Tight DNA-protein complexes isolated from barley seedlings are rich in potential guanine quadruplex sequences

Chemicals

Tris base, ethidium bromide, agarose, Hind III/λ DNA digest, ethidium bromide (EBr), Na₂EDTA, Na bisulfite, NaOH, LiCl, KCl, NaCl, and other inorganic salts were purchased from Sigma-Aldrich. Sodium dodecyl sulfate was supplied by Acros Organics. Buthoxyethanol, chloroform and isoamylic alcohol were obtained from Stanlab. Restrictases and Proteinas K were purchased from Fermentas.

Plant material

The work was performed using the “Balga” barley cultivar plants. This cultivar was created by Latvian breeders. We used it to study the development-dependent changes in TBP complexes (Sjakste et al., 2009). For DNA extraction, we routinely used about 100 seedlings. To obtain the plant organs, grains were germinated; shoots were grown for 5 days at 30 °C temperature in the darkness. The first leaf, coleoptile and root were dissected and subsequently used for DNA extraction.

Solutions

DNA extraction buffer: 100 mM TrisHCl, pH 7.5; 500 mM NaCl, 50 mM Na₂EDTA, 1.25% SDS and 3.8 g/l Na bisulfite. Filtration buffer: 0.5 M KCl, 5 mM EDTA, 10 mM Tris- HCl, pH 7.4. Elution buffer: elution buffer 5 mM EDTA, 10 mM TrisHCl, pH 7.4. DNase buffer: 10 mM Tris–HCl, pH 7.6; 5 mM MgCl₂. Folding buffer: 10 mM sodium phosphate and 0.3 mM EDTA, pH 7.1.

DNA isolation

Bulk genomic DNA was extracted according to the previously described protocol of chloroform-isoamylic alcohol extraction (Plaschke, Ganal & Röder, 1995), with some modifications. Plant tissues were frozen in liquid nitrogen and ground with a mortar into a fine powder. The powder was suspended in 25 ml of the pre-warmed (65 °C) extraction buffer. The mixture was incubated for 30 min at 65 °C in the same buffer with occasional shaking. DNA was extracted with the same volume of chloroform/isoamilic alcohol mixture (24:1); the suspension was centrifuged, and the water phase was separated. RNA was precipitated with concentrated LiCl solution: the salt was added up to 4M and the mixture incubated for 1 h on ice. The sample was centrifuged to pellet the RNA. DNA was precipitated with 1 volume of butoxyethanol. The quality of DNA was controlled by spectrophotometry. The ratio of the optical density of 260 nm and 280 nm was not less than 2.

Protocols of purification of the tight DNA-protein complexes

Two alternative protocols were used as internal controls. These are based on different principles, and DNA fragments of different sizes are generated in these methods.

Isolation of TBP complexes with DNA using fractionation on nitrocellulose

DNA was digested with Hind III and Pst 1 restrictases or alternatively with Alu I restrictase (1U/1 µg of DNA) at 37 °C overnight in the appropriate buffer. Completeness of DNA digestion was tested by gel electrophoresis. The disappearance of the high-molecular DNA fraction and formation of the smear were criteria for the completeness of digestion. The restrictase-digested DNA sample was diluted in 3 ml of filtration buffer to a final concentration of 25–70 µg/ml. The solution was pressed through a nitrocellulose filter pre-soaked in a filtration buffer (HAWP 025 00, HA 0.45 µ, 25 mm, Millipore) supported in Swinnex filter holder. To avoid cross-contamination of the fractions, the filter was washed up to five times with the same volume (3 ml) of filtration buffer. The filter-retained DNA fraction enriched in the tightly bound proteins was eluted with 3 ml of elution buffer (five washes) and 3 ml of 50 mM NaOH in sequence (Werner & Neuer-Nitsche, 1989). The DNA content of the filtered fraction (F), low-ionic strength eluted fraction (R1) and alkali-eluted fraction (R2) were measured spectrophotometrically on NanoPhotometer NP80 Touch (Implen, Munich, Germany). A schematic presentation of protocols was published previously (Sjakste et al., 2009). Cloning was performed with the leaf F fraction DNA (FF), coleoptile R1 and R2 fraction and DNA extracted from the coleoptiles, leaves and roots (CR1, CR2, LR1, LR2, RR1, RR2 fractions respectively).

