Figures
Abstract
Human embryonic stem cells (hESCs) have great promise as a source of unlimited transplantable cells for regenerative medicine. However, current progress on producing the desired cell type for disease treatment has been limited due to an insufficient understanding of the developmental processes that govern their differentiation, as well as a paucity of tools to systematically study differentiation in the lab. In order to overcome these limitations, cell-type reporter hESC lines will be required. Here we outline two strategies using Transcription Activator Like Effector Nucleases (TALENs) and Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-CRISPR-Associated protein (Cas) to create OCT4-eGFP knock-in add-on hESC lines. Thirty-one and forty-seven percent of clones were correctly modified using the TALEN and CRISPR-Cas9 systems, respectively. Further analysis of three correctly targeted clones demonstrated that the insertion of eGFP in-frame with OCT4 neither significantly impacted expression from the wild type allele nor did the fusion protein have a dramatically different biological stability. Importantly, the OCT4-eGFP fusion was easily detected using microscopy, flow cytometry and western blotting. The OCT4 reporter lines remained equally competent at producing CXCR4+ definitive endoderm that expressed a panel of endodermal genes. Moreover, the genomic modification did not impact the formation of NKX6.1+/SOX9+ pancreatic progenitor cells following directed differentiation. In conclusion, these findings demonstrate for the first time that CRISPR-Cas9 can be used to modify OCT4 and highlight the feasibility of creating cell-type specific reporter hESC lines utilizing genome-editing tools that facilitate homologous recombination.
Citation: Krentz NAJ, Nian C, Lynn FC (2014) TALEN/CRISPR-Mediated eGFP Knock-In Add-On at the OCT4 Locus Does Not Impact Differentiation of Human Embryonic Stem Cells towards Endoderm. PLoS ONE 9(12): e114275. https://doi.org/10.1371/journal.pone.0114275
Editor: Katriina Aalto-Setala, University of Tampere, Finland
Received: June 10, 2014; Accepted: November 8, 2014; Published: December 4, 2014
Copyright: © 2014 Krentz et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Data Availability: The authors confirm that all data underlying the findings are fully available without restriction. All relevant data are within the paper and its Supporting Information files.
Funding: FCL salary support provided by the Michael Smith Foundation for Health Research, the Canadian Diabetes Association, and the Child and Family Research Institute. NAJK is a recipient of the Canadian Institute of Health Research-BC Transplantation Trainee Fellowship, Child and Family Research Institute Sue Carruthers Graduate Studentship, and University of British Columbia Four Year Fellowship. FCL received the following grants in support of this work: Juvenile Diabetes Research Foundation 2-2011-91; Canadian Institutes of Health Research RMF-111626; Child and Family Research Institute Canucks for Kids Fund 2014. The funders had no role in study design, data collection or analysis, decision to publish or preparation of the manuscript.
Competing interests: Francis Lynn is a PLOS ONE Editorial Board Member. This does not alter the authors' adherence to PLOS ONE Editorial policies and criteria.
Introduction
Embryonic stem cells (ESCs) are pluripotent cells located in the inner cell mass of early embryos that have the capacity for long-term self-renewal and the ability to form all cell types of the embryo proper. Since the generation and successful culture of the first human (h)ESC line [1], there has been great excitement surrounding their potential to treat many diseases, including diabetes [1]–[4]. Unfortunately, progress in making fully functional terminally differentiated cells has been slow. This is likely due to both the insufficient knowledge of the developmental processes that govern tissue formation and the lack of appropriate tools to study development in culture [5], [6]. One potential method to address both of these issues is the generation of reporter hESC lines that facilitate the study of human development in culture and to allow for high throughput, high content screens to uncover factors that drive differentiation.
Previously, creation of reporter hESC lines has primarily been limited to transgenesis using constitutive [7]–[12] or truncated promoters [7], [13], [14]. These strategies are not ideal, as variation in copy number and integration sites may affect expression of reporter genes. More importantly, there is a significant likelihood of transgene silencing upon differentiation, especially to more specialized cell types [15], and a risk of disrupting endogenous gene expression. Another strategy is to replace one allele with the reporter gene; however, this creates haploinsufficiency that can impair differentiation and complicate interpretation. A better approach is to knock-in a reporter gene downstream, but in-frame with the protein of interest, allowing for marker expression driven by the endogenous promoter without altering expression of the targeted gene. This strategy was previously difficult in hESCs due to the low rate of homologous recombination and the requirement for very large homology arms [16]. With the recent advent of three high efficiency genome editing technologies, Zinc Finger Nucleases (ZFNs), Transcription Activator Like Effector Nucleases (TALENs) and Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-CRISPR-Associated protein (Cas), genome editing is fast becoming a reality in human ESCs [17]–[19]. These technologies utilize sequence-specific (10–30 bp in length) nucleases to create a double stranded break in the DNA, which dramatically increases the frequency of homologous recombination through homology directed repair. While several landmark papers have described the generation of reporter lines using these technologies [20]–[22], no studies have thoroughly investigated the effects of the genomic modification on stem cell characteristics or directed differentiation potential.
Oct4/Pou5f1 is a key member of the pluripotency network [23] and while Oct4−/− embryos develop to the blastocyst stage, they do not contain pluripotent cells within the inner cell mass [24]. In addition to its role in maintaining embryonic stem cell pluripotency, Oct4 is also important for differentiation, as Oct4 expression is required for the formation of all embryonic lineages in vitro and in vivo [25]. For instance, in zebrafish the Oct4 homolog is essential for endoderm formation [26] and maternal-zygotic Oct4 mutant embryos display delayed gastrulation and absence of endoderm [27].
The dual role of Oct4 in both maintaining pluripotency and establishing endoderm is believed to be driven by its Sox binding partner. Oct4 interacts with Sox2 at “canonical” binding sites to maintain pluripotency, while endoderm specification involves Oct4 and Sox17 binding at “compressed” Sox/Oct motifs [28]. Consistent with this finding, point mutations in the Oct4-interaction interface of Sox17 allow Sox17 to cooperate with Oct4 at canonical sites and drive reprogramming; whereas, mutations to the analogous region of Sox2 allow it to cooperate with Oct4 to drive endoderm formation [29]. Consistent with the role of Oct4 in mouse development, it appears that the level of human OCT4 expression dictates which lineage stem cells will differentiate towards: reduced expression of OCT4 promotes the mesoderm lineage while elevated OCT4 promotes adoption of the endoderm lineage [30]. The critical role of OCT4 in endoderm formation suggests that any changes in OCT4 expression or stability in hESC reporter cell lines may alter their differentiation potential, especially to endodermally-derived tissues.
