vector or an empty vector, were individually co-transfected into N2a cells for 48 h, the cells were collected and the viral protein levels were analyzed by western blotting. As shown in Fig 4A, the protein levels of RABV-N, -P, or -G-flag almost have no changes following TRIM72-myc over-expression. In contrast, the protein level of RABV-M-HA was dramatically decreased in the TRIM72-myc over-expression group compared to the empty vector group. Furthermore, RABV-M level was analyzed post TRIM72 overexpression during high MOI RABV infection. As shown in Fig 4B, the RABV-M level was reduced during TRIM72 overexpression, while no obvious change in RABV-N level was observed post TRIM72 overexpression. These results indicate that TRIM72 specifically induces the degradation of RABV-M. We also found that hTRIM72 can induce the degradation of RABV-M in SK-N-SH cells (S3A Fig), indicating the conserved function of TRIM72 in degrading RABV-M. Furthermore, proteasome inhibitor Mg132 and lysosome inhibitor NH4Cl were used individually in N2a cells to elucidate the degradation pathway of M induced by TRIM72. As shown in Fig 4C, TRIM72 over-expression induces the degradation of M even after NH4Cl treatment, whereas the degradation was interrupted following Mg132 treatment. Then a dose-dependent assay was performed, and the M protein level was gradually decreased along with increasing TRIM72 level (Fig 4D). However, the degradation was impeded after Mg132 treatment (Fig 4E). These findings indicate that TRIM72 induces RABV-M degradation through the proteasome pathway.
(A) pCAGGS or pCA-Trim72-myc together with pCA-N, pCA-P, pCA-M-HA, and pCA-G-flag were co-transfected into N2a cells respectively for 48 h, and the protein levels of N, P, M-HA and G-flag were analyzed by western blotting. (B) pCAGGS or pCA-Trim72-flag were transfected into N2a cells for 12 h, then infected with RABV (MOI = 1) for 36h and RABV-N and RABV-M protein levels were analyzed by western blotting. (C) pCAGGS or pCA-Trim72-flag together with pCA-M-HA were co-transfected into N2a cells respectively. The specific inhibitors for proteasome and lysosome, Mg132 (10 μM) and NH4Cl (5 mM) were applied. Then the protein levels of TRIM72 and M were analyzed by western blotting. (D) pCA-M-HA together with pCAGGS or different concentrations of pCA-Trim72-flag were co-transfected into N2a cells for 48 h. Then the protein levels of TRIM72-flag and M-HA were analyzed by western blotting. (E) pCA-M-HA together with pCAGGS or different concentrations of pCA-Trim72-flag were co-transfected into N2a cells. Then Mg132 (10 μM) was applied and the protein levels of TRIM72-flag and M-HA were analyzed by western blotting. (F) pCA-M-HA together with pCAGGS, pCA-Trim72-flag, or Trim72-ΔRING-flag were co-transfected into N2a cells respectively for 48 h, then M-HA level was analyzed by western blotting. (G) pCAGGS or pCA-Trim72-myc together with pCA-M-flag and UB-HA over-expression vectors were co-transfected into N2a cells respectively. Then treated with Mg132 and Co-IP assays were performed with anti-flag antibody. The protein levels of TRIM72-myc, M-flag, and UB-HA were analyzed by western blotting. (H) pCAGGS or pCA-Trim72-flag were transfected into N2a cells respectively. Then infected with RABV (MOI = 1) for 36 h and treated with Mg132 and Co-IP assays were performed with anti-M antibody. The protein levels of TRIM72-flag, M, and UB were analyzed by western blotting. (I) pCAGGS or pCA-Trim72-myc together with pCA-M-flag and UB-K48-HA over-expression vectors were co-transfected into N2a cells respectively. Then treated with Mg132 and Co-IP assays were performed with anti-flag antibody post transfection for 48 h. Then the protein levels of TRIM72-myc, M-flag, and UB-K48-HA were analyzed by western blotting. (J) pCAGGS or pCA-Trim72-myc together with pCA-M-flag and UB-K63-HA over-expression vectors were co-transfected into N2a cells respectively. Then treated with Mg132 and Co-IP assays were performed with anti-flag antibody. The protein levels of TRIM72-myc, M-flag, and UB-K63-HA were analyzed by western blotting. Western blot data are representative of at least two independent experiments.
We then speculated that TRIM72-induced degradation of M via the proteasome pathway was due to its E3 ubiquitin ligase function which promotes M ubiquitination. The RING domain is essential for TRIM72 to promote the ubiquitination of the target proteins [25]. Thus, TRIM72, a RING domain deficient TRIM72 (TRIM72-ΔRING) together with M were co-overexpressed in N2a cells for 48 h and the M level was analyzed by western blotting. As shown in Fig 4F, WT TRIM72 over-expression induces M degradation, whereas TRIM72ΔRING over-expression failed to induce M degradation. The phosphorylation of the S255 site in TRIM72 has been demonstrated as a prerequisite for TRIM72 E3 ligase activity [35]. Then we mutated the Serine at 255 site of TRIM72 to Alanine to analyze whether the effect of TRIM72 on RABV M degradation was dependent on its E3 ligase activity. As shown in S3B Fig, the degradation of RABV-M induced by TRIM72 was abolished with the introduction of the S255A mutation. Moreover, the restriction effect of TRIM72 on RABV was also abolished with the S255A mutation (S3C Fig). These results indicate that TRIM72 induces M degradation depending on its RING domain and E3 ligase activity. We then examined the effect of TRIM72 on the ubiquitination of M. The ubiquitination level of M was dramatically increased following TRIM72 over-expression in the presence of Mg132 (Fig 4G), indicating that TRIM72 promotes the ubiquitination of M. We then tested the effect of TRIM72 on the ubiquitination level of RABV-M during RABV infection. N2a cells were transfected with empty vectors or TRIM72-flag expressing vectors for 12 h and then infected with RABV (MOI = 1) for 36 h. The endogenous Co-IP was then performed with an anti-M antibody. As shown in Fig 4H, the ubiquitination level of RABV-M was higher in the TRIM72 over-expression group compared with the empty vector group (Fig 4H). K48- and K63-linked polyubiquitin chains are the two major types of ubiquitin linkages [36], then we further characterized which type of ubiquitination of M was modified by TRIM72. TRIM72 over-expression plasmids and M over-expression plasmids together with either K48- or K63- ubiquitin over-expression plasmids were co-transfected into N2a cells for 48 h respectively, then ubiquitination assays were performed. As shown in Fig 4I and 4J, TRIM72 specifically promotes the K48-linked ubiquitination of M, while almost does not affect the K63-linked ubiquitination of M. Overall, TRIM72 promotes K48-linked ubiquitination of M, consequently facilitating M degradation via the proteasome pathway.
The SPRY domain of TRIM72 directly interacts with RABV-M
Our above results demonstrate that TRIM72 promotes the K48-linked ubiquitination of RABV-M, thus we speculated that TRIM72 might interact with RABV-M directly. Consequently, Co-Immunoprecipitation (Co-IP) assays were performed to investigate this interaction, as shown in Figs 5A–5C, S4A and S4B, both murine TRIM72 and hTRIM72 were found to interact directly with M no matter under over-expression condition or RABV infection condition. For further analysis of the interaction between TRIM72 and RABV-M, different TRIM72 truncation over-expression vectors were designed and constructed based on its functional domain (Fig 5D). These vectors together with M over-expression vectors were co-overexpressed in N2a cells for 48 h and Co-IP assays were performed. As shown in Fig 5E, the TRIM72 truncations which contain the SPRY domain could interact with M, indicating that the TRIM72-SPRY domain directly interacts with M. Additionally, different M truncation over-expression vectors were also constructed based on its secondary structure (Fig 5F). Co-IP assays were performed between M truncations and TRIM72-SPRY domain. As shown in Fig 5G, All the M truncations including 49–160 aa were capable of interacting with the TRIM72-SPRY domain, while the M truncation with 49–160 aa deletion (i.e. 1–48 and 161–202) cannot interact with the TRIM72-SPRY domain, indicating that M truncation (49–160 aa) was the key interaction domain that interacts with the TRIM72-SPRY domain.
