Physiological and Molecular Responses of Six Apple Rootstocks to Osmotic Stress
Abstract
:1. Introduction
2. Results
2.1. Physiological Changes in Response to Osmotic Stress
2.2. Changes in ABA Levels under Osmotic Stress
2.3. Changes in ORGs Gene Expression under Osmotic Stress
3. Discussion
3.1. The Physiological Changes under Osmotic Stress in Apple Rootstocks
3.2. Changes in ABA Content under Osmotic Stress
3.3. Differential Expression of ORGs in Apple Rootstocks
4. Conclusions
5. Materials and Methods
5.1. Plant Materials and Samples Collection
5.2. Measurement of Physiological Changes
5.3. Extraction and Analysis of ABA
5.4. RNA Extraction and Gene Expression Analyses
5.5. Statistical Analysis
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
References
- Reig, G.; Lordan, J.; Fazio, G.; Grusak, M.A.; Hoying, S.; Cheng, L.; Francescatto, P.; Robinson, T. Horticultural performance and elemental nutrient concentrations on ‘Fuji’ grafted on apple rootstocks under New York State climatic conditions. Sci. Hortic. (Amst.) 2018, 227, 22–37. [Google Scholar] [CrossRef]
- Marini, R.P.; Autio, W.R.; Black, B.; Cline, J.A.; Cowgill, W.; Crassweller, R.; Domoto, P.; Hampson, C.; Moran, R.; Parra-Quezada, R.A.; et al. Summary of the NC-140 Apple Physiology Trial: The Relationship Between “Golden Delicious” Fruit Weight and Crop Density at 12 locations as Influenced by Three Dwarfing Rootstocks. J. Am. Pomol. Soc. 2012, 66, 78–90. [Google Scholar]
- Lordan, J.; Fazio, G.; Francescatto, P.; Robinson, T. Effects of apple (Malus × domestica) rootstocks on scion performance and hormone concentration. Sci. Hortic. (Amst.) 2017, 225, 96–105. [Google Scholar] [CrossRef]
- Tworkoski, T.; Fazio, G. Effects of Size-Controlling Apple Rootstocks on Growth, Abscisic Acid, and Hydraulic Conductivity of Scion of Different Vigor. Int. J. Fruit Sci. 2015, 15, 369–381. [Google Scholar] [CrossRef]
- Fazio, G.; Aldwinckle, H.; Robinson, T.; Biology, M. Unique Characteristics of Geneva Apple Rootstocks. N. Y. Fruit Q. 2013, 21, 25–28. [Google Scholar]
- Tworkoski, T.; Fazio, G.; Glenn, D.M. Apple rootstock resistance to drought. Sci. Hortic. (Amst.) 2016, 204, 70–78. [Google Scholar] [CrossRef] [Green Version]
- Liu, B.; Li, M.; Cheng, L.; Liang, D.; Zou, Y.; Ma, F. Influence of rootstock on antioxidant system in leaves and roots of young apple trees in response to drought stress. Plant Growth Regul. 2012, 67, 247–256. [Google Scholar] [CrossRef]
- Choi, B.H.; Bhusal, N.; Jeong, W.T.; Park, I.H.; Han, S.G.; Yoon, T.M. Drought tolerance of ‘fuji’ apple trees grafted onto g, cg, or m series rootstocks: Growth and physiology. Hortic. Sci. Technol. 2020, 38, 583–594. [Google Scholar] [CrossRef]
- Kautz, B.; Noga, G.; Hunsche, M. PEG and drought cause distinct changes in biochemical, physiological and morphological parameters of apple seedlings. Acta Physiol. Plant. 2015, 37, 162. [Google Scholar] [CrossRef]
- Marini, R.P.; Fazio, G. Apple Rootstocks. Hortic. Rev. (Am. Soc. Hortic. Sci.) 2018, 45, 197–312. [Google Scholar] [CrossRef]