In the present study both TALEN and CRISPR-Cas approaches were used to generate OCT4-eGFP-2A-Puro reporter lines using the CyT49 hESC line: the CRISPR-Cas9 strategy being slightly more efficient. In order to understand if OCT4 targeting impacted stem cell identity or the ability of hESCs to form endoderm and endodermally-derived tissues, three of the correctly targeted clones were analyzed further. Knock-in add-on of eGFP to OCT4 did not affect pluripotency; eGFP fluorescence mirrored expression of OCT4; and genomic modification did not alter expression from the wild type OCT4 allele. Finally, genomic modification of OCT4 did not alter the potential of these cells to differentiate either to definitive endoderm or towards downstream pancreatic progenitor cells. Taken together, these results support the use of genome editing technologies to efficiently generate reporter hESC lines.
Materials and Methods
Cell culture
Undifferentiated CyT49 hESCs (ViaCyte, Inc. San Diego CA) were maintained on EmbryoMAX Primary Mouse Embryo Fibroblasts (MEF) feeder layers (Millipore) in 10/10 media [DMEM/F12 (Cellgro), 10% XenoFree KnockOut Serum Replacement (Life Technologies), 1x MEM non-essential amino acids (Life Technologies), 1x GlutaMAX (Life Technologies), 1x penicillin/streptomycin (10,000 U/mL) (Life Technologies), 10 nM β-mercaptoethanol (Sigma), supplemented with 10 ng/mL Activin A (R&D) and 10 ng/mL Heregulin-β1 (Peprotech)] [31], [32]. Cells were split twice weekly and plated at a density of 5×105 or 1×106 on 35 and 60 mm plates, respectively. Cells to be differentiated were plated on Growth Factor Reduced BD Matrigel Matrix (BD Biosciences; 1∶75 in DMEM/F12) coated plates. The cells derived in this study may be obtained upon written consent from ViaCyte Inc.
DNA constructs
Transcriptional Activator Like Effector Nucleases (TALEN)s were generated in house using the TALE toolbox (pTALEN_v2) [33]. Guanine binding was encoded by the repeat-variable diresidue Asn-His (NH) as described [34]. TALEN binding sites flanked the stop codon of the OCT4 gene with the forward TALEN designed to bind to the sequence: 5′- TCTGGGCTCTCCCATGCATT-3′ and the reverse TALEN to the sequence: 5′- TCCCCCATTCCTAGAAGGGC-3′.
The CRISPR/Cas vector was based on px458 (Addgene; plasmid 48138)); however, the Cbh promoter was exchanged for a full-length CAGGS promoter in order to maximize hESC expression (pCCC). The gRNA (AGAGTGGTGACGGAGACAGG; score 0.6) was designed using the algorithm reported by Doench et al. [35] and was cloned into the BbsI sites of pCCC to generate pCCC-LL488 as described by Ran et al. [36]. The targeting vector was obtained from Addgene (plasmid 31939) and has been previously described [21].
Electroporation
CyT49 hESC were cultured in 10/10 media with 1 µM Y-27632 dihydrochloride (Tocris Bioscience) for 2 hours prior to electroporation. Cells were washed with PBS before trypsinization with Accutase (Life Technologies) for 5 minutes at 37°C. Following detachment, cells were centrifuged at 200×g for 5 minutes before being washed three times in 100-pellet volumes of PBS. 107 cells were resuspended in Embryomax Electroporation Buffer (Millipore), transferred to a 0.4 cm cuvette with 40 µg of OCT4-eGFP-2A-Puro donor plasmid and 15 µg of each TALEN encoding plasmid (or 15 µg pCCC-LL488), and electroporated using Bio-Rad Gene Pulser II system (250 V, 500 µF, time constants <13 ms). After electroporation, cells were resuspended well in 10/10 media with 1 µM Y-27632 dihydrochloride and plated onto a 10 cm Matrigel-coated tissue culture dish. Media was replaced daily with 10/10 and cells were allowed to recover for up to four days before selecting with 0.25 µg/mL puromycin (Sigma). Colonies were picked into a 96-well Matrigel-coated plate within 10 days of electroporation by manually scraping and pipetting the colony off the plate and into a well with 100 uL of 10/10. Once clones were close to confluent, cells were replica plated onto three plates: one to genotype, one to freeze down and one to expand the correctly targeted clones. Genomic DNA was extracted using QuickExtract (Epicentre) and the following primers were used to genotype: 5′F CTCAGTTCTGCTGGGATAAG, 5′R GTCTTGTAGTTGCCGTCGTC, 3′F GCAACCTCCCCTTCTACGAG, 3′R CTTACACCAAGCCAAACTATTG.
In vitro differentiation of hESC
The differentiation protocol was adapted from Schulz et al. [32]. Briefly, to produce definitive endoderm cells were treated with Activin A (100 ng/mL; eBioscience), Wnt3a (25 ng/mL; R&D), and 1∶5000 Insulin-Transferrin-Selenium (ITS; Gibco) in RPMI (0.5x penicillin/streptomycin, 1x glutaMAX; Hyclone) for 24 hours. Cells were in the same media supplemented with 0.2% defined FBS and without Wnt3a for another 48 hours. To generate primitive gut tube, cells were first treated with KGF (25 ng/mL; R&D), TGF-β RI kinase inhibitor (2.5 µM; EMB Bioscience), 0.2% defined FBS and 1∶1000 ITS. Cells were then treated as previously but without TGF-β RI kinase inhibitor for 48 hours. To produce posterior foregut, cells were treated for 36 hours in TTNPB (3 nM; Sigma), cyclopamine-KAAD (0.25 µM; Toronto Research Chemicals), Noggin (50 ng/mL; R&D), 0.5x B27 (Gibco) in DMEM High Glucose (0.5x penicillin/streptomycin, 1x glutaMAX; Hyclone). Finally, to produce pancreatic progenitors and endocrine precursors, cells were treated for 36 hours in Noggin (50 ng/mL; R&D), KGF (50 ng/mL; R&D), EGF (50 ng/mL; R&D) in DMEM High Glucose.
