2.1 Reagents
β-Sitosterol(wkq-00044, 98%purity)was acquired from Sichuan Victory Biological Technology Co., Ltd. Ibuprofen (National Drug Certificate No.H20066822) purchased from The First Hospital of Jinan University. Lipopolysaccharide 055:B5 (L2880), TAK-242 (S80562), JSH-23 (M134534) were purchased from Guangzhou Yiyou Biotechnology CO.,Ltd(China). ELISA Kits of IL-1β (MM-0047R2), IL-4 (MM-0191R2), IL-8 (MM-0175R2), IFN-γ (MM-0198R2) were purchased from MEIMIAN Industrial Co., Ltd. (CHINA). The antibodies used for immunohistochemistry were TLR4 (35463, SAB), Cox-2 (12282T, CST), IBA-1 (17198T, CST). The antibodies used for Western Blotting were β-actin (380624, ZENBIO), TLR4 (35463, SAB), MyD88 (340629, ZENBIO), NF-κB (R25149, ZENBIO), p-NF-κB (310314, ZENBIO), IL-1β (516288, ZENBIO), Cox-2 (12282T, CST), IBA-1 (17198T, CST), Arg-1 (93668T, CST), iNOS (13120S, CST), secondary antibody(A32731TR, A32727, Thermo). Prestained Protein Marker (G2058-250UL) was acquired from Servicebio (China). The polyvinylidene fluoride (PVDF) membrane was obtained from Millipore (Billerica, USA). Radioimmunoprecipitation assay (RIPA) (WB-0017) was purchased in Guangzhou Dingguo Biological Co., Ltd. (China). A Cell Membrane Protein and Cytoplasmic Protein Extraction Kit (BL671A) was purchased from Biosharp Biotechnology Co., Ltd. (China). Primary antibody diluent, secondary antibody dilution, Western Blot transfer solution, Western Blot electrophoresis solution, Quick block buffer, and immunolfluorescence staining kit were purchased from Beyotime Biotechnology (Shanghai, China). Ultra-sensitive ECL luminescent reagent (MA0186-1, Meilunbio). SYBR Green Premix qPCR, an RT–PCR Kit, and RNase Free water (AG11701, AG11602, AG11012) were obtained from Accurate Biotechnology Co. Ltd. (China). APC anti-mouse CD206 (MMR) (141708, Biolegend), PE anti-mouse CD32 (Fcgr2) (156404, Biolegend), fixation buffer (420801) and intracellular staining perm wash buffer (421002) were purchased from Dakewe Biotech Co.,Ltd. (Shenzhen, China).
2.2 Subjects
Thirty-two male Sprague-Dawley rats aged 8 weeks weighing approximately 180-200g were purchased from the experimental center of Beijing Huafu Kang Co.Ltd. Five rats were housed per cage according to the standard of the Animal Experiment Center of the Medical College of Jinan University, and were quarantined and acclimatized to the environment for 10 days before the official start of the experiment. Animal ethics application No.20220314-12.
2.3 Sciatica model
We performed chronic constriction injury (CCI) processing on Sprague-Dawley rats to form a sciatica model(Chang, et al. 2022; Yoon et al. 1994; Zhang et al. 2020). First, we injected sodium pentobarbital (3%; 40 mg/kg) into the Sprague-Dawley rats, and after they lost consciousness, we fixed the limbs with immobilizers and performed surgery. The right sciatic nerve was fully exposed, and four consecutive ligatures were made on the right sciatic nerve with 4.0 sutures under the microscope, each ligature positioned about 1 mm apart, and the muscle and skin were sutured, after which a dose (10 mg/ml,i.m.) of penicillin was injected at about 1 cm from the wound. In the sham-operated group, only the skin and muscle were cut and sutured, and no ligation was performed.
2.4 In vivo drug treatment
Thirty-two Sprague-Dawley male rats were randomly divided into four groups (8 rats in each group), which were sham-operated group(Sham); model group (CCI); ibuprofen group (Ibuprofen); and β-sitosterol group (β-sitosterol). The sham-operated and CCI groups were gavaged with saline (0.9%, 6 ml/kg/bid); the ibuprofen group was gavaged with ibuprofen solution (10 mg/kg/bid); the β-sitosterol group was gavaged with β-sitosterol solution (50 mg/kg/bid)(Liu, et al. 2019). The drug was given continuously from the first day after the procedure until day 21.