(A) pCAGGS or pCA-Trim72-flag together with pCA-M-HA were co-transfected into N2a cells respectively. Then Mg132 (10 μM) was treated, and Co-IP assays were performed with anti-flag antibody post-transfection for 48 h. The protein levels of TRIM72-flag and M-HA were analyzed by western blotting. (B) pCAGGS or pCA-M-flag together with pCA-Trim72-HA were co-transfected into N2a cells respectively for 48 h. Then Co-IP assays were performed with anti-flag antibody. The protein levels of TRIM72-flag and M-HA were analyzed by western blotting. (C) N2a cells were infected with RABV (MOI = 1) for 36 h. Then Co-IP assays were performed with anti-TRIM72 antibody. The protein levels of TRIM72 and M were analyzed by western blotting. (D) TRIM72 truncations were designed and constructed based on its functional domain. (E) The over-expression vectors of TRIM72-flag truncations together with pCA-M-HA were co-transfected into N2a cells respectively for 48 h. Then Co-IP assays were performed with anti-flag antibody. The protein levels of TRIM72 truncations and M-HA were analyzed by western blotting. (F) RABV-M truncations were designed and constructed based on its secondary structure. (G) The over-expression vectors of M-HA truncations together with pCA-Trim72-SPRY-flag were co-transfected into N2a cells for 48 h. Then Co-IP assays were performed with anti-HA antibody. The protein levels of M truncations and SPRY-flag were analyzed by western blotting. (H) A structural model of RABV-M was built using SWISS-MODEL online software (https://swissmodel.expasy.org/interactive) based on the crystal structure of Lagos bat virus M protein (PDB code: 2W2S). (I) An interaction model of the human TRIM72-SPRY domain and RABV-M was built with GalaxyWEB online software (https://galaxy.seoklab.org/) based on hTRIM72 structure (PDB code: 6NPY), the potential interaction sites were labeled. (J) Over-expression vectors of RABV-M-HA mutations together with TRIM72-SPRY-flag over-expression vector were co-transfected into N2a cells respectively for 48 h. Then Co-IP assays were performed with anti-HA antibody. The protein levels were analyzed by western blotting. (K) The protein sequences of SPRY domain between hTRIM72 and mouse TRIM72 were compared and analyzed with ESPript 3.0 online software (https://espript.ibcp.fr/ESPript/cgi-bin/ESPript.cgi). (L) Over-expression vectors of TRIM72-SPRY-flag mutations together with M-HA over-expression vectors were co-transfected into N2a cells respectively for 48 h. Then Co-IP assays were performed with anti-flag antibody and protein levels were analyzed by western blotting. (M) Over-expression vectors of TRIM72-flag mutations together with M-HA over-expression vector were co-transfected into N2a cells respectively for 48 h. The protein levels were analyzed by western blotting. (N) Over-expression vectors of TRIM72-flag mutations or empty vectors were transfected into N2a cells respectively for 12 h, then infected with rRABV (MOI = 0.01) for 48 h and the viral titers in the supernatants were analyzed. Statistical analysis of grouped comparisons was carried out by student’s t-test (*P < 0.05; **P<0.01; ***P<0.001; ****P<0.0001). The bar graph represents means ± SD, n = 3. Western blot data are representative of at least two independent experiments.
We then attempted to construct an M-TRIM72-SPRY interaction model to analyze the specific interaction sites. Since there was no available structure model for RABV-M, thus we built a RABV-M model based on the Lagos bat virus M protein structure with SWISS-MODEL online software. The RABV-M model is shown in Fig 5H. A previous study has reported the hTRIM72 crystal structure, allowing us to employ it as the model for building the M-TRIM72-SPRY interaction model using GalaxyWEB online software. The M-TRIM72-SPRY interaction model is shown in Fig 5I, and the potential interaction sites between M and TRIM72-SPRY were analyzed and presented. We found that the residues R404, D421 and VP436-437 of hTRIM72-SPRY could interact with the residues K60, PN64-65, M110, DT147-148 and Q154 of M respectively. The potential interaction residues were then validated by mutation and Co-IP assays. As shown in Fig 5J, the protein level of SPRY that was pulled down by mutated M (PN64-65AA, M110A, DT147-148AA and Q154A) was dramatically decreased compared to that of WT M. Since the amino acid sequence homology between hTRIM72-SPRY and murine TRIM72-SPRY reached 84.3% (Fig 5K). Therefore, the corresponding interaction residues of the murine TRIM72-SPRY domain were mutated and Co-IP experiments were performed to determine the changes in binding between the mutated murine TRIM72-SPRY and M. As shown in Fig 5L, the M protein level pulled down by mutated TRIM72-SPRY (R404A, D421A and VP436-437AA) dramatically reduced compared to that of WT TRIM72-SPRY. In conclusion, these results strongly support the reliability of the key interaction sites between M and TRIM72-SPRY as analyzed by the predicted M-TRIM72-SPRY interaction model. Specifically, residues PN64-65, M110, DT147-148 and Q154 on M, as well as R404, D421, and VP436-437 on TRIM72-SPRY, have been identified as critical for the interaction between TRIM72-SPRY and M.
Furthermore, we sought to analyze whether these interaction site mutations in TRIM72-SPRY disrupted the function of TRIM72 in M degradation, then the over-expression vectors of full-length TRIM72 mutations (R404A, D421A and VP436-437AA) were constructed and together with M over-expression vector were co-transfected into N2a cells for 48 h. Then the M levels were analyzed by western blotting. Interestingly, the protein level of M was comparable in the TRIM72 mutated group compared to the empty vector group, while the M level decreased significantly following WT TRIM72 over-expression (Fig 5M). Moreover, the antiviral function of TRIM72 mutations was also analyzed. The over-expression vectors of WT full-length TRIM72 or mutations were transfected into N2a cells for 12 h and then infected with RABV (MOI = 0.01) for 48h, the virus titers in the cell culture supernatant were measured. As shown in Fig 5N, the antiviral function of TRIM72 was impaired following R404, D421 and VP436-437 mutation in TRIM72 compared to the WT TRIM72 group.
TRIM72 promotes the ubiquitination of RABV-M at the K195 site
To identify the specific lysine site in M that is ubiquitinated by TRIM72, the lysine in M was mutated respectively (Fig 6A). The over-expression vectors of M which lysine (K) mutated to alanine (A) were constructed and together with TRIM72 were co-overexpressed in N2a cells for 48 h respectively, then western blots were performed and the protein level of mutated M was analyzed. As shown in Fig 6B, only the M-K195A mutant abolished the degradation of M which was induced by TRIM72, indicating that the K195 is a potential lysine residue targeted by TRIM72 for M ubiquitination. Subsequently, the stability of WT M and M-K195A were compared when individually over-expressed in N2a cells for 48 h, the M level was analyzed by western blot. As shown in Fig 6C, The M-K195A protein level was higher than that of WT M, indicating that M-K195A was much more stable than WT M. Then we examined the ubiquitination level of WT M and M-K195A which was induced by TRIM72. Empty vector or TRIM72 over-expression vector together with ubiquitin and WT M or M-K195A were co-overexpressed in N2a cells for 48 h and then the ubiquitination level of WT M and M-K195A was analyzed. As shown in Fig 6D, WT M presents a decreased ubiquitination level in TRIM72 over-expression group compared with the empty vector group, and M-K195A presents a comparable ubiquitination level between the vector group and TRIM72 over-expression group. Moreover, the ubiquitination level of M-K195A was lower compared with WT M. These results demonstrated that the K195A mutation abolished the enhanced ubiquitination level induced by TRIM72. These results strongly indicate that the K195 site is a critical ubiquitination target for M, mediated by TRIM72.
(A) Illustration of the lysine (K) sites in RABV-M. (B) The lysine residues in RABV-M were mutated to alanine and over-expression vectors were constructed and together with pCAGGS or pCA-Trim72-flag were co-transfected into N2a cells respectively for 48 h. The protein levels of M-HA mutations and TRIM72-flag were analyzed by western blotting. (C) WT M-HA or M-K195A-HA was over-expressed in N2a cells respectively for 48 h, and the protein level was analyzed by western blotting. (D) pCA-M-flag or pCA-M-K195A-flag together with UB-HA and pCAGGS or pCA-Trim72-myc were co-transfected into N2a cells and treated with Mg132 (10 μM), then Co-IP assays were performed with anti-flag antibody. The protein levels were analyzed by western blotting. (E) pCAGGS or pCA-Trim72-myc together with pCA-M-K195A-HA and pCA-G-flag were co-transfected into HEK-293T cells respectively for 48 h, the protein levels of M-K195A-HA and G-flag in the supernatants and cells were analyzed by western blotting. (F) Schematic diagram of the recombinant rRABV-M-K195A. (G) N2a cells were infected with rRABV or rRABV-M-K195A (MOI = 0.01) for the indicated time and their growth kinetics were compared. (H) pCAGGS or pCA-Trim72-flag was transfected into N2a cells respectively for 12 h, then infected with WT rRABV (MOI = 0.01) or rRABV-M-K195A (MOI = 0.01) for 48 h. The supernatants were collected and viral titers were analyzed. Statistical analysis of grouped comparisons was carried out by student’s t-test (*P < 0.05; **P<0.01; ***P<0.001; ****P<0.0001). The bar graph represents means ± SD, n = 3. Western blot data are representative of at least two independent experiments.