RNA isolation and RT-PCR analysis
RNA extraction was performed as previously described [37]. Gene expression analysis was determined using ΔΔCT relative to the housekeeping gene, TATA-binding protein (TBP). For a list of TAQMAN primers used, see Table S1.
Western blot analysis
Lysis buffer (95°C) was used to lyse cells and protein was denatured by boiling at 95°C for 10 minutes before sonication (S-4000 with cuphorn; Misonix) for 2 minutes (80%). Cells were then centrifuged at 10,000×g for 5 minutes at 20°C and supernatant was collected. Lysates were subjected to standard SDS-PAGE followed by blotting onto nitrocellulose membrane (Biorad). Blots were then blocked with 5% milk powder in Tris-buffered saline with Tween (0.1%) and probed with rabbit anti-human OCT4 (Cell Signaling; 1∶1000), anti-GFP (MBL; 1∶1000) or mouse anti-GAPDH (Sigma; 1∶125,000) overnight at 4°C in blocking buffer. The next day membranes were probed with horseradish peroxidase-conjugated secondary antibodies at 1∶10,000 (Jackson ImmunoResearch) for 1 hour and visualized with ECL Prime (GE Biosciences).
Flow Cytometry and FACS
Cells were rinsed once with PBS and detached from the plate using Accutase. Cells were centrifuged for 5 minutes at 200×g before being resuspended well in 4% paraformaldehyde (PFA) and fixed for 15 minutes. Subsequently, cells were rinsed twice in PBS before analyses on a BD FACSCalibur flow cytometer for GFP expression. Representative flow plots can be found in Figure S4B. To sort for eGFP+ and GFP– populations, cells were trypsinized, washed in PBS and sorted directly into TRIzol (Life Technologies) using a BD FACS Aria. To determine endogenous OCT4 expression, cells were fixed as above, permeabilized in 0.5% triton-X and stained overnight at 4° with rabbit anti-human OCT4 antibody (1∶100; Cell Signaling). The next morning cells were rinsed three times in PBS before incubation with secondary antibody anti-rabbit FITC (1∶250; Jackson ImmunoResearch) for 1 hour at room temperature. Cells were analyzed on a BD FACSCalibur using appropriate unstained and secondary antibody only controls. Representative flow plots for OCT4 analysis can be found in Figure S4A. To determine CXCR4+ cells, cells were fixed in 4% PFA for 15 minutes, washed three times in PBS and incubated with CXCR4-PE antibody (1∶20; R&D) for 45 minutes. After cells were washed well, they were analyzed using BD FACSCalibur.
Immunocytochemical analyses
Cells were grown and differentiated on Matrigel-coated optical dishes (MatTek). On the day of collection, cells were rinsed once in PBS before fixation in 4% PFA for 15 minutes. Cells were permeabilized with 0.5% triton X in PBS for 30 minutes, blocked for 30 minutes in 5% horse serum in PBS and stained with primary antibodies overnight at 4°C: mouse anti-OCT4 antibody (1∶100; Cell Signaling), mouse anti-SOX2 (1∶100; Cell Signaling), mouse anti-NANOG (1∶100; Cell Signaling), rabbit anti-SOX9 (1∶500; Millipore), and mouse anti-NKX6.1 (1∶100; DSHB). The following morning, plates were washed three times with PBS and stained with secondary antibodies for 1 hour: anti-mouse Dy-488 (1∶250; Jackson ImmunoResearch), anti-mouse Dy-594 (1∶450; Jackson ImmunoResearch), anti-rabbit Dy-594 (1∶450; Jackson ImmunoResearch), and TO-PRO Iodide (1∶10,000; Life Technologies). Images were taken using 63x oil immersion objective on a Leica TCS SP8 confocal microscope.
Results
Generation of OCT4-eGFP-2A-Puro hESC lines using genetically engineered nucleases
TALENs consist of 34 amino acid repeat modules where the repeat variable domain at amino acids 12–13 dictates nucleotide binding specificity (Figure 1A) [38], [39]. Using this modular code, a TALEN pair was designed that bound on either side of the OCT4 stop codon where the Fok1 nuclease domains of this pair of proteins homodimerize and generate a double stranded break (DSB) (Figure 1B). This DSB can be repaired through homologous recombination of the provided donor plasmid, resulting in eGFP-2A-Puro inserted, in frame, downstream of the last exon of OCT4.
(A) The structure of Xanthomonas sp TALE protein. Each nucleotide-binding module is comprised of a 34 amino acid sequence, inside of which is embedded one of 4 repeat variable domains (RVD). The sequence of this di-amino acid RVD dictates the deoxynucleotide-binding cipher: NG is highly specific for deoxythymidine, HD for deoxycytidine, NI for deoxyadenosine, and NH for deoxyguanosine. (B) Schematic overview of the targeting strategy using TALENs to knock eGFP onto the OCT4 coding sequence. Red line represents the stop codon. Regions where genotyping PCR primer pairs bind are highlighted for 5′F, 5′R, 3′F and 3′R. (C) Genotyping PCR for i) 5′ arm of insertion using primers 5′F and 5′R (1180 bp) ii) 3′ arm of insertion using primers 3′F and 3′R (1000 bp) iii) endogenous allele using primers 5′F and 3′R for parent CyT49 line and three of the generated knock-in lines OCT4-2, OCT4-3 and OCT4-28. (D) Schematic overview of the CRISPR-Cas9 targeting strategy. Red line represents the stop codon. A green circle represents the Cas9 endonuclease with the tracRNA in black. The genomic protospacer adjacent motif (PAM) sequence is highlighted in red type and the guide RNA sequence is in bold type. Genotyping PCR primer pairs are the same as for TALEN targeting and are highlighted.