Isolation of TBP complexes with DNA using exhaustive Dnase I digestion

The DNA was digested with DNase I (Fermentas) (1U/100 µg, room temperature, overnight) in 10 mM Tris–HCl, pH 7.6; 5 mM MgCl₂. Completeness of digestion was monitored by gel electrophoresis. A faint band of about 100 bp was sometimes visible. To obtain the residual DNA fragments, the digest was incubated with Proteinase K (0.5 mg/ml) and SDS (0.5%) overnight at 37 °C and deproteinized with chloroform. Remnants of DNA were precipitated with ethanol (Avramova, Georgiev & Tsanev, 1994; scheme in Sjakste et al., 2009). DNA fragments were obtained from coleoptiles, first leaves and roots, with fractions called Cd, FLd and Rd, respectively.

Cloning and transformation were performed using pMOSBBlue Blunt Ended Cloning Kit (Amersham Biosciences, Piscataway, USA), as described by the manufacturer. Positive white colonies were picked and transferred to 100 µl of sterile water. Cells were lysed by keeping the tube in boiling water for 5 min. 10 µl of lysate was used for amplification with T7 promoter primer and U-19mer primer. PCR was performed using the Dream Taq polymerase (Fermentas, Vilnius, Lithuania) with the following parameters: 92 °C for 3 min; then 40 cycles 92 °C for 1 min, annealing temperature (55 °C) for 1 min, 72 °C for 2 min and a final extension step at 72 °C for 10 min. The presence of insertion was tested in the 2% agarose gel. The PCR product was purified using MinElute 96 UF Plates (Qiagen, Leipzig, Germany) and the NucleoVac vacuum manifold (Macherey-Nagel, Düren, Germany), according to manufacturers’ protocols.

The sequencing reaction was performed with primer M13 21uni and 5 µl of the purified product. Sequencing was performed on the MegaBace 1000 Sequencing System (Amersham Biosciences, Piscataway, USA).

Computational analysis

EditSeq and SeqManII modules of the Lasergene expert sequence analysis software were used for sequence editing and assemble/contig management correspondingly. Blast search was performed using sequence databases at NCBI, CR-EST (Crop EST database at IPK), TREP (the Triticeae Repeat Sequence Database) and EnsemblPlants (http://plants.ensembl.org/Hordeum_vulgare/) databases. Comparison to MAR/SAR sequences was performed using http://smartdb.bioinf.med.uni-goettingen.de/cgi-bin/SMARtDB/smar.cgi database. Prediction of G quadruplexes (GQ) was performed with R-studio library pqsfinder.

Circular dichroism spectroscopy of G-quadruplex forming sequences

Oligonucleotides corresponding to probable GQ-forming sequences were designed and ordered in Metabion (Table 1). Oligonucleotides were diluted in Milli-Q water to obtain a 100 µM stock solution. The stock solutions were incubated at 4 °C to achieve complete solubilization. Then, samples were prepared by dilution in folding buffer to a final concentration of 5 µM and annealed in the presence of the 100 mM KCl by heating to 95 °C for 5 min in a heating block and slowly cooling down at room temperature. Spectra were detected immediately and after 3 h. Samples were stored at 4 °C. CD spectra were recorded on a Chirascan CS/3D spectrometer (Applied Photophysics, Surrey, UK), 10 mm path-length at room temperature. CD spectra of DNA were recorded in a quartz cell off 10 mm path-length in a range of 340–200 nm, scan rate 200 nm min⁻¹, bandwidth 1 nm, numbers of scan 4 averaged, at room temperature.

Cloning

The tight DNA-protein complexes were purified from the first leaves, coleoptiles, and roots of barley seedlings using chromatography on nitrocellulose and exhaustive digestion of DNA with DNase I. Deproteinized and additionally purified DNA fragments (R1-DNA, R2-DNA after fractionation on nitrocellulose and DNA protected by proteins against DNase1) were cloned in Eco RV site of pMOSBBlue Blunt Ended vector. The cloning procedure of all the DNA samples was efficient. The blue/white screening enabled the identification of a large number of positive colonies. Bacterial lysates were prepared from the maximal possible number of positive colonies. From 48 to 140 DNA samples of every specimen were taken for the PCR-based insert amplification. PCR products were identified on the 2% agarose gels. All successful PCR products without size selection were used in sequence analysis. The purified PCR products were sequenced; the capacity of the experiment is given in Table 2. Altogether, about 477 DNA fragments were sequenced to produce a representative set of sequence complexity, according to the barley tissue studied, as well as the method of TBP fractionation applied.