To further investigate the impact of the M-K195A mutation on the effect of TRIM72 on RABV assembly and release, the VLP production assay was performed. TRIM72 or empty vector together with M-K195A and RABV G were co-overexpressed in 293T cells for 48 h and the VLP production in the supernatants was analyzed by western blotting. As shown in Fig 6E, the protein levels of M-K195A and G in the supernatants were comparable between the TRIM72 over-expression group and the control group, indicating that TRIM72 lost its ability to restrict the VLP production following M-K195 site mutation. Moreover, A M-K195A mutant RABV (rRABV-M-K195A) was constructed (Fig 6F), and virus growth kinetics experiments were performed in N2a cells. Briefly, N2a cells were infected with rRABV or rRABV-M-K195A (MOI = 0.01), and the supernatants were collected at the indicated time points post rRABVs infection for virus titration. The virus titers were significantly higher in the rRABV-M-K195A-infected cells than in rRABV-infected cells at all tested time points (Fig 6G). Then the restriction effect of TRIM72 on rRABV-M-K195A was analyzed. N2a cells were transfected with either a vector or TRIM72 over-expression vector for 12 h and then infected with rRABV or rRABV-M-K195A (MOI = 0.01). The supernatants were collected and viral titers were analyzed at 48 h post-infection. As shown in Fig 6H, TRIM72 over-expression reduced the viral titer of rRABV, while there were almost no obvious changes in viral titers between the vector group and the TRIM72 over-expression group during rRABV-M-K195A infection. These results indicate that TRIM72 restricts RABV assembly and release by promoting the ubiquitination of M at the 195 site, thereby promoting the degradation of the M protein.
TRIM72 targeting the K195 site is partially conserved among lyssavirus M
RABV is a member of lyssaviruses, the M proteins display a high homology among lyssaviruses (S5 Fig). Therefore, we speculated that TRIM72 might also induce the degradation of other lyssavirus M proteins. Our results demonstrate that TRIM72 promotes CVS-M-K195 ubiquitination thereby promoting the degradation of CVS-M protein. Then the K195 site was analyzed among the M proteins of those lyssaviruses. As shown in S5 Fig, the K195 site was partially conserved among those lyssavirus M proteins, such as dog-derived RABV M (named DRV-M), ABLV-M (At the 205 site in ABLV-M), DUVV-M and EBLV-M, while the 195 site was the E instead of K in LBV-M or MOKV-M. Firstly, we tested the effect of TRIM72 on DRV-M, the DRV-M together with TRIM72 or empty vector were co-overexpressed in N2a cells for 48 h, and then western-blot was performed to analyze the DRV-M protein level. As shown in Fig 7A, the DRV-M protein level decreased significantly following TRIM72 over-expression, indicating that TRIM72 induce the degradation of DRV-M. The other M proteins containing the K195 site of these lyssaviruses were also tested including ABLV-M, DUVV-M and EBLV-M. As shown in Fig 7B–7D, similar results were observed, where the protein levels of ABLV-M, DUVV-M and EBLV-M were dramatically reduced following TRIM72 overexpression, indicating that TRIM72 induced the degradation of those lyssavirus M proteins. Importantly, treatment with Mg132, a proteasome inhibitor, could reverse the degradation of lyssavirus M proteins induced by TRIM72 over-expression (Fig 7E–7H). Moreover, the results of Co-IP assays demonstrated that DRV-M, ABLV-M, DUVV-M and EBLV-M could also interact with TRIM72 (Fig 7E–7H). However, when we tested the effect of TRIM72 on LBV-M and MOKV-M, we found that although TRIM72 could interact with LBV-M or MOKV-M, TRIM72 did not induce the degradation of LBV-M or MOKV-M (S6A and S6B Fig).
(A-D) HA-tagged lyssavirus M proteins (DRV-M-HA, ABLV-M-HA, DUVV-M-HA and EBLV-M-HA) together with empty vector or TRIM72-flag were co-overexpressed in N2a cells for 48 h, then protein levels of DRV-M-HA (A), ABLV-M-HA (B), DUVV-M-HA (C) and EBLV-M-HA (D) were analyzed by western blotting. (E-H) HA-tagged lyssavirus M proteins (DRV-M-HA, ABLV-M-HA, DUVV-M-HA, and EBLV-M-HA) together with empty vector or TRIM72-flag were co-overexpressed in N2a cells respectively, followed by treatment with Mg132 (10 μM). Co-IP assays were performed with anti-flag antibody post-transfection for 48 h, and protein levels of DRV-M-HA (E), ABLV-M-HA (F), DUVV-M-HA (G), and EBLV-M-HA (H) were analyzed by western blotting. (I-L) The K195 sites (K205 site in ABLV-M) in lyssavirus M proteins were mutated to Alanine, then together with empty vector or TRIM72-flag were co-overexpressed in N2a cells for 48 h. The protein levels of DRV-M-K195A-HA (I), ABLV-M-K205A-HA (J), DUVV-M-K195A-HA (K), and EBLV-M-K195A-HA (L) were analyzed by western blotting. Western blot data are representative of at least two independent experiments.
Then the K195 (or at the 205 site in ABLV-M) sites of these lyssaviruses’ M proteins were mutated to Alanine. The mutated M proteins were co-overexpressed with TRIM72 or empty vector in N2a cells for 48 h, and the levels of mutated M proteins were analyzed by western blot. As shown in Fig 7I–7L, the levels of mutated M proteins were comparable between the TRIM72 over-expression group and the vector group, indicating that the mutation of the K195 (At the 205 site in ABLV-M) in lyssavirus M proteins impedes the degradation induced by TRIM72. When we mutate the 195 site in LBV-M or MOKV-M from E to K, TRIM72 can induce the degradation of LBV-M-E195K or MOKV-M-E195K (S6C and S6D Fig). Overall, the K195 (or at 205 site in ABLV-M) ubiquitination sites were partially conserved among lyssavirus M proteins and were essential for the degradation induced by TRIM72.
Discussion
The TRIM protein family is a large family consisting of more than 80 members, and TRIM proteins play important roles in innate and adaptive immune responses to defend against viral invasions [30]. Moreover, TRIM proteins can directly target viral proteins, leading to the degradation or functional inhibition of these viral proteins, thereby disturbing the viral lifecycle [30]. In this study, we have provided evidence demonstrating that TRIM72 restricts the release of lyssavirus by inducing the degradation of lyssavirus M protein in neuronal cells. First, we found that TRIM72 was up-regulated following lyssavirus infection in neuronal cells and mouse brains. Subsequently, we identified a direct interaction between TRIM72 and lyssavirus M, leading to the promotion of K48-linked ubiquitination of lyssavirus M at the K195 site, thereby facilitating lyssavirus M degradation via proteasome pathway, effectively restricting the assembly and/or release of lyssavirus (Fig 8). Further study has revealed that the K195 site within M protein is partially conserved among lyssavirus M proteins. Importantly, these M proteins of lyssavirus that contain the conserved K195 site can be effectively degraded by TRIM72. This study is the first report demonstrating that lyssavirus M proteins undergo ubiquitination and degradation through the TRIM72-dependent proteasomal pathway.
TRIM72 plays an important role in membrane damage repair [37], and serves a protective role in many tissues, including neurons, heart, liver, kidney and muscle [38–43]. A previous study has indicated that TRIM72 attenuated LPS-induced neurotoxicity and neuroinflammation by inhibiting TLR4/NF-κB pathway both in vitro and in vivo [44]. A recent study has revealed that TRIM72 reduces muscle inflammation by promoting the inactivation of NLRP3 inflammasome [45]. Additionally, several studies have found a connection between TRIM72 and the influenza virus, demonstrating that TRIM72 protects mice from lethal influenza virus infection by suppressing interferon-β and inflammation [29, 46]. However. Until our study, there had been no reports of a direct interaction between TRIM72 and viral proteins. Our study here reveals a direct interaction between TRIM72 and lyssavirus M protein. Moreover, the interaction between TRIM72 and lyssavirus M promotes the degradation of lyssavirus M via a K48-linked ubiquitination modification in M at the K195 site. Recent studies have shown that TRIM72 is a potential E3-ligase enzyme [24, 25], and our findings in this study provide significant evidence to support this conclusion, confirming TRIM72 as an E3-ligase enzyme.
Ubiquitination is an important post-translational modification (PTM) that plays a key role in a wide range of cellular biological processes, including signal transduction [47], immune response [48], cancer [49], metabolism [50], etc. With a deeper understanding of ubiquitination, multiple forms of ubiquitination have been revealed, including K6-, K11-, K27-, K29-, K33-, K48- and K63-linked polyubiquitinations [51, 52]. Among the numerous polyubiquitination types, K48-linked polyubiquitination and K63-linked polyubiquitination have been the most extensively studied, multiple studies have proved that K48-linked polyubiquitination induces the degradation of target proteins and K63-linked polyubiquitination regulates the activation of target proteins [36, 51, 53]. K48-linked polyubiquitinations, which mediate proteasomal degradation, are the most abundant connection between ubiquitin proteins in cells [54]. The K48-linked polyubiquitination, responsible for the degradation of target proteins, plays essential roles in numerous biological processes, whether involving host or viral proteins. TRIM21, an interferon-inducible E3 ligase, has been shown to induce K48-linked ubiquitination and subsequent degradation of DDX41, thereby negatively regulating the innate immune response [55]. A most recent report has demonstrated that TRIM21 also restricts influenza A virus replication via a K48-linked degradation of the influenza A virus M1 protein [56]. These reports indicate that TRIM proteins could modulate the degradation of both host and viral proteins. TRIM72 has previously been reported to induce the K48-linked ubiquitination and degradation of FAK while regulating skeletal myogenesis [24]. However, there had been no prior reports of an association between TRIM72 and viral protein. In this study, we have demonstrated that TRIM72 directly interacts with lyssavirus-M and promotes K48-linked polyubiquitination at the lyssavirus-M K195 site, thereby promoting the degradation of lyssavirus M via the proteasome.
