2.1. Data download and analysis
GBM and LGG RNA-seq datasets and their associated clinical information were obtained from the TCGA database [12]. Forty GBM and 80 LGG samples were selected for Differential Expression Analysis (DEA). Transcriptome data were analyzed using the edgeR package[13]. The p-values were adjusted using the Benjamini-Houchberg method[14]. Subsequently, differentially expressed LncRNAs were chosen for further investigations and volcano plot was created to visualize the DELncRNAs utilizing R Enhanced Volcano package[15] on the basis of False Discovery Rate (FDR) and Log 2 Fold Change.
2.2. Survival Analysis
GEPIA web server was used for analysis of any correlation between OBI1-AS1 gene expression level and patient overall survival[16]. Patients were grouped into low expression and high expression categories according to whether their OBI1-AS1 gene expression level was below the first quartile or above the third quartile, respectively. Consequently, Kaplan-Meier survival analysis was performed for the survival data as presented in Fig.1c.
2.3. ChIP-Seq
The ChIP-Atlas-Enrichment Analysis online tool[17] was used to find the transcription factors (TF) binding to -3000 < TSS < 3000 of OBI1-AS1 transcription start site (TSS) in neural cells. The significance threshold was selected as greater than 100 based on peak caller MACS2 score (-10*Log10 [MACS2 Q-value]) which means that peaks with MACS2 Q-value (FDR) lower than 10E-10 are considered. Moreover, we downloaded Histone marks which were enriched in proximity of OBI1-AS1 TSS using the determined cut-off from the National Bioscience Database Center (NBDC)[18].
2.4. Gene Ontology (GO)
We used OBI1-AS1 co-expressed genes to perform functional annotation. We downloaded FPKM count for TCGA-GBM and TCGA-LGG project from the GDC data portal. Subsequently, we used the Pearson method to compute the correlation coefficient and p-value. Genes with R > 0.5 were selected for functional annotation. Enrichment analysis for Biological Process, Molecular Function, Cellular Component and Pathways involved were conducted by the R TCGAbiolinks package[19].
2.5 Patient samples and IHC diagnosis
Twenty-six GBM and 26 LGG samples were collected from the Shariati Hospital affiliated with Tehran University of Medical Sciences (TUMS). Pathological diagnosis and immunohistochemical analysis of the tumor type was carried out by an expert neuropathologist based on the World Health Organization classification of tumors (grade I to IV). The histopathological diagnosis of the obtained tissue samples was conducted based on immunohistochemical detection of the following proteins: GFAP, OLIG2, p53, KI67, IDH1, ATRX, EGFR. All samples were included in the immunohistochemical and Real-Time PCR analyses. Tumor samples were all collected in RNA Later immediately after surgical resection and stored at -80° centigrade until RNA extraction. Written informed consent was obtained from all patients enrolled in this study. This study fully conforms to the ethical standards of Tehran University of Medical Sciences and the 1975 Helsinki Declaration.
2.6. RNA extraction, cDNA synthesis and quantitative Real-Time PCR
RiboEx™ (GeneAll) was used for RNA extraction and RNA extraction was carried out based on manufacturer’s protocol. Presence of genomic contamination was checked by agarose gel electrophoresis before cDNA synthesis. RNA concentration and presence of contaminants were determined using the NanoDrop 2000 spectrophotometer (Thermo Scientific). cDNA synthesis was performed using the PrimeScript RT reagent (TakaraBio Inc, Shiga, Japan) and qRT-PCR was carried out using the AMPLIQON Real Q Plus 2× Master Mix Green low ROX in the Light Cycler® 96 System (Roche Life Science, Germany) based on the manufacturer’s instructions. Real-time PCR was conducted in duplicates. Primers were designed using the Oligo software and were blasted to check their specificity afterwards. Primer sequences are presented in Table.1 below. Standard curves were created for the setup of the primers and the primers were set up with efficiency equal with 2. Relative quantification of target gene expression was performed using the 2–∆∆Ct method with B2M as the normalizer gene. The Real-time procedure for each sample was as follows:
Incubation for 10 min at 95°C followed by 40 cycles of elongation including 10 s at 95°C and 30 s at 60 °C. To exclude presence of any primer dimers or by-products, dissociation curves were carefully analyzed to check the specificity of the product melting peak. The PCR products were ultimately confirmed by 2% agarose gel electrophoresis.
Table 1.
primers sequences
Gene
|
Forward primer
|
Reverse primer
|
OBI1-AS1
|
GCCCTGAAGCATACCAAAATGT
|
CACAGAAAGTGCCCAAGAGGT
|
B2M
|
AGATGAGTATGCCTGCCGTG
|
GCGGCATCTTCAAACCTCCA
|
2.7. Statistical analysis
The Q-Q plot was used to assess normal distribution of the data. The Mann-Whitney test was carried out for comparison of groups. The ROC curve and the Area Under the Curve (AUC) were used to evaluate the sensitivity and specificity of the LncRNA in distinguishing GBM from LGG. A p-value less than 0.05 was deemed statistically significant for a confidence interval of 95%. Statistical analysis was performed with GraphPad Prism8.