Statistical analysis of the sequences

The average length of the “free” DNA fraction inserts was 116 bp; average GC content was equal to 43%, very close to the average Hordeum vulgare DNA GC content (44.15%) published in the NCBI Genome database. The average length of the coleoptile R1 (CR1) fraction sequences was 50 bp, but the GC content was higher than in the genome (69%). Similarly, CR2 sequences were 79 bp long on average and GC-rich (63%). Clones of the retained DNA obtained from the leaves had an average length of 90 bp in LR1 fraction and 75 bp in LR2 fraction. The GC content was also high, 57% and 59%, respectively. In the root R1 fraction, GC content was even higher (70%) with an average length of 45 bp. However, the RR2 fraction did not follow this trend: it contained several AT-rich sequences, and the average GC content was still higher than in genomes (50%, average length—133 bp). Some differences were observed for clones obtained by exhaustive DNase digestion. In coleoptile, the average length of DNA-derived clones was 111 bp with an average of 58% of GC pairs. Clones obtained from the first leaves were mostly shorter (50 bp on average). Many were AT-rich, although GC-rich clones were also identified; the average GC content was 53%. The root clones were mostly GC-rich (70% on average), and the average length was 70 bp.

The similarity of the sequences

BLAST alignment revealed homologous sequences in the barley genome for a majority of clones. However, no similarities were found for 7 clones derived from the “free DNA” (FF), 5 CR1 fraction clones, 10 CR2 clones, 13 LR1 and 16 LR2 sequences and 26 RR1 and 11 RR2 sequences. Among the clones obtained by exhaustive DNase digestion, 29 coleoptile-derived, 26 first-leaf derived and 12 root-derived clones did not align with the published barley sequences. Indeed, this is not surprising as the barley genome has not been completely sequenced. Initially, the sequences revealed by The International Barley Genome Sequencing Consortium (2012) represented about 80% of the whole genome. The following almost complete sequence did not represent 100% (Mascher et al., 2017). Our data give insight into sites difficult to sequence. Sequences without similarity in the databases (barley genome at NCBI and Ensembl) exceeding 30 bp in length were submitted to the NCBI database Sequence Read Archive (SRA). BioSample numbers are given in Table 3. In cases where we could identify our sequences from R1, R2 and DNase-resistant fractions in the well-characterized barley genome fragments, they were mostly localized in the repeats (Caspar, retrotransposons BARE 2-3; BARE_N15C-1, RLG_BAGY1_Y14573-1, Ashbury-2, gypsy, Sherlock, Athila Sabine, Wham-M19C-1; Wham_T14A-1; WhamD18-1-SoloLTR, Sabrina T8A1, LINE Morpheus, Sukkula_N15C-1, transposons CACTA and Balduin). That is not surprising, as 84% of the barley genome is formed by the repeats (International Barley Genome Sequencing Consortium, 2012). However, some clones aligned with both nuclear and chloroplast structural genes—several LR1 clones aligned with chloroplast psbA and psbE genes. Other clones aligned with ribosomal proteins L22 and S19, intron 1 of receptor like-kinase MybS3 gene, intron 2 VRN-H1 and some unidentified genes. Thus, the tightly bound proteins can anchor both DNA repeats and structural genes.