Applying this strategy, 52 puromycin-resistant clones from two electroporations were picked and characterized. Sixteen of these clones (31%) were correctly targeted at both the 5′ and 3′ ends as determined using PCR genotyping (Table 1). As the primer pairs used to amplify the 5′ and 3′ regions of the genomic insertion contained one primer that bound outside of OCT4 donor vector homology arms and a second primer that bound within sequences not contained in wild type cells (Figures 1B & S1B), these experiments correctly distinguished targeted clones from those with random genomic insertions. Furthermore, sequence analyses of the obtained PCR products confirmed precise insertion of the reporter gene (Figure S1) without introduced errors. To determine if the insertion was found in one or both alleles, PCR genotyping was used to distinguish the wild type allele from the modified allele and it was determined that all three hESC lines were heterozygous for the insertion (Figure 1C). Taken together, these results demonstrate that this new TALEN pair can drive efficient genomic modification downstream of OCT4 in hESCs.
As OCT4 has not been targeted using the CRISPR-Cas system and previous reports suggest CRISPR-Cas9 is more efficient, we compared the efficiencies of TALEN and CRISPR-Cas9 technologies. CRISPR-Cas9 is an RNA-guided endonuclease technology [22], [40] and requires three distinct components: the guide RNA (gRNA), the tracRNA, and the Cas9 endonuclease. The gRNA binds to target genomic sequences by complementary base pairing and recruits first the tracRNA and then the Cas9 endonuclease (Figure 1D), which creates a DSB that is repaired by the same mechanisms as described above.
Early attempts at targeting the OCT4 locus using the protocol outlined by Ran et al. [36] were unsuccessful, with only one of 177 puro-resistant clones from three separate electroporations correctly targeted at the 5′ end (data not shown). Because of low expression from the Cbh promoter in CyT49 cells, a new CRISPR-Cas9 vector was generated that utilized the full length CAGGS promoter to drive Cas9 expression. Using this expression system, 15/32 (47%) clones were correctly targeted at both the 5′ and 3′ ends (Table 1) and one of these clones was homozygous for the insertion while all others were heterozygous. These data are consistent with other reports [20], [41] that suggest the CRISPR-Cas9 strategy is more efficient than TALENs at generating DSBs.
OCT4-eGFP reporter lines have normal OCT4 expression and stem cell phenotype
To determine if the knock-in add-on eGFP faithfully reported expression of OCT4, immunofluorescence for OCT4 in the wildtype CyT49 and the knock-in hESC lines OCT4-2, OCT4-3, and OCT4-28 was performed. As depicted in Figure 2, OCT4 and GFP expression completely overlapped in these three cell lines indicating that GFP faithfully recapitulates endogenous OCT4 expression. Further, similar OCT4 staining intensities between targeted and parental cells suggested that the targeting did not affect native OCT4 expression levels. Importantly, all three of the reporter lines maintained eGFP expression after eight passages in culture (data not shown), confirming the stability of this insertion and minimal effects on maintenance of pluripotency.
Undifferentiated cells on optical dishes were fixed in 4% PFA, permeabilized using 0.5% triton-X and stained for OCT4. Images were obtained on a Leica SP8 confocal microscope and native eGFP fluorescence (green) overlapped completely with both OCT4 immunostaining (red) and nuclear counterstain using TO-PRO Iodide (blue). Scale bars represent 50 µm.
To ensure the genomic modification and our targeting approach did not alter the stem cell characteristics of these cells, immunofluorescent staining for two other pluripotency markers, NANOG (Figure 3A) and SOX2 (Figure 3B) was performed. As seen in Figure 3, similar immunostaining intensities for these pluripotency factors were observed in all four cell lines, suggesting that the targeting and cloning did not impact pluripotency. Interestingly, a small percentage of SOX2+GFP- and NANOG+GFP- cells in all three OCT4 reporter lines was noted.
Cells were grown on optical dishes and then fixed with 4% PFA and permeabilized with 0.5% triton-X. Immunostaining was carried out and images were obtained on a Leica SP8 confocal microscope. Native eGFP fluorescence (green) overlapped with both SOX2 or NANOG immunostaining (red) and nuclear counterstain using TO-PRO Iodide (blue). Scale bars represent 50 µm.
OCT4-eGFP reporter lines are able to form the definitive endoderm germ layer
To determine if the genomic modification impacted differentiation of these cells and if OCT4 expression levels were downregulated at similar rates during definitive endoderm (DE) formation in targeted lines, a directed differentiation to DE and qPCR was carried out. During DE formation, only the OCT4-2 line showed significantly elevated levels of OCT4 when compared to CyT49 controls (Figure 4A). Next, the efficiency of DE formation was determined by measuring the number of CXCR4 immunopositive(+) cells using flow cytometry [42]. As seen in Figure 4B, there were no differences in the number of CXCR4+ cells derived from the OCT4-2 or OCT4-28 lines; however, there was a slight, 13% reduction in CXCR4+ cells in the OCT4-3 line. The OCT4-eGFP lines expressed normal message levels of DE markers including: CER1 (Figure 4C), GSC (Figure 4D), and SOX17 (Figure 4F). Of note, none of these markers were significantly different between the reporter lines and CyT49, except for a 2.8-fold reduction in GSC message expression again in OCT4-2. SOX7 expression was measured to determine if there was any change in the formation of visceral endoderm (VE) (Figure 4E) and no significant differences were observed. Taken together, these results suggest that knocking eGFP onto OCT4 has minimal effects on the formation of DE beyond the previously described clonal variation [43].
hESCs were differentiated into definitive endoderm using a three day protocol, cells were collected and expression of OCT4 (A), CER1 (C), GSC (D), SOX7 (E), and SOX17 (F) were analyzed using Taqman qPCR. All genes were normalized to TATA Binding Protein expression (TBP). (B) hESC-derived DE cells were fixed with 4% PFA and stained for the cell surface marker CXCR4. The number of CXCR4+ DE cells was detected using BD FACSCalibur in the CyT49, OCT4-2, OCT4-3 and OCT4-28 lines. Statistical analysis was carried out using a one-way ANOVA followed by a Dunnett post-test. n≥3. *p<0.05.