2.5 Behavioral experiments
We performed behavioral tests on all rats on the day before surgery (day 0) and on postoperative days 1, 4, 7, 14, and 21, recorded mechanical pain sensitivity by Von-Fery experiment observation. The rat was placed in a container with a hollow bottom plate, and after the rat finished the exploratory behavior, the right hind limb of the rat was stimulated with Von-Fery filaments of different pressure values, and the rapid lifting of the right hind limb was regarded as a positive response, and the corresponding pressure value of Von-Fery filaments at this time was paw mechanical withdrawal threshold (PMWT) (when the pressure value was greater than 26, it was recorded as 26). All operations were repeated three times, each at 10-minute intervals.
2.6 Hematoxylin-eosin staining
Freshly excised livers, kidneys and sciatic nerves were soaked in 4% paraformaldehyde for 24 hours. Next, ethanol gradient dehydration, paraffin embedding, sectioning, dewaxing, hydration, hematoxylin staining, eosin staining, dehydration, and finally clear sealing of the slices. All images were taken using an ortho-fluorescence microscope (Olympus ,Japan)and quantified using image J.
2.7 ELISA
On postoperative day 21, 8-10 ml of blood was collected from the abdominal aorta of each rat and centrifuged at 4°C for 15 minutes at 3000 rpm. Remove the supernatant (serum) and transfer to a new centrifuge tube for storage at -20°C. The experiment was carried out according to the ELISA kit instructions, and the optical density (OD) was detected by microplate reader (Bio Tek Corporation, USA), and the corresponding cytokine levels in the serum were finally calculated.
2.8 Immunohistochemistry
The removed right sciatic nerve tissue was soaked in 4% paraformaldehyde for 24 hours, then dehydrated and wrapped in paraffin wax and cut into sections of 3 μm thickness, dewaxed, and antigenically repaired with EDTA (PH 9.0), the tissue sections were incubated in 3% hydrogen peroxide solution for 25 minutes at room temperature and protected from light to block endogenous peroxidase, and the tissue was closed at room temperature by adding 3% BSA in drops in the histochemical circle to evenly cover the tissue 30 min, plus primary antibody incubated overnight at 4°C in a wet box, plus secondary antibody incubated for 50 min at room temperature, DAB color development, hematoxylin re-stained cell nuclei, dehydrated and sealed. All images were taken using an ortho-fluorescence microscope (Olympus ,Japan)and quantified using image J.
2.9 In vitro cell culture
The microglial cells used in our in vitro cell experiments were GMI-R1 cell line obtained from Huatuo Biotechnology Biological Co., Ltd. (China), and cells between generation 4th to 10th were used in the experiments. Cells were cultured in 4.5g/L D-Glucose Dulbecco’s Modified Eagle Medium (DMEM) containing 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin mixture, and cell incubator control carbon dioxide concentration of 5% temperature of 37 ℃. Passage of cells when 70% of the culture flask is full.
2.10 Cellular experiment grouping and dosing
All cell experiments were divided into six groups: control group; LPS group (10μg/ml LPS); LPS+TAK-242 group (10μg/ml LPS+10μM TAK-242); LPS+JSH-23 group(10μg/ml LPS+10μM JSH-23); LPS+β-sitosterol group (10μg/ml LPS+40μM β-sitosterol); β-sitosterol group (40μM β-sitosterol).
2.11 Cell viability determination
Cells were inoculated in 96-well plates at 5×103 per well, incubated in the incubator for 24 h and then replaced with new medium and added drug (set drug concentration gradient), after which they were incubated in the incubator for another 24 h. The liquid in the wells was removed with a pipette gun and CCK8 reagent (diluted with DMEM) was added, incubated in the incubator for 1 to 4 h. The absorbance of each well was measured at a wavelength of 450 nm on a microplate reader. (the volume of liquid in the wells was controlled at 100 μl for all the above cell manipulations).