Lyssavirus M is the most abundant and smallest protein within the lyssavirus virion [57]. Lyssavirus M plays an essential role in the lyssavirus life cycle, with its primary functions encompassing viral assembly/budding and the regulation of the balance between transcription and replication [7, 8]. As a multiple-functional protein, lyssavirus M is involved in numerous biological processes during lyssavirus infection. M displays different functions via direct or indirect interaction with different host proteins and several important functions have been identified including defense host immune response, induce apoptosis and regulate lyssavirus replication [58]. NF-κB pathway is essential for defense against viral infection, and antiviral cytokines are produced once NF-κB is activated during virus infection. With this context, RelAp43, a member of the NF-κB pathway, has been found to participate in the innate immune response against lyssavirus infection [59]. Recent studies have revealed that lyssavirus M disturbs the NF-κB pathway by interacting with RelAp43 [9, 60]. Additionally, lyssavirus M was also found to interact with Jak1 and cooperate with lyssavirus P to modulate the Jak-Stat pathway, thereby restricting the expression of interferon-stimulated genes (ISGs) [61]. Lyssavirus induces apoptosis in neuronal cells during infection [62], and lyssavirus M contributes to this process via interacting with Cco1, ultimately decreasing the viability of Cco1, thereby disrupting the mitochondrial morphology and inducing apoptosis [63]. Furthermore, lyssavirus M facilitates its replication via interacting with host proteins, a recent study has shown that M interacts with ATP6V1A to promote lyssavirus uncoating [34].
TRIM proteins display an essential role in defending against virus invasion, while viruses also evolved functions to hijack the host ubiquitin system to facilitate their life cycle at different stages, including virus entry, virus replication, virus assembly and budding [64]. For example, TRIM7 induces K63-linked polyubiquitination on the E protein of Zika virus (ZIKV), the ubiquitination enhances ZIKV entry into cells via direct interaction with TIM1 a host cell receptor [65]. TRIM6 ubiquitinates the K309 site in the VP35 protein of Ebola virus (EBOV) and the ubiquitination facilitates the polymerase cofactor activity thereby enhancing the replication of EBOV [66]. Previous studies have shown that the ubiquitination of lyssavirus M which is regulated by the host is essential for lyssavirus budding [67, 68]. However, there are fewer reports on E3 ligases involved in lyssavirus M ubiquitination except for NEDD4 which is a membrane-localized ubiquitin ligase containing multiple WW domains that interact with the PPxY domain in the M protein of RABV [68]. Although the interaction sites between M and TRIM72-SPRY were conserved among lyssavirus M proteins (S5 Fig), it is worth noting that the degradation of lyssavirus M induced by TRIM72 is dependent on the ubiquitination at the K195 site, thus TRIM72 cannot induce the degradation of some lyssavirus M proteins due to the deficient of lysine at 195 site, such as LBV-M and MOKV-M. According to our results, there is a higher ubiquitination level in lyssavirus M following mutation at the M K195 site (Fig 6D), indicating that there exist other ubiquitination sites in lyssavirus M. Although a previous study has identified a ubiquitination site at K60 of RABV M protein [69], additional ubiquitination sites may exist in lyssavirus M, necessitating further investigation.
In summary, our study has revealed a previously unknown role of TRIM72 during lyssavirus infection. We found that lyssavirus infection triggers an increase in TRIM72 levels in neuronal cells and mouse brains. Furthermore, we have identified a novel function of TRIM72, wherein it restricts lyssavirus assembly and/or release via directly interacting with lyssavirus M protein and facilitating the ubiquitination of lyssavirus’s M proteins at the K195 site, thereby promoting the degradation of lyssavirus M. The discovery in this study is significant because it sheds light on the direct interaction between TRIM72 and viral proteins, it also opens up the possibility that TRIM72 interacts and ubiquitinates other viral proteins from various viruses, which warrants further investigation. This research contributes to our understanding of how TRIM72 and other TRIM proteins play a role in defending against viral invasions and may inspire further research in this field.
Materials and methods
Ethics statement
Female C57 BL/6 mice (8-week-old) were purchased from the Hubei Center for Disease Control and Prevention, Hubei, China, and were housed in the animal facility at Huazhong Agricultural University in accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of Hubei Province, China. All experimental procedures involving animals were reviewed and approved by The Scientific Ethic Committee of Huazhong Agricultural University (permit number HZAUMO-2019-086).
Cells
Cell lines N2a (mouse neuroblastoma cell, ATCC CCL-131), BSR (a clone of BHK-21, ATCC CCL-10), SK-N-SH (human neuroblastoma cell, ATCC HTB-11) and Vero (African green monkey kidney cell, ATCC CCL-81) were obtained from American Type Culture Collection. Cells were cultured in a 37°C incubator with a humidified atmosphere containing 5% CO2. The growth media employed were DMEM (Bio-Channel Biological Technology Co., Ltd, BC-M-005-500ml) or RPMI1640, both of which were supplemented with 10% (vol/vol) fetal bovine serum (FBS, QmSuero/Tsingmu Biotechnology, Wuhan, China, mu001SR) and 1% penicillin-streptomycin (Bio-Channel, BC-CE-007-100ml).
Primary neuron cells
Primary neuron cells were isolated from the cerebral cortex of 16-day C57BL/6 mouse embryos as described previously [70]. Briefly, the cerebral cortex was separated from the brains and then dissociated with 0.25% trypsin (wt/vol) at 37°C for 30min. After centrifugation, the cells were resuspended in DMEM containing 5% FBS (Gibco) and subsequently passed through a 70 μm filter. After cell counting, the cells were seeded into 12-well plates (SORFA Life Science Co., Ltd, Beijing, China) that had been pretreated with poly-D-lysine and laminin (10 μg/ml) (Sigma, P7280). The cell supernatants were discarded at 5 h after seeding and replaced with Neurobasal plus Medium (Gibco, A3582901) containing 2% B-27 Plus (Gibco, A3582801). Then replace the medium every two days until 5–6 days post seeding for experiments.
qPCR analysis
Total RNA was isolated from cells and tissues using TRIzol reagent (Aidlab Biotech, Beijing, China, 321728AX) following the manufacturer’s instruction. cDNAs were synthesized using HiScript II 1st Strand cDNA Synthesis Kit (Vazyme Biotech co., Ltd, R212-02), the genomic vRNA was synthesized using HiScript II Q RT SuperMix (Vazyme Biotech co.,ltd, R222-01) according to the manufacturer’s protocol. qPCR was performed using ChamQ Universal SYBR qPCR Master Mix (Vazyme Biotech Co., Ltd, Q711-02). The qPCR program consists of an initial denaturation step at 95°C for 2 min for one cycle, followed by 40 cycles at 95°C for 5 s and 60°C for 30 s. The primer sequences used for qPCR were as follows (5’-3’):
Mouse Trim72-F GTTCTCACCGTGGTCATCGT
Mouse Trim72-R CAGCACCGCTACAGTCTTCT
hTrim72-F GACCCGCTGAGCATCTACTG
hTrim72-R AGCCACACTCTTCTCCTTGC
Mouse Gapdh-F CTACCCCCAATGTGTCCGTC
Mouse Gapdh-R TGAAGTCGCAGGAGACAACC
hGapdh-F AAGGTCATCCCTGAGCTAGAC
hGapdh-R GCAGGTTTTTCTAGACGGCAG
Mouse IFN-β-F TCCGCCCTGTAGGTGAGGTTGAT
Mouse IFN-β-R GTTCCTGCTGTGCTTCTCCCACCA
Mouse Isg15-F TGGTACAGAACTGCAGCGAG
Mouse Isg15-R AGCCAGAACTGGTCTTCGTG
Mouse Ifit1-F GCATCACCTTCCTCTGGCTA
Mouse Ifit1-R TGTTGTTCAGTGCCTTCTGG
Mouse Ifit2-F GCCAAGGAACACCAAAGATTG
Mouse Ifit2-R AAGTCCAAGATGAAGGTGCC
Mouse Ifit3-F CAGGGATAAAGGAGTGGCTG
Mouse Ifit3-R GATGAGCAGAGGAGTCAGGG
RABV N mRNA-F GATCGTGGAACACCATACCC
RABV N mRNA-R TTCATAAGCGGTGACGACTG
RABV-vRNA-F CTCCACAACGAGATGCTCAA
RABV-vRNA-R CATCCAACGGGAACAAGACT
Western blot
Cells were lysed in lysis buffer (50 mM Tris pH = 7.4, 150 mM NaCl, 0.25% Sodium deoxycholate, 1% NP40, 1 mM EDTA) containing 1x protease inhibitor cocktail (Biosharp, BL630B). After centrifugation at 12000 rpm/min for 10 min at 4°C, the supernatant was collected and SDS-PAGE loading buffer was added to the samples and boiled for 10 min. Total cell lysate samples were then separated on 8–12% SDS-PAGE gels and transferred to PVDF membranes (Millipore, ISEQ00010). Membranes were blocked with TBST containing 5% (w/v) non-fat dry milk at room temperature for 4 h or overnight in 4°Cand probed with primary antibodies which were diluted with TBST and 5% (w/v) non-fat dry milk overnight in 4°C. The primary antibodies were against RABV N protein (prepared by our lab, 1:5000), RABV P protein (prepared by our lab, 1:5000), RABV M protein (LSbio, LS-C369074), TRIM72 (Boster, A06982-2), Flag tag (MBL, M185-3L, 1:10000), HA tag (MBL, M180-3, 1:10000), Myc tag (MBL, M192-3, 1:10000), or GAPDH (ProteinTech, 60004-1-Ig, 1:5000). Membranes were probed with HRP-conjugated goat anti-mouse secondary antibodies (Boster, Wuan, China, BA1051), goat anti-rabbit secondary antibodies (Boster, BA1055, 1:6000), goat anti-mouse IgG light chain secondary antibodies (Abbkine, A25012, 1:5000), goat anti-mouse IgG Heavy chain secondary antibodies (Abbkine, A25012, 1:5000), then developed using BeyoECL Star kit (Beyotime, P0018A). Images were captured with an Amersham Imager 600 (GE Healthcare) imaging system.