To demonstrate the utility of eGFP to enrich for OCT4 expression, the reporter lines were differentiated to definitive endoderm, FACS was used to collect the eGFP+ and eGFP- cells, and OCT4 qPCR was carried out on the two populations. As expected, OCT4 expression was enriched 2.7-, 1.5-, and 4.4-fold in the eGFP+ cells from OCT4-2, OCT4-3, and OCT4-28 lines, respectively (Figure S2). Surprisingly, abundant OCT4 mRNA was observed in the GFP- fraction of OCT4-3. As SOX17 is important in hESCs for DE formation [44], SOX17 expression was measured and found to be enriched 19.3-, 118.1-, and 83.3-fold in the eGFP− cells from OCT4-2, OCT4-3, and OCT4-28 lines, respectively (Figure S2). This provides evidence that reporter expression driven by a single endogenous promoter is sufficient to isolate cells via FACS and that these cell lines could be used to assess for presence of OCT4-expressing cells in mixed, differentiated cultures.
eGFP expression mirrors OCT4 protein levels in OCT4 reporter lines
To determine whether the stability of the OCT4-eGFP fusion protein is similar to that of native OCT4, western blot analyses of OCT4 and GFP in stem cells (Day 0), definitive endoderm (Days 1–3) and posterior foregut (Days 4–6) was performed (Figure S3). The decline of OCT4 protein in the CyT49 parental line was consistent with mRNA expression (c.f. Figure 5A & Figure S3). Furthermore, the OCT4-eGFP fusion protein was downregulated at a similar rate to wild type OCT4 in all three genetically modified reporter lines and the rate of OCT4 loss is consistent with the FACS data (Figure 5B).
(A) The mRNA expression of OCT4 was measured during the differentiation of CyT49 cells. Day 0 represents undifferentiated hESC cells, Days 1–3 are cells becoming definitive endoderm, Days 4–6 are cells becoming posterior foregut, Day 9 are pancreatic endoderm cells and Day 12 are pancreatic progenitors and endocrine cells. (B) CyT49 cells were fixed with 4% PFA, permeabilized in 0.5% triton-X, stained using rabbit anti-OCT4 antibodies followed by FITC-conjugated donkey anti-rabbit antibodies. The number of FITC+ cells was measured using a BD FACSCalibur during several days of the differentiation protocol. The number of GFP+ cells was measured using native eGFP fluorescence and a BD FACSCalibur in OCT4-2 (C), OCT4-3 (D) and OCT4-28 (E) fixed cells. n≥3.
Ability to differentiate into pancreatic progenitors is maintained in OCT4 reporter lines
In order to determine whether fusion protein would alter OCT4 stability and possibly the dynamics of differentiation towards endodermally-derived tissues, OCT4 gene expression (Figure 5A) and the number of OCT4+ cells (Figure 5B) was assessed during the differentiation towards pancreas. To confirm that the loss of eGFP expression in the reporter lines mirrors the decline in OCT4 expression that is observed in the parental line (Figures 5A&B), we characterized eGFP expression during the differentiation towards pancreas in the OCT4 reporter lines using flow cytometry (Figures 5C–E). In undifferentiated cells, 98.6%, 79.3%, and 92.1% of cells were GFP+ in OCT4-2, OCT4-3, and OCT4-28 lines, respectively. In human pluripotent cells, OCT4 interacts with both NANOG and SOX2 to activate pluripotent genes [45]; however, it has been shown that elevated Oct4 expression is sufficient for endodermal formation in mouse ESCs [46] due to the cooperation between Oct4 and Sox17 in driving endoderm differentiation [28]. Consistent with the role of OCT4 in endoderm formation we noted 51.9%, 12.7%, and 11.7% GFP+ cells at the end of day 3 in OCT-2, OCT4-3, and OCT4-28 lines, respectively. Furthermore, we did not detect greater than 1% GFP+ in hESC-derived pancreatic endoderm at day 12 from any of the reporter lines, which is consistent with the number of OCT4+ cells in the CyT49 line (Figures 5A&B). Thus, in agreement with data presented in Figure 4A and Figure S3, OCT4-2 has a delayed loss of OCT4 protein upon differentiation, which may result in a delayed formation of endodermally-derived progenitors.
To determine whether the targeted clones would differentiate towards the pancreatic lineage with similar efficiencies as the parental line, immunocytochemical analyses for NKX6-1 [47]–[50] and SOX9 [51]–[54] were performed on day 12 (Figure 6). Despite the small differences in loss of OCT4 expression described above, we were unable to appreciate a change in the level of these two proteins in the reporter lines compared to the parental line. As NKX6-1 and SOX9 are also expressed in other cell types, qPCR analysis for other pancreas and endocrine cell genes was carried out. No significant differences in expression levels of PDX1, NEUROG3, SOX9 or NKX6-1 were observed (not shown). Taken together, these findings suggest that this approach is amenable for the future creation of tissue or cell-type specific reporter lines.
Immunostaining for NKX6-1 (green) and SOX9 (red) was carried out on day 12 in parent CyT49 hESCs and knock-in OCT4-2, OCT4-3 and OCT4-28 hESC lines that were grown and differentiated in optical dishes. Images were obtained on a Leica SP8 confocal microscope using TO-PRO Iodide (blue) as nuclear counterstain. Scale bars represent 25 µm.
Discussion
This study outlines two strategies for the creation of OCT4-eGFP-2A-Puro hESC reporter lines using either TALEN or CRISPR-Cas9 genome editing methodologies. Both of these approaches allowed for the efficient generation of reporter lines in approximately four weeks. Further characterization of these lines determined that knocking a fluorescent protein onto OCT4 neither impacted the pluripotency nor differentiation potential of the cells. We confirmed that the eGFP reporter is co-expressed with OCT4 and does not alter native OCT4 expression. Finally, the efficiencies of differentiating these cells to both definitive endoderm and pancreatic progenitors were similar to the parental CyT49 line.