- Moran, R.E.; Peterson, B.J.; Fazio, G.; Cline, J. Genotypic variation in apple rootstock low temperature tolerance during spring and fall. J. Am. Soc. Hortic. Sci. 2018, 143, 319–332. [Google Scholar] [CrossRef] [Green Version]
- Cline, J.A.; Hunter, D.M.; Bonn, W.G.; Bijl, M. Resistance of the Vineland Series of Apple Rootstocks to Fire Bilight Caused By Erwinia amylovora. J. Am. Pomol. Soc. 2001, 55, 218–221. [Google Scholar]
- Yin, R.; Bai, T.; Ma, F.; Wang, X.; Li, Y.; Yue, Z. Physiological responses and relative tolerance by Chinese apple rootstocks to NaCl stress. Sci. Hortic. (Amst.) 2010, 126, 247–252. [Google Scholar] [CrossRef]
- Jiménez, S.; Dridi, J.; Gutiérrez, D.; Moret, D.; Irigoyen, J.J.; Moreno, M.A.; Gogorcena, Y. Physiological, biochemical and molecular responses in four Prunus rootstocks submitted to drought stress. Tree Physiol. 2013, 33, 1061–1075. [Google Scholar] [CrossRef] [PubMed]
- Xu, H.; Ediger, D. Rootstocks with different vigor influenced scion–water relationships and stress responses in ambrosiatm apple trees (Malus domestica var. ambrosia). Plants 2021, 10, 641. [Google Scholar] [CrossRef] [PubMed]
- Marchioretto, L.D.R.; De Rossi, A.; do Amaral, L.O.; de Souza Ribeiro, A.M.A. Tolerance of apple rootstocks to short-term waterlogging. Cienc. Rural. St. Mariaria 2018, 48, e20170940. [Google Scholar] [CrossRef] [Green Version]
- Robinson, T.L.; Barritt, B.H. Endogenous Abscisic Acid Concentrations, Vegetative Growth, and Water Relations of Apple Seedlings following PEG-induced Water Stress. J. Am. Soc. Hortic. Sci. 1990, 115, 991–999. [Google Scholar] [CrossRef]
- Taiz, L.; Zeiger, E. Plant Physiology, 3rd ed.; Sinauer Associates, Inc. Publishers: Sunderland, MA, USA, 2003; ISBN 0878938230. [Google Scholar]
- Aloni, B.; Cohen, R.; Karni, L.; Aktas, H.; Edelstein, M. Hormonal signaling in rootstock-scion interactions. Sci. Hortic. (Amst.) 2010, 127, 119–126. [Google Scholar] [CrossRef]
- Ishitani, M.; Xiong, L.; Stevenson, B.; Zhu, J.-K. Genetic Analysis of Osmotic and Cold Stress Signal Transduction in Arabidopsis: Interactions and Convergence of Abscisic Acid-Dependent and Abscisic Acid-Independent Pathways. Plant Cell 1997, 9, 1935–1949. [Google Scholar] [CrossRef]
- Aroca, R. Plant Responses to Drought Stress: From Morphological to Molecular Features; Springer: Berlin/Heidelberg, Germany, 2013; ISBN 9783642326530. [Google Scholar]
- Fujita, Y.; Yoshida, T.; Yamaguchi-Shinozaki, K. Pivotal role of the AREB/ABF-SnRK2 pathway in ABRE-mediated transcription in response to osmotic stress in plants. Physiol. Plant. 2013, 147, 15–27. [Google Scholar] [CrossRef]
- Lee, S.C.; Luan, S. ABA signal transduction at the crossroad of biotic and abiotic stress responses. Plant Cell Environ. 2012, 35, 53–60. [Google Scholar] [CrossRef]
- Shao, Y.; Qin, Y.; Zou, Y.; Ma, F. Genome-wide identification and expression profiling of the SnRK2 gene family in Malus prunifolia. Gene 2014, 552, 87–97. [Google Scholar] [CrossRef] [PubMed]
- Bassett, C. Water use and drought response in cultivated and wild apples. In Abiotic Stress-Plant Responses and Applications in Agriculture; Vahdati, K., Leslie, C., Eds.; InTech: London, UK, 1024; ISBN 978-953-51-1024-8. [Google Scholar] [CrossRef] [Green Version]