Indirect Immunofluorescence
N2a cells that transfected with pCAGGS or pCA-Trim72-flag for 48 h were fixed with 4% (v/v) paraformaldehyde for 15 min at room temperature then washed three times with PBS. The cells were permeabilized in PBS containing 0.3% Triton X-100 for 5 min at 4°C, then blocked in 5% BSA buffer for 2 h at 37°C. Cells were then incubated with anti-flag antibody (MBL, M185-3) for 1.5 h at 37°C. After washed three times with PBS, cells were then incubated with Alexa Fluor 488 goat anti-mouse IgG (H+L) cross-adsorbed secondary antibody (Invitrogen, 11001) for 45 min at 37°C. The cells were then stained with DAPI for 10 min and again washed three times with PBS, and then imaged with a NiKon microscope (Ti2-A).
Trim72 knockout N2a cell line construction
To construct a Trim72-/- N2a cell line, the target sgRNA was designed as Trim72-sgRNA CCGTGCCTGCCTGATCCGGG, then the sgRNA sequence was cloned into px458-Cas9-puro plasmid (px458-Trim72-sgRNA-Cas9-puro). The recombinant plasmids were then transfected into N2a cells, and the positive cells were then separated with a flow cytometer and cultured which was used for the experiments.
Rescue of rRABVs
The recombinant rRABV-Trim72, rRABV-Trim72(-) and mutant rRABV-M-K195A were cloned from RABV strain challenge virus standard-B2c (CVS-B2c) and constructed as described previously [71, 72]. Briefly, BSR cells were seeded in 6-well plates (SORFA Life Science Co., Ltd, Beijing, China) and transfected with 2 μg of a fully infectious clone, 0.5 μg of pcDNA-N, 0.25 μg of pcDNA-P, 0.15 μg of pcDNA-G and 0.1 μg of pcDNA-L by using Jetprime polyplus transfection reagent (Polyplus, 114–15) according to the manufacturer’s instructions. Four days post-transfection, supernatants were harvested and examined for the presence of rescued viruses using FITC-conjugated anti-RABV P antibodies (Prepared by our lab).
Virus challenge experiment in mice
8-week-old female C57 BL/6 mice were infected intranasally with 100 fluorescence focus units (FFU) RABV (CVS-B2c) or mock infected, and the mouse brains were collected at 12 d post-infection for qPCR and western blot analysis.
8-week-old female C57 BL/6 mice were randomly divided into four groups (n = 10). 100 FFU of recombinant RABV (rRABV), rRABV-Trim72 and rRABV-Trim72(-) were injected into mice via intranasal individually, and the same volume of DMEM was injected into control mice. Survival percent, body weight changes and clinical score were recorded daily for 21 days.
IHC staining
Slices of mouse brains were prepared as described in our previous study [72]. Briefly, mice were intracardially perfused with PBS, and the brains were then extracted and fixed in 4% paraformaldehyde at 4°C for 16 h. Subsequently, the brains were embedded in paraffin and sectioned into slices. After dewaxing and dehydration, the slices were stained with a RABV-P polyclonal antibody (Prepared by our lab) overnight at 4°C. Following incubation with HRP-conjugated anti-rabbit secondary antibodies (Servicebio, GB23303, 1:200) were incubated, the slices were treated with diaminobenzidine (Servicebio, G1211) for color development. Finally, an XSP-C204 microscope (CIC) was used for photography and analysis.
Virus spreading assay
Virus spreading assay was performed as in our previous studies [71, 72]. Briefly, N2a cells were infected with different rRABVs, then the infected N2a cells were covered by a culture medium containing 1% low melting agar (VWR lifescience, 9012-36-6) to inhibit the virus release into the supernatant. The culture medium was removed post 48 h infection and fixed with 4% (v/v) paraformaldehyde for 15 min at room temperature then washed three times with PBS. And the cells were permeabilized in PBS containing 0.3% Triton X-100 for 5 min at 4°C, then blocked in 5% BSA buffer for 2 h at 37°C. Cells were then incubated with FITC-conjugated anti-RABV P antibodies (Prepared by our lab) for 45 min at 37°C. The cells were then stained with DAPI for 10 min. Cells were again washed three times with PBS and then imaged with a NiKon microscope (Ti2-A).
VLP analysis
VLP system was reconstructed as previously described [33, 34]. Briefly, empty vector or pCA-TRIM72-myc together with pCA-M-HA and pCA-G-flag (ratio 6:1) were co-transfected into HEK 293T cells for 48 h. Cells were collected for the analysis of the protein expression level by western blotting, and the supernatants were collected and centrifugated at 4°C for 30 min (5200 rpm/min). Then the supernatants were collected again and centrifugated at 4°C for 30 min (30000 rpm/min). The pellets were then collected and used for the analysis of VLP production by western blotting.
Co-immunoprecipitation (Co-IP)
The pretreated cells were washed 3 times with PBS and then lysed in lysis buffer (50 mM Tris pH = 7.4, 150 mM NaCl, 0.25% Sodium deoxycholate, 1% NP40, 1 mM EDTA) containing 1x protease inhibitor cocktail (Biosharp, BL630B). After centrifuging at 12000 rpm/min for 10 min at 4°C, the supernatant was collected. Anti-flag mAb-magnetic agarose (MBL, M185-10), Anti-HA-tag mAb-magnetic agarose (MBL, M180-10), Anti-RABV-M antibody (LSbio, LS-C369074) which pre-conjugated with rProtein A/G magpoly beads (Smart-Lifesciences, SM015010) or anti TRIM72 antibody (Proteintech, 22151-1-AP) which pre-conjugated with rProtein A/G magpoly beads was then added to the samples and incubated for 4 h at 4°C. After incubation, the samples were washed 3 times with lysis buffer (5 min/time), and then the magnetic agarose was collected and resuspended in PBS. Then SDS-PAGE loading buffer was added to the samples and boiled for 10 min. The supernatants were collected and used for western blot analysis.
Supporting information
S1 Fig. RABV infection induces TRIM72 and TRIM72 reduces RABV replication.
(A-B) SK-N-SH cells were infected with RABV at different MOI for 36 h. The mRNA level of TRIM72 was analyzed by qPCR (A), and the protein levels of TRIM72 and RABV-N were analyzed by western blotting (B). (C) Empty vector (pCAGGS) or TRIM72-flag over-expression vector (pCA-Trim72-flag) were transfected into N2a cells respectively for 48 h, then TRIM72-flag expression level and transfection efficiency were analyzed by indirect immunofluorescence with anti-flag antibody. Scale bar, 100 μM. (D) pCAGGS or pCA-TRIM72-flag were transfected into N2a cells respectively for the indicated time, then cell viability was analyzed. (E) The cell viability of WT and Trim72-/- N2a cells were analyzed at different time points. (F) The protein level of TRIM72 in N2a cells which were transfected with different concentrations of pCA-Trim72 or infected with RABV (MOI = 1) for 48 h were analyzed by western blotting with anti-TRIM72 antibody. (G) Empty vectors or different concentrations of TRIM72 over-expression vectors were transfected into N2a cells respectively for 12 h, then infected with RABV (MOI = 0.01) for 48 h, and the viral titers in the supernatant were analyzed. (H) Empty vector (pCAGGS) or hTRIM72-flag over-expression vector (pCA-hTrim72-flag) were transfected into SK-N-SH cells respectively for 48 h, then hTRIM72-flag level was analyzed by western blotting. (I) Empty vector or hTRIM72-flag over-expression vectors were transfected into SK-N-SH cells respectively for 12 h, then infected with RABV (MOI = 0.01) for the indicated time, and the viral titers in the supernatant were analyzed. Statistical analysis of grouped comparisons was carried out by student’s t-test (*P < 0.05; **P<0.01; ***P<0.001; ****P<0.0001). The bar graph represents means ± SD, n = 3. Western blot data are representative of at least two independent experiments.
https://doi.org/10.1371/journal.ppat.1011718.s001
(TIF)
S2 Fig. TRIM72 negatively regulates the IFN system.