Genome-editing technologies such as those described herein have greatly improved efficiency of homologous recombination in three ways: 1) through reducing the burden of generating constructs containing long homology arms; 2) by simplifying clone screening and verification processes; and 3) by increasing the likelihood of homologous recombination. Two other studies have shown the utility of genome editing in generating mutations at the OCT4 locus; however, neither of these studies have characterized whether these mutations impact differentiation potential. Zinc Finger Nucleases were used to insert eGFP into one of two regions of OCT4, both of which disrupted the protein coding region in BG01 hESCs [20]. More recently, using TALENs, eGFP was inserted downstream of the last exon of OCT4 to create an OCT4-eGFP fusion protein, avoiding the disruption of the protein coding gene [21]. This manuscript provides the first description OCT4 modification using the CRISPR-Cas9 system. Using the described approaches, the CRISPR-Cas9 strategy was more efficient (47% vs. 31%) and allowed creation of homozygous knock-in reporter lines.
OCT4, a POU domain transcription factor that can act both as an activator and repressor, was first identified as a central member of the pluripotency network [24], [55]. As such, its absence causes ESCs to differentiate into trophoblast cells [46]. Importantly no changes in the expression of NANOG or SOX2 were observed in the targeted cell lines, consistent with the fact that the OCT4-eGFP fusion protein did not alter the pluripotent nature of these hESC lines. However, OCT4 expression was observed in the GFP- fraction from OCT4-3 line. This could reflect a mixed clone and highlights a limitation of this approach, which is that ensuring lines are derived from a single cell can often be difficult. As such, it should be emphasized that it is important to investigate several “clonal” lines when performing these types of analyses.
OCT4 is required for the generation of all germ layers [25] and in particular definitive endoderm (DE) [28], the germ layer whose derivatives form the lining of the gut and associated organs [56]. In the three OCT4-eGFP reporter lines characterized here, there were no significant differences in expression of the DE genes CER1 and SOX17 and the VE gene SOX7; however, there were significant changes in GSC in OCT4-2. GSC is a homeobox gene with important roles in gastrulation and endoderm formation. Interestingly, the significant decrease in GSC expression was concurrent with a significant increase in OCT4 expression. Owing to its role as a transcriptional repressor [57], it is possible that GSC expression, and endoderm formation, is repressed by prolonged expression of OCT4. Even with the slight differences in the expression profile of the DE generated from these reporter lines, they were able to form pancreatic progenitors with similar efficiencies, suggesting that this strategy does not dramatically disrupt differentiation.
In summary, this work has demonstrated that the CyT49 hESC line is amenable to genomic modification using two genome-editing technologies. Characterization of three OCT4-eGFP reporter lines demonstrated that these genomic modifications do not significantly alter either their stem cell characteristics or differentiation potential. These studies add to the growing body of literature that shows nuclease-mediated genome engineering is a powerful approach for hESC modification and underscore its utility in the generation of personalized cell based therapies.
Supporting Information
Figure S1.
Sequencing analysis of OCT4-2, OCT4-3, and OCT4-28 hESC clones. Genomic DNA isolated from each cell line was sequenced using primers 5′F, 5′R, 3′F, and 3′R. (A) Aligned raw sequences from OCT4-2, OCT4-3, and OCT4-28 spanning homology arms. (B) Schematic of pOCT4-eGFP-2A-Puro genomic integration outlining the 5′ homology arm (pink box), eGFP (green box) and 3′ homology arm (pink box). Arrows highlight region of homology arm sequence alignment for OCT4-2 (red), OCT4-3 (blue) and OCT4-28 (black). Forward primers (hatched arrows) and reverse (solid arrows) genotyping and sequencing primers are highlighted.
https://doi.org/10.1371/journal.pone.0114275.s001
(PDF)
Figure S2.
OCT4 and SOX17 expression in GFP+ and GFP− cells. Cells were trypsinized on the second day of differentiation to definitive endoderm and the GFP+ and GFP− populations were collected into TRIzol using the BD FACS Aria. RNA was isolated and cDNA synthesized before carrying out qPCR analysis for OCT4 and SOX17 using TBP as control gene. Statistical analysis was performed using a Student’s t-test. n≥3. *p<0.05, **p<0.01, ***p<0.001.
https://doi.org/10.1371/journal.pone.0114275.s002
(TIF)
Figure S3.
Western Blot analysis of OCT4 and eGFP expression during differentiation of hESCs to definitive endoderm and primitive gut tube. Protein lysates were collected on Day 0 (hESC), Days 1–3 (definitive endoderm) and Days 4–6 (primitive gut tube) and the expression of OCT4, eGFP and the control protein GAPDH were analyzed in the CyT49, OCT4-2, OCT4-3 and OCT4-28 hESC lines using SDS-PAGE followed by western blotting as described in the Materials and Methods section.
https://doi.org/10.1371/journal.pone.0114275.s003
(TIF)
Figure S4.
Representative flow cytometry data for the analysis of OCT4+ and eGFP+ cells. (A) Representative flow plots for CyT49 cells that were collected on Days 0–3, stained for OCT4, and analyzed using BD FACSCalibur. Unstained controls used to set up the gating strategy are also shown. (B) Representative flow plots for OCT4-2 cells that were analyzed for eGFP expression using the BD FACSCalibur on Days 0–3. To set up the gates for eGFP, CyT49 cells were used as a negative control. Data analysis was performed using FlowJo software.
https://doi.org/10.1371/journal.pone.0114275.s004
(TIF)
Acknowledgments
We acknowledge Dr. Rudolph Jaenisch for providing the OCT4-eGFP-2A-Puro donor plasmid and Dr. Feng Zhang for the px458 vector. We thank Dr. Kevin D’Amour, ViaCyte, Inc. San Diego CA and members of the Lynn lab for their critical reading of this manuscript as well as technical support from Lisa Xu and Jingsong Wang.
Author Contributions
Conceived and designed the experiments: NAJK CN FCL. Performed the experiments: NAJK CN FCL. Analyzed the data: NAJK FCL. Contributed reagents/materials/analysis tools: NAJK FCL. Contributed to the writing of the manuscript: NAJK FCL.