2.12 Western blotting (WB)
We measured the relative expression of various proteins in different groups using WB. We extracted histones from sciatic nerve tissue and cytosolic proteins from GMI-R1 cells. Proteins of different molecular weight sizes were separated by 10% SDS-PAGE and then transferred onto PVDF membranes, and the membranes was blocked by Quick blocking buffer, primary antibodies were incubated overnight (at least 8 hours) and secondary antibodies were incubated for one hour. The ultra-sensitive ECL luminescent reagent was sprinkled on the completed incubated PVDF membrane and imaged with the ChemiDoc MP imaging system (BIO-RAD).
2.13 Quantitative real-time PCR (qRT-PCR)
We extracted total RNA using RNAiso Plus, then reverse transcribed the RNA to cDNA using RT–PCR kit according to the manufacturer’s instructions, and finally the cDNA was mixed with SYBR Green Premix qPCR and primers and then qRT-PCR was performed using BIO-RAD CFX96 Real-Time PCR System (BIO-RAD, United States). The relative expression of mRNA was calculated according to the 2-ΔΔCq method(Zhang et al. 2021) and then normalized by the mRNA expression level of β-actin. All primer sequences used are listed in Table 1.
Table 1 Primer sequences of qPCR
Gene
|
Forwards primer (5'->3')
|
Reverse primer (5'->3')
|
β-actin
TLR4
|
CCTAGACTTCGAGCAAGAGA
ATCAGTGTATCGGTGGTCAGT
|
GGAAGGAAGGCTGGAAGA
AGCCAGCAATAAGTATCAGGT
|
IL1β
|
AGGAGAGACAAGCAACGACA
|
CTTTTCCATCTTCTTCTTTGGGTAT
|
TNF-α
|
GCGTGTTCATCCGTTCTCTACC
|
TACTTCAGCGTCTCGTGTGTTTCT
|
IL6
|
AGTTGCCTTCTTGGGACTGATGT
|
GGTCTGTTGTGGGTGGTATCCTC
|
IL10
|
AGGGTTACTTGGGTTGCC
|
GGGTCTTCAGCTTCTCTCC
|
IL4
|
CAAGGAACACCACGGAGAA
|
AGCACGGAGGTACATCACG
|
Arg-1
|
CAGTATTCACCCCGGCTA
|
CCTCTGGTGTCTTCCCAA
|
iNOS
CD32
|
CGGAGAACAGCAGAGTTGG
CCCACAACACCAAGAACTG
|
GGAATAGCACCTGGGGTTT
CCCACAACACCAAGAACTG
|
2.14 Flow cytometry analysis
The cells were digested with trypsin, then washed three times with PBS (centrifuged with low speed at room temperature and resuspended). PE-conjugated monoclonal mouse CD32 antibodies can be directly bound to cell membrane proteins, incubated at 4℃ for 20 minutes, then washed three times with PBS, and finally resuspended with 500μl of PBS. APC-conjugated monoclonal mouse CD206 antibodies need to be fixed with Fixation Buffer, then washed three times with Intracellular Staining Perm Wash Buffer, then incubated at 4℃ for 20 minutes, next washed three times with Intracellular Staining Perm Wash Buffer, and resuspended with 500μl of Intracellular Staining Perm Wash Buffer finally. All prepared cell suspensions were assayed with flow cytometer (Cyto-FLEX, Beckman Coulter, USA) and data analyzed with FlowJo software.
2.15 Immunofluorescence assay
The slices were placed in a six-well plate, inoculated with cells for group culture, and washed with PBS soak after the culture was completed, then fixed with 4% paraformaldehyde at room temperature for 30 min, washed again with PBS and then closed with 3% BSA drop in the circle at room temperature for 30 min, poured off the closure solution plus primary antibody (1:200) and incubated flat in a wet box at 4°C overnight, and the next day secondary antibody (1:400) was incubated for 50 min, followed by DAPI re-staining of the nuclei for 10 min, and finally sealing with anti-fluorescence quenching sealer. All images were taken using an ortho-fluorescence microscope (Olympus ,Japan)and quantified using image J.
2.16 Data Analysis
All experimental data were processed and analyzed using GraphPad Prism 8.0.2 and statistical plots were generated. Behavioral data were analyzed using repeated-measures ANOVA and other experimental data were analyzed using one-way ANOVA. Multiple comparisons tests were then performed, and P values less than 0.05 were considered statistically significant. (All experiments were repeated at least three times).
2.17 Signaling Pathways
2.18 Flow chart