(A-E) Empty vector or TRIM72-flag over-expression vectors were transfected into N2a cells respectively for 12 h, then infected with RABV (MOI = 1) for 48 h, and the mRNA levels of IFN-β (A), Isg15 (B), Ifit1 (C) Ifit2 (D) and Ifit3 (E) were analyzed by qPCR. (F-J) WT and Trim72-/- N2a cells were infected with RABV (MOI = 1) for 48 h, and the mRNA levels of IFN-β (A), Isg15 (B), Ifit1 (C) Ifit2 (D) and Ifit3 (E) were analyzed by qPCR. (K) Empty vector or TRIM72-flag over-expression vectors were transfected into Vero cells respectively for 12 h, then infected with RABV (MOI = 0.01) for the indicated time, and the viral titers in the supernatant were analyzed. (L) Vero cells were infected with different types of rRABVs (MOI = 0.01) and their growth kinetics were compared. Statistical analysis of grouped comparisons was carried out by student’s t-test (*P < 0.05; **P<0.01; ***P<0.001; ****P<0.0001). The bar graph represents means ± SD, n = 3.
https://doi.org/10.1371/journal.ppat.1011718.s002
(TIF)
S3 Fig. TRIM72 induces the degradation of M.
(A) pCAGGS or pCA-hTrim72-flag together with pCA-M-HA were co-transfected into SK-N-SH cells respectively for 48 h, and the protein levels of M-HA and hTRIM72-flag were analyzed by western blotting. (B) pCAGGS, pCA-Trim72-flag or pCA-Trim72-S255A-flag together with pCA-M-HA were co-transfected into N2a cells respectively for 48 h, and the protein levels of M-HA, TRIM72-flag or TRIM72-S255A-flag were analyzed by western blotting. (C) pCAGGS, pCA-Trim72-flag or pCA-Trim72-S255A-flag were transfected into N2a cells respectively for 12 h, then infected with RABV (MOI = 0.01) for 48 h, and the viral titers in the supernatant were analyzed. Statistical analysis of grouped comparisons was carried out by student’s t-test (**P<0.01; ****P<0.0001). The bar graph represents means ± SD, n = 3. Western blot data are representative of at least two independent experiments.
https://doi.org/10.1371/journal.ppat.1011718.s003
(TIF)
S4 Fig. hTRIM72 interacts with RABV-M.
(A) pCAGGS or pCA-hTrim72-flag together with pCA-M-HA were co-transfected into SK-N-SH cells respectively. Then Mg132 (10 μM) was treated, and Co-IP assays were performed with anti-flag antibody post-transfection for 48 h. The protein levels of TRIM72-flag and M-HA were analyzed by western blotting. (B) SK-N-SH cells were infected with RABV (MOI = 1) for 48 h, then Co-IP assays were performed with an anti-hTRIM72 antibody and protein levels of hTRIM72 and RABV-M were analyzed by western blotting. Western blot data are representative of at least two independent experiments.
https://doi.org/10.1371/journal.ppat.1011718.s004
(TIF)
S5 Fig. Lyssavirus M proteins’ sequences were compared.
The protein sequences of lyssavirus M were compared and analyzed with ESPript 3.0 online software (https://espript.ibcp.fr/ESPript/cgi-bin/ESPript.cgi).
https://doi.org/10.1371/journal.ppat.1011718.s005
(TIF)
S6 Fig. TRIM72 interacts with LBV-M and MOKV-M.
(A-B) HA-tagged lyssavirus M proteins (LBV-M-HA and MOKV-MHA) together with empty vector or TRIM72-flag were co-overexpressed in N2a cells respectively. Co-IP assays were performed with anti-flag antibody post-transfection for 48 h and protein levels of LBV-M-HA (A), and MOKV-M-HA (B), were analyzed by western blotting. (C-D) pCA-LBV-M-E195K-HA or pCA-MOKV-M-E195K-HA together with empty vector or TRIM72-flag were co-overexpressed in N2a cells for 48 h. The protein levels of LBV-M-E195K-HA (C) or MOKV-M-E195K-HA (D) were analyzed by western blotting. Western blot data are representative of at least two independent experiments.
https://doi.org/10.1371/journal.ppat.1011718.s006
(TIF)
References
- 1. Walker PJ, Blasdell KR, Calisher CH, Dietzgen RG, Kondo H, Kurath G, et al. ICTV Virus Taxonomy Profile: Rhabdoviridae. The Journal of general virology. 2018;99(4):447–8. Epub 2018/02/22. pmid:29465028.
- 2. Rupprecht CE, Mshelbwala PP, Reeves RG, Kuzmin IV. Rabies in a postpandemic world: resilient reservoirs, redoubtable riposte, recurrent roadblocks, and resolute recidivism. Animal diseases. 2023;3(1):15. Epub 2023/05/30. pmid:37252063; PubMed Central PMCID: PMC10195671.
- 3. Rupprecht CE, Turmelle A, Kuzmin IV. A perspective on lyssavirus emergence and perpetuation. Current opinion in virology. 2011;1(6):662–70. Epub 2012/03/24. pmid:22440925.
- 4. Hampson K, Coudeville L, Lembo T, Sambo M, Kieffer A, Attlan M, et al. Estimating the global burden of endemic canine rabies. PLoS neglected tropical diseases. 2015;9(4):e0003709. Epub 2015/04/17. pmid:25881058; PubMed Central PMCID: PMC4400070 does not alter our adherence to all PLOS NTDs policies on sharing data and materials. The findings and conclusions in this report are those of the authors and do not necessarily represent the views of the Centers for Disease Control and Prevention.
- 5. Fisher CR, Streicker DG, Schnell MJ. The spread and evolution of rabies virus: conquering new frontiers. Nature reviews Microbiology. 2018;16(4):241–55. Epub 2018/02/27. pmid:29479072; PubMed Central PMCID: PMC6899062.
- 6. Davis BM, Rall GF, Schnell MJ. Everything You Always Wanted to Know About Rabies Virus (But Were Afraid to Ask). Annual review of virology. 2015;2(1):451–71. Epub 2016/03/10. pmid:26958924; PubMed Central PMCID: PMC6842493.
- 7. Jayakar HR, Jeetendra E, Whitt MA. Rhabdovirus assembly and budding. Virus research. 2004;106(2):117–32. Epub 2004/11/30. pmid:15567492.
- 8. Finke S, Mueller-Waldeck R, Conzelmann KK. Rabies virus matrix protein regulates the balance of virus transcription and replication. The Journal of general virology. 2003;84(Pt 6):1613–21. Epub 2003/05/29. pmid:12771432.
- 9. Besson B, Sonthonnax F, Duchateau M, Ben Khalifa Y, Larrous F, Eun H, et al. Regulation of NF-κB by the p105-ABIN2-TPL2 complex and RelAp43 during rabies virus infection. PLoS pathogens. 2017;13(10):e1006697. Epub 2017/10/31. pmid:29084252; PubMed Central PMCID: PMC5679641.
- 10. Ryšlavá H, Doubnerová V, Kavan D, Vaněk O. Effect of posttranslational modifications on enzyme function and assembly. Journal of proteomics. 2013;92:80–109. Epub 2013/04/23. pmid:23603109.
- 11. Ramazi S, Allahverdi A, Zahiri J. Evaluation of post-translational modifications in histone proteins: A review on histone modification defects in developmental and neurological disorders. Journal of biosciences. 2020;45. Epub 2020/11/14. pmid:33184251.
- 12. Komander D. The emerging complexity of protein ubiquitination. Biochemical Society transactions. 2009;37(Pt 5):937–53. Epub 2009/09/17. pmid:19754430.
- 13. Hochstrasser M. Ubiquitin-dependent protein degradation. Annual review of genetics. 1996;30:405–39. Epub 1996/01/01. pmid:8982460.
- 14. Lee D, Hong JH. Physiological Overview of the Potential Link between the UPS and Ca(2+) Signaling. Antioxidants (Basel, Switzerland). 2022;11(5). Epub 2022/05/29. pmid:35624861; PubMed Central PMCID: PMC9137615.
- 15. Buetow L, Huang DT. Structural insights into the catalysis and regulation of E3 ubiquitin ligases. Nature reviews Molecular cell biology. 2016;17(10):626–42. Epub 2016/08/04. pmid:27485899; PubMed Central PMCID: PMC6211636.