References
- 1. Thomson JA, Itskovitz-Eldor J, Shapiro SS, Waknitz MA, Swiergiel JJ, et al. (1998) Embryonic stem cell lines derived from human blastocysts. Science 282:1145–1147
- 2. Cohen DE, Melton D (2011) Turning straw into gold: directing cell fate for regenerative medicine. Nat Rev Genet 12:243–252
- 3. Aguayo-Mazzucato C, Bonner-Weir S (2010) Stem cell therapy for type 1 diabetes mellitus. Nat Rev Endocrinol 6:139–148
- 4. Hoffman LM, Carpenter MK (2005) Characterization and culture of human embryonic stem cells. Nat Biotechnol 23:699–708
- 5. McKnight KD, Wang P, Kim SK (2010) Deconstructing Pancreas Development to Reconstruct Human Islets from Pluripotent Stem Cells. Cell Stem Cell 6:300–308
- 6. Polak JM, Bishop AE (2006) Stem Cells and Tissue Engineering: Past, Present, and Future. Ann NY Acad Sci 1068:352–366
- 7. Eiges R, Schuldiner M, Drukker M, Yanuka O, Itskovitz-Eldor J, et al. (2001) Establishment of human embryonic stem cell-transfected clones carrying a marker for undifferentiated cells. Current Biology 11:514–518
- 8. Vallier L, Rugg-Gunn PJ, Bouhon IA, Andersson FK, Sadler AJ, et al. (2004) Enhancing and diminishing gene function in human embryonic stem cells. Stem Cells 22:2–11
- 9. Ren CP, Zhao M, Shan W-J, Yang X-Y, Yin Z-H, et al. (2005) Establishment of Human Embryonic Stem Cell Line Stably Expressing Epstein Barr Virus Encoded Nuclear Antigen 1. Acta Biochim Biophys Sin 37:68–73
- 10. Liu Y-P, Dovzhenko OV, Garthwaite MA, Dambaeva SV, Durning M, et al. (2004) Maintenance of pluripotency in human embryonic stem cells stably over-expressing enhanced green fluorescent protein. Stem Cells Dev 13:636–645
- 11. Siemen H, Nix M, Endl E, Koch P, Itskovitz-Eldor J, et al. (2005) Nucleofection of human embryonic stem cells. Stem Cells Dev 14:378–383
- 12. Lakshmipathy U, Pelacho B, Sudo K, Linehan JL, Coucouvanis E, et al. (2004) Efficient transfection of embryonic and adult stem cells. Stem Cells 22:531–543
- 13. Thyagarajan B, Liu Y, Shin S, Lakshmipathy U, Scheyhing K, et al. (2008) Creation of Engineered Human Embryonic Stem Cell Lines Using phiC31 Integrase. Stem Cells 26:119–126
- 14. Gerrard L, Zhao D, Clark AJ, Cui W (2005) Stably Transfected Human Embryonic Stem Cell Clones Express OCT4-Specific Green Fluorescent Protein and Maintain Self-Renewal and Pluripotency. Stem Cells 23:124–133
- 15. MacArthur CC, Xue H, Van Hoof D, Lieu PT, Dudas M, et al. (2012) Chromatin Insulator Elements Block Transgene Silencing in Engineered Human Embryonic Stem Cell Lines at a Defined Chromosome 13 Locus. Stem Cells Dev 21:191–205
- 16. Leavitt AD, Hamlett I (2011) Homologous Recombination in Human Embryonic Stem Cells: A Tool for Advancing Cell Therapy and Understanding and Treating Human Disease. Clin Transl Sci 4:298–305
- 17.
Peters DT, Cowan CA, Musunuru K (2013) Genome editing in human pluripotent stem cells. StemBook, ed. doi:doi:https://doi.org/10.3824/stembook.1.94.1..
- 18. Wei C, Liu J, Yu Z, Zhang B, Gao G, et al. (2013) TALEN or Cas9 - Rapid, Efficient and Specific Choices for Genome Modifications. J Genet Genomics 40:281–289
- 19. Gaj T, Gersbach CA, Barbas CF III (2013) ZFN, TALEN, and CRISPR/Cas-based methods for genome engineering. Trends Biotechnol 31:397–405
- 20. Hockemeyer D, Soldner F, Beard C, Gao Q, Mitalipova M, et al. (2009) Efficient targeting of expressed and silent genes in human ESCs and iPSCs using zinc-finger nucleases. Nat Biotechnol 27:851–857
- 21. Hockemeyer D, Wang H, Kiani S, Lai CS, Gao Q, et al. (2011) Genetic engineering of human pluripotent cells using TALE nucleases. Nat Biotechnol 29:731–734
- 22. Cong L, Ran FA, Cox D, Lin S, Barretto R, et al. (2013) Multiplex Genome Engineering Using CRISPR/Cas Systems. Science 339:819–823
- 23. Chambers I, Tomlinson SR (2009) The transcriptional foundation of pluripotency. Development 136:2311–2322
- 24. Nichols J, Zevnik B, Anastassiadis K, Niwa H, Klewe-Nebenius D, et al. (1998) Formation of pluripotent stem cells in the mammalian embryo depends on the POU transcription factor Oct4. Cell 95:379–391
- 25. Radzisheuskaya A, Chia GL, dos Santos RL, Theunissen TW, Castro LF, et al. (2013) A defined Oct4 level governs cell state transitions of pluripotency entry and differentiation into all embryonic lineages. Nat Cell Biol 15:579–590
- 26. Reim G, Mizoguchi T, Stainier DY, Kikuchi Y, Brand M (2003) The POU domain protein spg (pou2/Oct4) is essential for endoderm formation in cooperation with the HMG domain protein casanova. Dev Cell 6:91–101
- 27. Lunde K, Belting H-G, Driever W (2004) Zebrafish pou5f1/pou2, Homolog of Mammalian Oct4, Functions in the Endoderm Specification Cascade. Current Biology 14:48–55
- 28. Aksoy I, Jauch R, Chen J, Dyla M, Divakar U, et al. (2013) Oct4 switches partnering from Sox2 to Sox17 to reinterpret the enhancer code and specify endoderm. EMBO J 32:938–953
- 29. Jauch R, Aksoy I, Hutchins AP, Ng CK, Tian XF, et al. (2011) Conversion of Sox17 into a Pluripotency Reprogramming Factor by Reengineering Its Association with Oct4 on DNA. Stem Cells 29:940–951
- 30. Rodriguez RT, Velkey JM, Lutzko C, Seerke R, Kohn DB, et al. (2007) Manipulation of OCT4 Levels in Human Embryonic Stem Cells Results in Induction of Differential Cell Types. Exp Biol Med 232:1368–1380
- 31. D’Amour KA, Agulnick AD, Eliazer S, Kelly OG, Kroon E, et al. (2005) Efficient differentiation of human embryonic stem cells to definitive endoderm. Nat Biotechnol 23:1534–1541
- 32. Schulz TC, Young HY, Agulnick AD, Babin MJ, Baetge EE, et al. (2012) A Scalable System for Production of Functional Pancreatic Progenitors from Human Embryonic Stem Cells. PLoS ONE 7:e37004
- 33. Sanjana NE, Cong L, Zhou Y, Cunniff MM, Feng G, et al. (2012) A transcription activator-like effector toolbox for genome engineering. Nat Protoc 7:171–192
- 34. Cong L, Zhou R, Kuo Y-C, Cunniff M, Zhang F (2012) Comprehensive interrogation of natural TALE DNA-binding modules and transcriptional repressor domains. Nat Comms 3:968–6
- 35.
