Apelin signaling dependent endocardial protrusions promote cardiac trabeculation in zebrafish

Version of Record

Accepted for publication after peer review and revision.

Download
Cite
Share
CommentOpen annotations (there are currently 0 annotations on this page).

Version of Record published: March 11, 2022 (This version)
Accepted Manuscript published: February 28, 2022 (Go to version)
Accepted: February 25, 2022
Preprint posted: August 31, 2021 (Go to version)
Received: August 20, 2021

1. Of interest
Endogenous tagging using split mNeonGreen in human iPSCs for live imaging studies

Mathieu C Husser, Nhat P Pham ... Alisa Piekny

Tools and Resources Apr 23, 2024
Further reading

Abstract
Editor's evaluation
Introduction
Results
Discussion
Materials and methods
Data availability
References
Article and author information
Metrics

Abstract

During cardiac development, endocardial cells (EdCs) produce growth factors to promote myocardial morphogenesis and growth. In particular, EdCs produce neuregulin which is required for ventricular cardiomyocytes (CMs) to seed the multicellular ridges known as trabeculae. Defects in neuregulin signaling, or in endocardial sprouting toward CMs, cause hypotrabeculation. However, the mechanisms underlying endocardial sprouting remain largely unknown. Here, we first show by live imaging in zebrafish embryos that EdCs interact with CMs via dynamic membrane protrusions. After touching CMs, these protrusions remain in close contact with their target despite the vigorous cardiac contractions. Loss of the CM-derived peptide Apelin, or of the Apelin receptor, which is expressed in EdCs, leads to reduced endocardial sprouting and hypotrabeculation. Mechanistically, neuregulin signaling requires endocardial protrusions to induce extracellular signal-regulated kinase (Erk) activity in CMs and trigger their delamination. Altogether, these data show that Apelin signaling-dependent endocardial protrusions modulate CM behavior during trabeculation.

Editor's evaluation

This first formal dissection of endocardial protrusions in zebrafish hearts describes how they anchor to cardiomyocytes, and how they participate in signaling pathways involved in trabeculation. The work combines elegant zebrafish reporters and high-quality imaging, as well as mutant lines and pathway inhibitors to provide key findings of how mutual regulation between the myocardium and the endocardium contribute to understanding of mechanisms underlying organ development. This manuscript is of broad interest to readers who study cardiogenesis and developmental biology.

https://doi.org/10.7554/eLife.73231.sa0

Introduction

To meet the needs of the growing embryo, the vertebrate heart has to undergo a series of complex morphogenetic events to transform from a linear tube into a mature organ. During cardiac trabeculation, CMs in the outer curvature of the ventricles delaminate toward the lumen to form multicellular sponge-like projections, called trabeculae (Sedmera and Thomas, 1996; Sedmera et al., 2000; Stankunas et al., 2008; Liu et al., 2010; Peshkovsky et al., 2011; Staudt et al., 2014). Cardiac trabeculae are crucial to achieve increased contractility as well as for the formation of the conduction system. Trabeculation defects are often associated with left ventricular noncompaction (Oechslin et al., 2000; Stöllberger and Finsterer, 2004), embryonic heart failure, and lethality (Gassmann et al., 1995; Lee et al., 1995; Lai et al., 2010; Liu et al., 2010; Rasouli and Stainier, 2017).

In zebrafish, as in other vertebrates, the early embryonic heart consists of two cell layers, the myocardium and the endocardium, separated by a specialized extracellular matrix called the cardiac jelly (CJ) (Stainier and Fishman, 1992; Brutsaert et al., 1996). Recently, it has been shown that endocardial cells (EdCs), similar to blood endothelial cells (ECs), form sprouts, and that these sprouts are mostly oriented toward the myocardium (Del Monte-Nieto et al., 2018). During sprouting angiogenesis, ECs first extend filopodia to sense the microenvironment for growth factors, then they migrate into avascular areas and form new blood vessels (Gerhardt et al., 2003). Due to its similarity to sprouting angiogenesis, the sprouting of EdCs has been termed endocardial sprouting. However, whether endocardial sprouting is regulated by the same signaling pathways as sprouting angiogenesis is not known.

Multiple signaling pathways have been implicated in cardiac trabeculation, including neuregulin (Nrg)/ErbB signaling. Mouse and zebrafish embryos lacking the endocardium-derived ligand Nrg or the ErbB receptor, which is expressed by the myocardium, fail to form trabeculae (Gassmann et al., 1995; Lee et al., 1995; Meyer and Birchmeier, 1995; Lai et al., 2010; Liu et al., 2010; Rasouli and Stainier, 2017). Furthermore, endocardial Notch signaling (Grego-Bessa et al., 2007; D’Amato et al., 2016; Del Monte-Nieto et al., 2018), angiopoietin 1/Tie2 signaling (Suri et al., 1996; Tachibana et al., 2005; Qu et al., 2019), and semaphorin 3E/plexinD1 signaling (Sandireddy et al., 2019) are required for cardiac trabeculation in mouse. Of note, genetic deletion of the relevant receptors in the endocardium results in attenuated endocardial sprouting (Qu et al., 2019) and trabeculation defects (Grego-Bessa et al., 2007; D’Amato et al., 2016; Del Monte-Nieto et al., 2018; Qu et al., 2019; Sandireddy et al., 2019).