- 16. Meroni G, Desagher S. Cellular Function of TRIM E3 Ubiquitin Ligases in Health and Disease. Cells. 2022;11(2). Epub 2022/01/22. pmid:35053366; PubMed Central PMCID: PMC8773487.
- 17. Wan T, Li X, Li Y. The role of TRIM family proteins in autophagy, pyroptosis, and diabetes mellitus. Cell biology international. 2021;45(5):913–26. Epub 2021/01/14. pmid:33438267.
- 18. Reymond A, Meroni G, Fantozzi A, Merla G, Cairo S, Luzi L, et al. The tripartite motif family identifies cell compartments. The EMBO journal. 2001;20(9):2140–51. Epub 2001/05/02. pmid:11331580; PubMed Central PMCID: PMC125245.
- 19. Torok M, Etkin LD. Two B or not two B? Overview of the rapidly expanding B-box family of proteins. Differentiation; research in biological diversity. 2001;67(3):63–71. Epub 2001/06/29. pmid:11428128.
- 20. Hatakeyama S. TRIM Family Proteins: Roles in Autophagy, Immunity, and Carcinogenesis. Trends in biochemical sciences. 2017;42(4):297–311. Epub 2017/01/26. pmid:28118948.
- 21. Ozato K, Shin DM, Chang TH, Morse HC, 3rd. TRIM family proteins and their emerging roles in innate immunity. Nature reviews Immunology. 2008;8(11):849–60. Epub 2008/10/07. pmid:18836477; PubMed Central PMCID: PMC3433745.
- 22. Park EY, Kwon OB, Jeong BC, Yi JS, Lee CS, Ko YG, et al. Crystal structure of PRY-SPRY domain of human TRIM72. Proteins. 2010;78(3):790–5. Epub 2009/12/08. pmid:19967786.
- 23. Ma X, Ma X, Zhu L, Zhao Y, Chen M, Li T, et al. The E3 ubiquitin ligase MG53 inhibits hepatocellular carcinoma by targeting RAC1 signaling. Oncogenesis. 2022;11(1):40. Epub 2022/07/21. pmid:35858925; PubMed Central PMCID: PMC9300626.
- 24. Nguyen N, Yi JS, Park H, Lee JS, Ko YG. Mitsugumin 53 (MG53) ligase ubiquitinates focal adhesion kinase during skeletal myogenesis. The Journal of biological chemistry. 2014;289(6):3209–16. Epub 2013/12/18. pmid:24344130; PubMed Central PMCID: PMC3916525.
- 25. Yi JS, Park JS, Ham YM, Nguyen N, Lee NR, Hong J, et al. MG53-induced IRS-1 ubiquitination negatively regulates skeletal myogenesis and insulin signalling. Nature communications. 2013;4:2354. Epub 2013/08/24. pmid:23965929; PubMed Central PMCID: PMC3941707.
- 26. Hwang M, Ko JK, Weisleder N, Takeshima H, Ma J. Redox-dependent oligomerization through a leucine zipper motif is essential for MG53-mediated cell membrane repair. American journal of physiology Cell physiology. 2011;301(1):C106–14. Epub 2011/04/29. pmid:21525429; PubMed Central PMCID: PMC3129825.
- 27. Ahn MK, Lee KJ, Cai C, Huang M, Cho CH, Ma J, et al. Mitsugumin 53 regulates extracellular Ca(2+) entry and intracellular Ca(2+) release via Orai1 and RyR1 in skeletal muscle. Scientific reports. 2016;6:36909. Epub 2016/11/15. pmid:27841305; PubMed Central PMCID: PMC5107933.
- 28. Yuan Y, Fang A, Wang Z, Tian B, Zhang Y, Sui B, et al. Trim25 restricts rabies virus replication by destabilizing phosphoprotein. Cell insight. 2022;1(5):100057. Epub 2023/05/17. pmid:37193556; PubMed Central PMCID: PMC10120326.
- 29. Sermersheim M, Kenney AD, Lin PH, McMichael TM, Cai C, Gumpper K, et al. MG53 suppresses interferon-β and inflammation via regulation of ryanodine receptor-mediated intracellular calcium signaling. Nature communications. 2020;11(1):3624. Epub 2020/07/19. pmid:32681036; PubMed Central PMCID: PMC7368064 treatment of human disease. Patents on the use of MG53 are held by Rutgers University Robert Wood Johnson Medical School. All other authors confirm no other conflicts of interest.
- 30. Yang W, Gu Z, Zhang H, Hu H. To TRIM the Immunity: From Innate to Adaptive Immunity. Frontiers in immunology. 2020;11:02157. Epub 2020/10/30. pmid:33117334; PubMed Central PMCID: PMC7578260.
- 31. Emeny JM, Morgan MJ. Regulation of the interferon system: evidence that Vero cells have a genetic defect in interferon production. The Journal of general virology. 1979;43(1):247–52. Epub 1979/04/01. pmid:113494.
- 32. Desmyter J, Melnick JL, Rawls WE. Defectiveness of interferon production and of rubella virus interference in a line of African green monkey kidney cells (Vero). Journal of virology. 1968;2(10):955–61. Epub 1968/10/01. pmid:4302013; PubMed Central PMCID: PMC375423.
- 33. Fontana D, Kratje R, Etcheverrigaray M, Prieto C. Rabies virus-like particles expressed in HEK293 cells. Vaccine. 2014;32(24):2799–804. Epub 2014/03/19. pmid:24631077.
- 34. Liu X, Li F, Zhang J, Wang L, Wang J, Wen Z, et al. The ATPase ATP6V1A facilitates rabies virus replication by promoting virion uncoating and interacting with the viral matrix protein. The Journal of biological chemistry. 2021;296:100096. Epub 2020/11/20. pmid:33208464; PubMed Central PMCID: PMC7949080.
- 35. Lv F, Wang Y, Shan D, Guo S, Chen G, Jin L, et al. Blocking MG53(S255) Phosphorylation Protects Diabetic Heart From Ischemic Injury. Circulation research. 2022;131(12):962–76. Epub 2022/11/08. pmid:36337049; PubMed Central PMCID: PMC9770150.
- 36. Ohtake F, Saeki Y, Ishido S, Kanno J, Tanaka K. The K48-K63 Branched Ubiquitin Chain Regulates NF-κB Signaling. Molecular cell. 2016;64(2):251–66. Epub 2016/10/22. pmid:27746020.
- 37. Cai C, Masumiya H, Weisleder N, Matsuda N, Nishi M, Hwang M, et al. MG53 nucleates assembly of cell membrane repair machinery. Nature cell biology. 2009;11(1):56–64. Epub 2008/12/02. pmid:19043407; PubMed Central PMCID: PMC2990407.
- 38. Zhang Y, Wu HK, Lv F, Xiao RP. MG53: Biological Function and Potential as a Therapeutic Target. Molecular pharmacology. 2017;92(3):211–8. Epub 2017/04/23. pmid:28432201.
- 39. Li Z, Wang L, Yue H, Whitson BA, Haggard E, Xu X, et al. MG53, A Tissue Repair Protein with Broad Applications in Regenerative Medicine. Cells. 2021;10(1). Epub 2021/01/15. pmid:33440658; PubMed Central PMCID: PMC7827922.
- 40. Blazek AD, Paleo BJ, Weisleder N. Plasma Membrane Repair: A Central Process for Maintaining Cellular Homeostasis. Physiology (Bethesda, Md). 2015;30(6):438–48. Epub 2015/11/04. pmid:26525343; PubMed Central PMCID: PMC4630197 biotechnology company developing products targeting membrane repair, including rhMG53.
- 41. Yao Y, Zhang B, Zhu H, Li H, Han Y, Chen K, et al. MG53 permeates through blood-brain barrier to protect ischemic brain injury. Oncotarget. 2016;7(16):22474–85. Epub 2016/03/12. pmid:26967557; PubMed Central PMCID: PMC5008374.
- 42. Han Y, Black S, Gong Z, Chen Z, Ko JK, Zhou Z, et al. Membrane-delimited signaling and cytosolic action of MG53 preserve hepatocyte integrity during drug-induced liver injury. Journal of hepatology. 2022;76(3):558–67. Epub 2021/11/06. pmid:34736969.
- 43. Xu B, Wang C, Chen H, Zhang L, Gong L, Zhong L, et al. Protective role of MG53 against ischemia/reperfusion injury on multiple organs: A narrative review. Frontiers in physiology. 2022;13:1018971. Epub 2022/12/09. pmid:36479346; PubMed Central PMCID: PMC9720843.
- 44. Guan F, Zhou X, Li P, Wang Y, Liu M, Li F, et al. MG53 attenuates lipopolysaccharide-induced neurotoxicity and neuroinflammation via inhibiting TLR4/NF-κB pathway in vitro and in vivo. Progress in neuro-psychopharmacology & biological psychiatry. 2019;95:109684. Epub 2019/07/02. pmid:31260721; PubMed Central PMCID: PMC6708450.