- Li, H.; Zhao, Q.; Sun, X.; Jia, H.; Ran, K. Bioinformatic identification and expression analysis of the Malus domestica DREB2 transcription factors in different tissues and abiotic stress. J. Plant Biochem. Biotechnol. 2017, 26, 436–443. [Google Scholar] [CrossRef]
- Zhao, K.; Shen, X.; Yuan, H.; Liu, Y.; Liao, X.; Wang, Q.; Liu, L.; Li, F.; Li, T. Isolation and characterization of dehydration-responsive element-binding factor 2C (MsDREB2C) from Malus sieversii Roem. Plant Cell Physiol. 2013, 54, 1415–1430. [Google Scholar] [CrossRef] [Green Version]
- Zhao, T.; Liang, D.; Wang, P.; Liu, J.; Ma, F. Genome-wide analysis and expression profiling of the DREB transcription factor gene family in Malus under abiotic stress. Mol. Genet. Genom. 2012, 287, 423–436. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Xie, Y.; Lu, L.; Yan, M.; Fang, N.; Xu, J.; Wang, L.; Yan, Y.; Zhao, T.; van Nocker, S.; et al. Contribution of methylation regulation of MpDREB2A promoter to drought resistance of Mauls prunifolia. Plant Soil 2019, 441. [Google Scholar] [CrossRef]
- Agarwal, P.K.; Agarwal, P.; Reddy, M.K.; Sopory, S.K. Role of DREB transcription factors in abiotic and biotic stress tolerance in plants. Plant Cell Rep. 2006, 25, 1263–1274. [Google Scholar] [CrossRef]
- Kimura, M.; Yamamoto, Y.Y.; Seki, M.; Sakurai, T.; Sato, M.; Abe, T.; Yoshida, S.; Manabe, K.; Shinozaki, K.; Matsui, M. Rapid Communication Identification of Arabidopsis Genes Regulated by High Light-Stress Using cDNA Microarray. Photochem. Photobiol. 2003, 77, 226–233. [Google Scholar]
- Kiyosue, T.; Yamaguchi-Shinozaki, K.; Shinozaki, K. Cloning of cDNAs for genes that are early-responsive to dehydration stress (ERDs) in Arabidopsis thaliana L.: Identification of three ERDs as HSP cognate genes. Plant Mol. Biol. 1994, 25, 791–798. [Google Scholar] [CrossRef] [PubMed]
- Alves, M.S.; Fontes, E.P.B.; Fietto, L.G. EARLY RESPONSIVE to DEHYDRATION 15, a new transcription factor that integrates stress signaling pathways. Plant Signal. Behav. 2011, 6, 1993–1996. [Google Scholar] [CrossRef] [Green Version]
- Li, J.; Besseau, S.; Törönen, P.; Sipari, N.; Kollist, H.; Holm, L.; Palva, E.T.; Petri, T. Defense-related transcription factors WRKY70 and WRKY54 modulate osmotic stress tolerance by regulating stomatal aperture in Arabidopsis. New Phytol. 2013, 200, 457–472. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dong, Q.; Zheng, W.; Duan, D.; Huang, D.; Wang, Q.; Liu, C.; Li, C.; Gong, X.; Li, C.; Mao, K.; et al. MdWRKY30, a group IIa WRKY gene from apple, confers tolerance to salinity and osmotic stresses in transgenic apple callus and Arabidopsis seedlings. Plant Sci. 2020, 299, 110611. [Google Scholar] [CrossRef] [PubMed]
- Meng, D.; Li, Y.; Bai, Y.; Li, M.; Cheng, L. Genome-wide identification and characterization of WRKY transcriptional factor family in apple and analysis of their responses to waterlogging and drought stress. Plant Physiol. Biochem. 2016, 103, 71–83. [Google Scholar] [CrossRef] [PubMed]
