An autoinducer-independent RhlR quorum-sensing receptor enables analysis of RhlR regulation
Fig 3
MBP-RhlR:mBTL and MBP-RhlR* bind equally well to DNA.
A) Electrophoretic mobility gel shifts showing 300 bp biotin-labeled DNA fragments containing the rhlA (top), rhlI (center), and hcnA (bottom) promoters incubated with different concentrations of MBP-RhlR:mBTL or MBP-RhlR*. “Ub” and “B” denote unbound DNA and DNA bound to protein, respectively. The probe DNA was used at 30 ng with 500, 200, 100, 50, 30, 20, and 10 ng of the specified protein going from left to right on the gels. The right-most lane shows the no protein control (designated by the dash). B) Isothermal titration calorimetry analyses of MBP-RhlR:mBTL (top) and MBP-RhlR* (bottom) binding to the rhl-box consensus DNA sequence (ACCTGCCAGATTTCGCAGGT). 1 μM protein and 20 μM DNA were used in the reactions. The calculated Kd values for MBP-RhlR:mBTL and for MBP-RhlR* for the rhl-box consensus sequence are 23 nM and 34 nM, respectively. DP and ΔH denote differential power and enthalpy, respectively.