- 45. Wu M, Li H, He J, Liang J, Liu Y, Zhang W. TRIM72 Alleviates Muscle Inflammation in mdx Mice via Promoting Mitophagy-Mediated NLRP3 Inflammasome Inactivation. Oxidative medicine and cellular longevity. 2023;2023:8408574. Epub 2023/01/31. pmid:36713032; PubMed Central PMCID: PMC9876702.
- 46. Kenney AD, Li Z, Bian Z, Zhou X, Li H, Whitson BA, et al. Recombinant MG53 Protein Protects Mice from Lethal Influenza Virus Infection. American journal of respiratory and critical care medicine. 2021;203(2):254–7. Epub 2020/10/09. pmid:33031705; PubMed Central PMCID: PMC7874416.
- 47. Yau R, Rape M. The increasing complexity of the ubiquitin code. Nature cell biology. 2016;18(6):579–86. Epub 2016/05/28. pmid:27230526.
- 48. Mello-Vieira J, Bopp T, Dikic I. Ubiquitination and cell-autonomous immunity. Current opinion in immunology. 2023;84:102368. Epub 2023/07/15. pmid:37451128.
- 49. Kim YJ, Lee Y, Shin H, Hwang S, Park J, Song EJ. Ubiquitin-proteasome system as a target for anticancer treatment-an update. Archives of pharmacal research. 2023. Epub 2023/08/05. pmid:37541992.
- 50. Yang YH, Wen R, Yang N, Zhang TN, Liu CF. Roles of protein post-translational modifications in glucose and lipid metabolism: mechanisms and perspectives. Molecular medicine (Cambridge, Mass). 2023;29(1):93. Epub 2023/07/07. pmid:37415097; PubMed Central PMCID: PMC10327358.
- 51. Husnjak K, Dikic I. Ubiquitin-binding proteins: decoders of ubiquitin-mediated cellular functions. Annual review of biochemistry. 2012;81:291–322. Epub 2012/04/10. pmid:22482907.
- 52. Ikeda F, Dikic I. Atypical ubiquitin chains: new molecular signals. ’Protein Modifications: Beyond the Usual Suspects’ review series. EMBO reports. 2008;9(6):536–42. Epub 2008/06/03. pmid:18516089; PubMed Central PMCID: PMC2427391.
- 53. Deng L, Wang C, Spencer E, Yang L, Braun A, You J, et al. Activation of the IkappaB kinase complex by TRAF6 requires a dimeric ubiquitin-conjugating enzyme complex and a unique polyubiquitin chain. Cell. 2000;103(2):351–61. Epub 2000/11/01. pmid:11057907.
- 54. Xu P, Duong DM, Seyfried NT, Cheng D, Xie Y, Robert J, et al. Quantitative proteomics reveals the function of unconventional ubiquitin chains in proteasomal degradation. Cell. 2009;137(1):133–45. Epub 2009/04/07. pmid:19345192; PubMed Central PMCID: PMC2668214.
- 55. Zhang Z, Bao M, Lu N, Weng L, Yuan B, Liu YJ. The E3 ubiquitin ligase TRIM21 negatively regulates the innate immune response to intracellular double-stranded DNA. Nature immunology. 2013;14(2):172–8. Epub 2012/12/12. pmid:23222971; PubMed Central PMCID: PMC3645272.
- 56. Lin L, Wang X, Chen Z, Deng T, Yan Y, Dong W, et al. TRIM21 restricts influenza A virus replication by ubiquitination-dependent degradation of M1. PLoS pathogens. 2023;19(6):e1011472. Epub 2023/06/21. pmid:37343022; PubMed Central PMCID: PMC10325077.
- 57. Komarova AV, Real E, Borman AM, Brocard M, England P, Tordo N, et al. Rabies virus matrix protein interplay with eIF3, new insights into rabies virus pathogenesis. Nucleic acids research. 2007;35(5):1522–32. Epub 2007/02/09. pmid:17287294; PubMed Central PMCID: PMC1865048.
- 58. Zandi F, Goshadrou F, Meyfour A, Vaziri B. Rabies Infection: An Overview of Lyssavirus-Host Protein Interactions. Iranian biomedical journal. 2021;25(4):226–42. Epub 2021/07/05. pmid:34217155; PubMed Central PMCID: PMC8334389.
- 59. Luco S, Delmas O, Vidalain PO, Tangy F, Weil R, Bourhy H. RelAp43, a member of the NF-κB family involved in innate immune response against Lyssavirus infection. PLoS pathogens. 2012;8(12):e1003060. Epub 2012/12/29. pmid:23271966; PubMed Central PMCID: PMC3521698.
- 60. Ben Khalifa Y, Luco S, Besson B, Sonthonnax F, Archambaud M, Grimes JM, et al. The matrix protein of rabies virus binds to RelAp43 to modulate NF-κB-dependent gene expression related to innate immunity. Scientific reports. 2016;6:39420. Epub 2016/12/22. pmid:28000711; PubMed Central PMCID: PMC5175135.
- 61. Sonthonnax F, Besson B, Bonnaud E, Jouvion G, Merino D, Larrous F, et al. Lyssavirus matrix protein cooperates with phosphoprotein to modulate the Jak-Stat pathway. Scientific reports. 2019;9(1):12171. Epub 2019/08/23. pmid:31434934; PubMed Central PMCID: PMC6704159.
- 62. Adle-Biassette H, Bourhy H, Gisselbrecht M, Chrétien F, Wingertsmann L, Baudrimont M, et al. Rabies encephalitis in a patient with AIDS: a clinicopathological study. Acta neuropathologica. 1996;92(4):415–20. Epub 1996/10/01. pmid:8891075.
- 63. Gholami A, Kassis R, Real E, Delmas O, Guadagnini S, Larrous F, et al. Mitochondrial dysfunction in lyssavirus-induced apoptosis. Journal of virology. 2008;82(10):4774–84. Epub 2008/03/07. pmid:18321977; PubMed Central PMCID: PMC2346764.
- 64. Valerdi KM, Hage A, van Tol S, Rajsbaum R, Giraldo MI. The Role of the Host Ubiquitin System in Promoting Replication of Emergent Viruses. Viruses. 2021;13(3). Epub 2021/03/04. pmid:33652634; PubMed Central PMCID: PMC7996891.
- 65. Giraldo MI, Xia H, Aguilera-Aguirre L, Hage A, van Tol S, Shan C, et al. Envelope protein ubiquitination drives entry and pathogenesis of Zika virus. Nature. 2020;585(7825):414–9. Epub 2020/07/10. pmid:32641828; PubMed Central PMCID: PMC7501154.
- 66. Bharaj P, Atkins C, Luthra P, Giraldo MI, Dawes BE, Miorin L, et al. The Host E3-Ubiquitin Ligase TRIM6 Ubiquitinates the Ebola Virus VP35 Protein and Promotes Virus Replication. Journal of virology. 2017;91(18). Epub 2017/07/07. pmid:28679761; PubMed Central PMCID: PMC5571272.
- 67. Harty RN, Paragas J, Sudol M, Palese P. A proline-rich motif within the matrix protein of vesicular stomatitis virus and rabies virus interacts with WW domains of cellular proteins: implications for viral budding. Journal of virology. 1999;73(4):2921–9. Epub 1999/03/12. pmid:10074141; PubMed Central PMCID: PMC104051.
- 68. Harty RN, Brown ME, McGettigan JP, Wang G, Jayakar HR, Huibregtse JM, et al. Rhabdoviruses and the cellular ubiquitin-proteasome system: a budding interaction. Journal of virology. 2001;75(22):10623–9. Epub 2001/10/17. pmid:11602704; PubMed Central PMCID: PMC114644.
- 69. Cai Y, Su J, Wang N, Zhao W, Zhu M, Su S. Comprehensive analysis of the ubiquitome in rabies virus-infected brain tissue of Mus musculus. Veterinary microbiology. 2020;241:108552. Epub 2020/01/14. pmid:31928699.
- 70. Cho H, Proll SC, Szretter KJ, Katze MG, Gale M Jr., Diamond MS. Differential innate immune response programs in neuronal subtypes determine susceptibility to infection in the brain by positive-stranded RNA viruses. Nature medicine. 2013;19(4):458–64. Epub 2013/03/05. pmid:23455712; PubMed Central PMCID: PMC3618596.
- 71. Tian D, Luo Z, Zhou M, Li M, Yu L, Wang C, et al. Critical Role of K1685 and K1829 in the Large Protein of Rabies Virus in Viral Pathogenicity and Immune Evasion. Journal of virology. 2016;90(1):232–44. Epub 2015/10/16. pmid:26468538; PubMed Central PMCID: PMC4702542.
- 72. Sui B, Chen D, Liu W, Wu Q, Tian B, Li Y, et al. A novel antiviral lncRNA, EDAL, shields a T309 O-GlcNAcylation site to promote EZH2 lysosomal degradation. Genome biology. 2020;21(1):228. Epub 2020/09/03. pmid:32873321; PubMed Central PMCID: PMC7465408.