- Ambawat, S.; Sharma, P.; Yadav, N.R.; Yadav, R.C. MYB transcription factor genes as regulators for plant responses: An overview. Physiol. Mol. Biol. Plants 2013, 19, 307–321. [Google Scholar] [CrossRef] [Green Version]
- Cao, Z.H.; Zhang, S.Z.; Wang, R.K.; Zhang, R.F.; Hao, Y.J. Genome Wide Analysis of the Apple MYB Transcription Factor Family Allows the Identification of MdoMYB121 Gene Confering Abiotic Stress Tolerance in Plants. PLoS ONE 2013, 8, e69955. [Google Scholar] [CrossRef]
- Wang, R.K.; Cao, Z.H.; Hao, Y.J. Overexpression of a R2R3 MYB gene MdSIMYB1 increases tolerance to multiple stresses in transgenic tobacco and apples. Physiol. Plant. 2014, 150, 76–87. [Google Scholar] [CrossRef]
- Dombrecht, B.; Xue, G.P.; Sprague, S.; Kirkegaard, J.; Ross, J.; Reid, J.; Fitt, G.P.; Sewelam, N.; Schenk, P.M.; Manners, J.M.; et al. MYC2 Differentially Modulates Diverse Jasmonate-Dependent Functions in Arabidopsis. Plant Cell 2007, 19, 2225–2245. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Boter, M.; Ruı, O.; Abdeen, A.; Ruı-Rivero, O.; Abdeen, A.; Prat, S. Conserved MYC transcription factors play a key role in jasmonate signaling both in tomato and Arabidopsis. GENES Dev. 2004, 2, 1577–1591. [Google Scholar] [CrossRef] [Green Version]
- Li, K.; Xing, C.; Yao, Z.; Huang, X. PbrMYB21, a novel MYB protein of Pyrus betulaefolia, functions in drought tolerance and modulates polyamine levels by regulating arginine decarboxylase gene. Plant Biotechnol. J. 2017, 15, 1186–1203. [Google Scholar] [CrossRef] [Green Version]
- Kazan, K.; Manners, J.M. MYC2: The Master in Action. Mol. Plant 2013, 6, 686–703. [Google Scholar] [CrossRef] [Green Version]
- Silva, K.J.P.; Mahna, N.; Mou, Z.; Folta, K.M. NPR1 as a transgenic crop protection strategy in horticultural species. Hortic. Res. 2018, 5, 16–18. [Google Scholar] [CrossRef] [Green Version]
- Bassett, C.L.; Baldo, A.M.; Moore, J.T.; Jenkins, R.M.; Soffe, D.S.; Wisniewski, M.E.; Norelli, J.L.; Farrell, R.E. Genes responding to water deficit in apple (Malus × domestica Borkh.) roots. BMC Plant Biol. 2014, 14, 182. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, R.; Liu, C.; Zhao, R.; Wang, L.; Chen, L.; Yu, W.; Zhang, S.; Sheng, J.; Shen, L. CRISPR/Cas9-Mediated SlNPR1 mutagenesis reduces tomato plant drought tolerance. BMC Plant Biol. 2019, 19, 1–13. [Google Scholar] [CrossRef] [Green Version]
- Dong, Q.L.; Wang, C.R.; Liu, D.D.; Hu, D.G.; Fang, M.J.; You, C.X.; Yao, Y.X.; Hao, Y.J. MdVHA-A encodes an apple subunit A of vacuolar H+-ATPase and enhances drought tolerance in transgenic tobacco seedlings. J. Plant Physiol. 2013, 170, 601–609. [Google Scholar] [CrossRef] [PubMed]
- Li, C.; Wei, Z.; Liang, D.; Zhou, S.; Li, Y.; Liu, C.; Ma, F. Enhanced salt resistance in apple plants overexpressing a Malus vacuolar Na+/H+ antiporter gene is associated with differences in stomatal behavior and photosynthesis. Plant Physiol. Biochem. 2013, 70, 164–173. [Google Scholar] [CrossRef] [PubMed]
- Hu, D.; Wang, S.; Luo, H.; Ma, Q.; Yao, Y.; You, C.; Hao, Y. Overexpression of MdVHA-B, a V-ATPase gene from apple, confers tolerance to drought in transgenic tomato. Sci. Hortic. (Amst.) 2012, 145, 94–101. [Google Scholar] [CrossRef]