Doench JG, Hartenian E, Graham DB, Tothova Z, Hedge M, et al.. (2014) Rational design of highly active sgRNAs for CRISPR-Cas9-mediated gene inactivation. Nat Biotechnol 1–8. doi:doi:https://doi.org/10.1038/nbt.3026..
- 36. Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA, et al. (2013) Genome engineering using the CRISPR-Cas9 system. Nat Protoc 8:2281–2308
- 37. Sabatini PV, Krentz NA, Zarrouki B, Westwell-Roper CY, Nian C, et al. (2013) Npas4 Is a Novel Activity-Regulated Cytoprotective Factor in Pancreatic β-Cells. Diabetes 62:2808–20
- 38. Boch J, Scholze H, Schornack S, Landgraf A, Hahn S, et al. (2009) Breaking the Code of DNA Binding Specificity of TAL-Type III Effectors. Science 326:1509–1512
- 39. Moscou MJ, Bogdanove AJ (2009) A Simple Cipher Governs DNA Recognition by TAL Effectors. Science 326:1501–1501
- 40. Mali P, Yang L, Esvelt KM, Aach J, Guell M, et al. (2013) RNA-Guided Human Genome Engineering via Cas9. Science 339:823–826
- 41. Ding Q, Regan SN, Xia Y, Oostrom LA, Cowan CA, et al. (2013) Enhanced Efficiency of Human Pluripotent Stem Cell Genome Editing through Replacing TALENs with CRISPRs. Cell Stem Cell 12:393–394
- 42. McGrath KE, Koniski AD, Maltby KM, McGann JK, Palis J (1999) Embryonic expression and function of the chemokine SDF-1 and its receptor, CXCR4. Dev Biol 213:442–456
- 43. D’Amour KA, Bang AG, Eliazer S, Kelly OG, Agulnick AD, et al. (2006) Production of pancreatic hormone–expressing endocrine cells from human embryonic stem cells. Nat Biotechnol 24:1392–1401
- 44. Séguin CA, Draper JS, Nagy A, Rossant J (2008) Establishment of Endoderm Progenitors by SOX Transcription Factor Expression in Human Embryonic Stem Cells. Cell Stem Cell 3:182–195
- 45. Boyer LA, Lee TI, Cole MF, Johnstone SE, Levine SS, et al. (2005) Core Transcriptional Regulatory Circuitry in Human Embryonic Stem Cells. Cell 122:947–956
- 46. Niwa H, Miyazaki J-I, Smith AG (2000) Quantitative expression of Oct-3/4 defines differentiation, dedifferentiation or self-renewal of ES cells. Nat Genet 24:372–376
- 47. Schaffer AE, Freude KK, Nelson SB, Sander M (2010) Nkx6 Transcription Factors and Ptf1a Function as Antagonistic Lineage Determinants in Multipotent Pancreatic Progenitors. Dev Cell 18:1022–1029
- 48. Henseleit KD, Nelson SB, Kuhlbrodt K, Hennings JC, Ericson J, et al. (2005) NKX6 transcription factor activity is required for alpha- and beta-cell development in the pancreas. J Embryol Exp Morphol 132:3139–3149
- 49. Sander M, Sussel L, Conners J, Scheel D, Kalamaras J, et al. (2000) Homeobox gene Nkx6. 1 lies downstream of Nkx2. 2 in the major pathway of beta-cell formation in the pancreas. Development 127:5533–5540
- 50. Rezania A, Bruin JE, Xu J, Narayan K, Fox JK, et al. (2013) Enrichment of Human Embryonic Stem Cell-derived NKX6.1 expressing Pancreatic Progenitors Accelerates the Maturation of Insulin-secreting Cells In Vivo. Stem Cells 11:2432–42
- 51. Lynn FC, Smith SB, Wilson ME, Yang KY, German MS (2007) Sox9 coordinates a transcriptional network in pancreatic progenitor cells. Proc Natl Acad Sci USA 104:10500–10505.
- 52. Seymour PA, Freude KK, Tran MN, Mayes EE, Jensen J, et al. (2007) SOX9 is required for maintenance of the pancreatic progenitor cell pool. Proc Natl Acad Sci USA 104:1865–1879.
- 53. Seymour PA, Shih HP, Patel NA, Freude KK, Xie R, et al. (2012) A Sox9/Fgf feed-forward loop maintains pancreatic organ identity. Development 139:3363–3372
- 54. McDonald E, Li J, Krishnamurthy M, Fellows GF, Goodyer CG, et al. (2011) SOX9 regulates endocrine cell differentiation during human fetal pancreas development. Int J Biochem Cell Biol 44:72–83
- 55. Takahashi K, Tanabe K, Ohnuki M, Narita M, Ichisaka T, et al. (2007) Induction of Pluripotent Stem Cells from Adult Human Fibroblasts by Defined Factors. Cell 131:861–872
- 56. Wells JM, Melton DA (1999) Vertebrate endoderm development. Annu Rev Cell Dev Bi 15:393–410
- 57. Liang J, Wan M, Zhang Y, Gu P, Xin H, et al. (2008) Nanog and Oct4 associate with unique transcriptional repression complexes in embryonic stem cells. Nat Cell Biol 10:731–739