Peculiarities of DNA sequences

The analysis of sequences forming complexes with tightly bound proteins revealed two specific motifs characteristic of this DNA fraction (Supplemental Information 1). These were CC(TCTCCC)n repeat, the so-called CT-motif found in18.9% of all inserts, and GCTCGTCCGGCTCGGAGGCTGACGATGGGCCCCGCCTGTCGGTCTCTCG sequence, the so-called GC-motif found in 6.9% of all inserts. These sequences were not found in any of the clones derived from protein-free DNA (F fraction). Sequence CC(TCTCCC)₂TC was found in about 90% of all sequences containing the CT-motif. Other versions of the motif are presented in Supplemental Information 1. Interestingly, the CT motif contained AGAGG/TCTCC repeats. These 5-mer repeats were previously described as sequences characteristic of chicken DNA associated with tightly-bound proteins (Werner & Neuer-Nitsche, 1989). Blast search with CT-motifs produced more than 200 high-scoring results with barley ESTs Database. Blast against TREP (GrainGenes) revealed 25 blast hits including - retransposons LTR (athila, gypsy, copia, and others) and transposons (CACTA, mutator). Similar sequences were abundant in rice, tomato and Arabidopsis genomes. TCTCCC motif also gave multiple alignments with human and mouse genome sequences. GC motif gave 6 alignments with the barley EST database. It seems that a full 49-bp motif is composed of parts of different mobile elements including retransposons (gypsy, copia) and transposons (CACTA). Both components of the motif aligned with 9 sites of rice genome and some sites of Caenorhabditis elegans, Mezorhizobum loti, Cryptococcus neoformis and rat genomes. CT-motif is more frequently found in clones derived from leaf and coleoptile DNA compared to root DNA. GC-motif was mostly found in clones derived from the root R-DNA. Interestingly, parts of the CT motif of 7 to 8 nucleotides (TCTCCCT, CTCCCTC, CCTCTCCC ) aligned with several GQ-forming sequences from rice, Arabidopsis and Glycinia (Takahashi et al., 2012).

Similarity to the MAR/SAR sequences

The relationship between TBP-bound DNA and nuclear matrix attachment sites (MARs) has been constantly discussed (Sjakste et al., 2012). To test similarities between our sequences and MARs, we have compared them to sequences deposited in the MAR/SAR database. Surprisingly, there were no alignments with the nitrocellulose-retained DNA fractions (CR1, CR2, LR1, LR2, RR1, RR2). However, some similarities were found in 5 of the 39 clones derived from free DNA. In TBP-bound fractions obtained by exhaustive nuclease digestion, some alignments were revealed in 6 of the 100 clones of coleoptile DNA, 8 of 63 clones of the first leaf DNA and 4 of the 41 clones of the root DNA.

Predicted guanine quadruplexes

Taking the GC content of the sequences into account, we became interested in the formation of quadruplexes in these sequences. The analysis produced by the pqsfinder program revealed numerous potential quadruplex-forming sites in the sequences. Amongst 39 free DNA clones, seven possible GQ were found (0.18 per clone). In the TBP-enriched leaf fractions, there were more GQ-forming sites compared to the free DNA: in LR1 and LR2 clones, there were 0.28 and 0.26 GQ per clone, respectively. However, clones obtained from coleoptile and roots did not follow this trend: in CR1, CR2, RR1 and RR2 clones 0.13, 0.16, 0.09 and 0.15 GQ per clone, respectively, were identified. TBP-DNA complexes obtained by the exhaustive DNAse I digestion GQ sites were more frequent. In 75 sequences of Cd fraction (coleoptile DNA exhaustively digested with DNase I), 46 potential quadruplex-forming sites were revealed (0.61 per clone). In 44 clones obtained similarly from roots, there were 24 probable GQs (0.54 per clone) and 29 GQs in 101 sequences from the leaves (0.27 per clone). In 43 selected clones containing the CT-repeat only, 10 did not contain GQs. In some clones, there were 2 and even 3 sites. Thus, GQ frequency turned out to be 1 GQ per clone. Among identified sequences, possible GQs were found both in transposable elements, Sherlock, BARE 1 LTR-1, LTR-retrotransposon Ashbury-2, and some structural genes, Chloroplast psbA gene, intron 1 MybS3 gene, intron 2 “VRN-H1”.

Determination of guanine quadruplexes

To confirm that our sequences can form guanine quadruplexes, a set of oligonucleotides containing sites of possible GQs were designed and ordered. Three of them represented the minus strand of the CT-repeat. Two were derived from sequences of two clones of LR1 fraction and contained GC-rich motifs different from the CT motif. Circular dichroism spectroscopy revealed profound changes in spectra when oligonucleotides were incubated in 100 mM KCl. There was either an increase of positive band in the area of 260 nm (oligonucleotides Ct-R1-6-2, Ct-11-2-F, 44-LR1, Figs. 1A, 1B and 1E) or the formation of a positive band at 290 nm (oligonucleotides Ct-2-F and 68 LR1, Figs. 1C and 1D). In the former case, changes are typical for parallel G-quadruplexes, and in the latter, 3+1 structures (Lexa et al., 2014).