- Chaves, M.M.; Maroco, J.P.; Pereira, J.S. Understanding plant responses to drought-From genes to the whole plant. Funct. Plant Biol. 2003, 30, 239–264. [Google Scholar] [CrossRef] [PubMed]
- Wright, D.E.J.; Cline, J.A.; Earl, H.J. Physiological responses of four apple (Malus × domestica borkh.) rootstock genotypes to soil water deficits. Can. J. Plant Sci. 2019, 99, 510–524. [Google Scholar] [CrossRef]
- Zhu, Y.f.; Wu, Y.x.; Hu, Y.; Jia, X.m.; Zhao, T.; Cheng, L.; Wang, Y. xiu Tolerance of two apple rootstocks to short-term salt stress: Focus on chlorophyll degradation, photosynthesis, hormone and leaf ultrastructures. Acta Physiol. Plant. 2019, 41. [Google Scholar] [CrossRef]
- Sakalauskaite, J.; Kviklys, D.; Lanauskas, J.; Duchovskis, P. Biomass production, dry weight partitioning and leaf area of apple rootstocks under drought stress. Sodininkystë Darzininkystë 2006, 25, 283–291. [Google Scholar]
- Sun, X.P.; Yan, H.L.; Kang, X.Y.; Ma, F.W. Growth, gas exchange, and water-use efficiency response of two young apple cultivars to drought stress in two scion-one rootstock grafting system. Photosynthetica 2013, 51, 404–410. [Google Scholar] [CrossRef]
- Davies, W.J.; Kudoyarova, G.; Hartung, W. Long-distance ABA signaling and its relation to other signaling pathways in the detection of soil drying and the mediation of the plant’s response to drought. J. Plant Growth Regul. 2005, 24, 285–295. [Google Scholar] [CrossRef] [Green Version]
- Kamboj, J.S.; Browning, G.; Blake, P.S.; Quinlan, J.D.; Baker, D.A. GC-MS-SIM analysis of abscisic acid and indole-3-acetic acid in shoot bark of apple rootstocks. Plant Growth Regul. 1999, 28, 21–27. [Google Scholar] [CrossRef]
- Fujita, Y.; Fujita, M.; Shinozaki, K.; Yamaguchi-Shinozaki, K. ABA-mediated transcriptional regulation in response to osmotic stress in plants. J. Plant Res. 2011, 124, 509–525. [Google Scholar] [CrossRef] [PubMed]
- Nakashima, K.; Yamaguchi-Shinozaki, K. Regulons involved in osmotic stress-responsive and cold stress-responsive gene expression in plants. Physiol. Plant. 2006, 126, 62–71. [Google Scholar] [CrossRef]
- Tuteja, N. Abscisic acid and abiotic stress signaling. Plant Signal. Behav. 2007, 2, 135–138. [Google Scholar] [CrossRef] [Green Version]
- Zhou, C.; Lin, Q.; Lan, J.; Zhang, T.; Liu, X.; Miao, R.; Mou, C.; Nguyen, T.; Wang, J.; Zhang, X.; et al. WRKY Transcription Factor OsWRKY29 Represses Seed Dormancy in Rice by Weakening Abscisic Acid Response. Front. Plant Sci. 2020, 11, 1–15. [Google Scholar] [CrossRef]
- Jayakannan, M.; Bose, J.; Babourina, O.; Shabala, S.; Massart, A.; Poschenrieder, C.; Rengel, Z. The NPR1-dependent salicylic acid signalling pathway is pivotal for enhanced salt and oxidative stress tolerance in Arabidopsis. J. Exp. Bot. 2015, 66, 1865–1875. [Google Scholar] [CrossRef] [Green Version]
- Srinivasan, T.; Kumar, K.R.R.; Meur, G.; Kirti, P.B. Heterologous expression of Arabidopsis NPR1 (AtNPR1) enhances oxidative stress tolerance in transgenic tobacco plants. Biotechnol. Lett. 2009, 31, 1343–1351. [Google Scholar] [CrossRef]
- Seo, S.Y.; Wi, S.J.; Park, K.Y. Functional switching of NPR1 between chloroplast and nucleus for adaptive response to salt stress. Sci. Rep. 2020, 10, 4339. [Google Scholar] [CrossRef] [Green Version]
- Zhang, X.H.; Li, B.; Hu, Y.G.; Chen, L.; Min, D.H. The wheat E subunit of V-Type H+-ATPase is involved in the plant response to osmotic stress. Int. J. Mol. Sci. 2014, 15, 16196–16210. [Google Scholar] [CrossRef] [Green Version]
- Jensen, P.J.; Makalowska, I.; Altman, N.; Fazio, G.; Praul, C.; Maximova, S.N.; Crassweller, R.M.; Travis, J.W.; McNellis, T.W. Rootstock-regulated gene expression patterns in apple tree scions. Tree Genet. Genomes 2010, 6, 57–72. [Google Scholar] [CrossRef]
- Bajji, M.; Kinet, J.M.; Lutts, S. The use of the electrolyte leakage method for assessing cell membrane stability as a water stress tolerance test in durum wheat. Plant Growth Regul. 2002, 36, 61–70. [Google Scholar] [CrossRef]
- Aneja, B.; Yadav, N.R.; Kumar, N.; Yadav, R.C. Hsp transcript induction is correlated with physiological changes under drought stress in Indian mustard. Physiol. Mol. Biol. Plants 2015, 21, 305–316. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Erland, L.A.E.; Shukla, M.R.; Glover, W.B.; Saxena, P.K. A simple and efficient method for analysis of plant growth regulators: A new tool in the chest to combat recalcitrance in plant tissue culture. Plant Cell. Tissue Organ Cult. 2017, 131, 459–470. [Google Scholar] [CrossRef]
- Gasic, K.; Hernandez, A.; Korban, S.S. RNA Extraction From Different Apple Tissues Rich in Polyphenols and Polysaccharides for cDNA. Plant Mol. Biol. Report. 2004, 22, 437a–437g. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
Accession # | Gene Name | Forward Primer | Reverse Primer |
---|---|---|---|
DQ341381.1 | EF1A | ATTCAAGTATGCCTGGGTGC | CAGTCAGCCTGTGATGTTCC |
NM_001294018.1 | DREB | GCAATTACAGGGGAGTGCG | ATAGGCAAGGGCAGCATCA |
JX569851.1 | SnRK | AGCCAAAATTCCTCCTCCA | TTCTTCCTCCTCGCCTTCT |
XM_029092593.1 | ERD | TTTATCCCTGCGGCTCTCC | CTGAGCCAGTAGTCGTGGT |
EF128033.1 | ATPASE | TTGAGGATCCAGCTGAAGG | CAAGAGCACGGAAACCACT |
XM_008377742.2 | WRKY29 | AGCTGTGGTAAGAGGGTGC | GGCTTCAAAGGCCTGAGGA |
NM_001328944.1 | MYC2 | GCAACGAGGAGGGGATATT | GTCCGAGTGGTCTGAATCG |
>DQ074459.1 | MYB2 | AGCCACCGAACAGCCTAAT | TGGAATCGGCCTTGGGAAT |
XM_008392806.2 | NPR1 | CGTGGTGAGGTCTAATGGTG | TTGGGTGCCAATGTTCTCTC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hezema, Y.S.; Shukla, M.R.; Ayyanath, M.M.; Sherif, S.M.; Saxena, P.K. Physiological and Molecular Responses of Six Apple Rootstocks to Osmotic Stress. Int. J. Mol. Sci. 2021, 22, 8263. https://doi.org/10.3390/ijms22158263
Hezema YS, Shukla MR, Ayyanath MM, Sherif SM, Saxena PK. Physiological and Molecular Responses of Six Apple Rootstocks to Osmotic Stress. International Journal of Molecular Sciences. 2021; 22(15):8263. https://doi.org/10.3390/ijms22158263
Chicago/Turabian StyleHezema, Yasmine S., Mukund R. Shukla, Murali M. Ayyanath, Sherif M. Sherif, and Praveen K. Saxena. 2021. "Physiological and Molecular Responses of Six Apple Rootstocks to Osmotic Stress" International Journal of Molecular Sciences 22, no. 15: 8263. https://doi.org/10.3390/ijms22158263