Cells communicate by a variety of mechanisms including paracrine and contact-dependent signaling. More recently, a novel mechanism of cell communication by active transport of signaling molecules through filopodia-like actin-rich membrane protrusions, also known as cytonemes, has been shown in different models including Drosophila (Ramírez-Weber and Kornberg, 1999; Roy et al., 2011; Huang et al., 2019), chick (Sanders et al., 2013), zebrafish (Stanganello et al., 2015), and mouse (Fierro-González et al., 2013). Like filopodia, cytonemes depend on actin polymerization by various effector proteins including formins, profilin, and IRSp53, a substrate for the insulin receptor (Rottner et al., 2017).

In this study, we take advantage of the zebrafish model, as its transparency allows single-cell resolution and high-speed imaging of the beating heart, to analyze endocardial-myocardial communication during embryogenesis. By investigating apelin (apln) mutants, we found that endocardial protrusion formation is controlled by Apln signaling. We also observed by in vivo imaging that endocardial protrusions promote cardiac trabeculation by modulating Nrg/ErbB/Erk signaling. Altogether, our results provide new insights into the role of endocardial protrusions during cardiac trabeculation.

Results

Endocardial-myocardial interactions in zebrafish

The early embryonic heart in vertebrates is composed of two cell types: EdCs and myocardial cells (Figure 1A–D). In order to analyze possible interactions between the endocardial and myocardial cells in zebrafish, we genetically labeled the actin cytoskeleton of the EdCs using the TgBAC(cdh5:Gal4ff) and Tg(UAS:LIFEACT-GFP) lines, and the membrane of myocardial cells with mCherry using the Tg(myl7:mCherry-CAAX) line. We observed endocardial protrusions extending toward the myocardium at 24 (Figure 1A–A’’) and 48 (Figure 1B–B’’, Figure 1—figure supplement 1A) hours post-fertilization (hpf). Of note, we observed more endocardial protrusions in the ventricle than in the atrium at 48, 60, and 72 hpf (Figure 1—figure supplement 1B). Subsequently, these ventricular endocardial protrusions formed anchor points with the myocardium, and to be consistent with similar observations in mouse (Del Monte-Nieto et al., 2018) we will refer to them as touchdowns (Figure 1B–B’’). Notably, these touchdowns are stable even during cardiac contractions (Figure 1E–H, Figure 1—video 1). Starting at around 60 hpf, cardiomyocytes (CMs) delaminate from the compact layer toward the lumen to seed the trabecular layer (Figure 1C, C’ and C’’’’), as reported before (Liu et al., 2010; Peshkovsky et al., 2011; Staudt et al., 2014; Priya et al., 2020). At this stage, we observed that endocardial protrusions appear to extend along, and sometimes around, the delaminating CMs (Figure 1C’’ and C’’’, Figure 1—video 2). Next, trabecular CMs start to assemble into trabeculae, ‘finger-like’ multicellular projections, starting at 72 hpf (Figure 1D, D’ and D’’’’). At this stage, we observed that endocardial protrusions can also be detected in close proximity to trabecular CMs (Figure 1D’’ and D’’’, Figure 1—video 3). Cardiac trabeculae are mostly present in the outer curvature of the ventricle at early developmental stages in zebrafish (Liu et al., 2010). Interestingly, we observed a spatial correlation between endocardial protrusions and trabeculation. At 48 hpf, endocardial protrusions are mostly located in the outer curvature of the ventricle (Figure 1—figure supplement 1C, F). At 60 and 72 hpf, respectively, 79% and 83% of all endocardial protrusions in the ventricle are located in the outer curvature (Figure 1—figure supplement 1D-F); 69% of all endocardial protrusions in the outer curvature are close to delaminating CMs at 60 hpf, and 91% of all endocardial protrusions in the outer curvature are close to trabecular CMs at 72 hpf (Figure 1—figure supplement 1D, E, G). Moreover, 98% of delaminating CMs and 93% of trabecular CMs are in close proximity to endocardial protrusions at 60 and 72 hpf, respectively (Figure 1—figure supplement 1D, E, H). Together these data lead us to speculate that endocardial protrusions play a role during endocardium-myocardium interactions.

Figure 1 with 4 supplements see all

Download asset Open asset

Stages of endocardial-myocardial interactions during zebrafish heart development.

(**A-D**) Confocal projection images of the heart of Tg(myl7:mCherry-CAAX); Tg(cdh5:Gal4ff); Tg(UAS:LIFEACT-GFP) zebrafish at 24 (A), 48 (B), 60 (C) and 72 (D) hpf. (**A-A’’**) Endocardial protrusions (arrows) towards the myocardium at 24 hpf. (**B-B’’**) Endocardial protrusions (arrows) and touchdowns (asterisks) with the myocardium at 48 hpf. (**C-C’’’**) Endocardial protrusions (arrows) during CM delamination (arrowheads) at 60 hpf. (**C’’’**) 3D surface rendering of the area in the yellow box in C’. (**D-D’’’**) Endocardial protrusions (arrows) during trabecular assembly and expansion (arrowheads) at 72 hpf. (**D’’’**) 3D surface rendering of the area in the yellow box in D’. (**A’’’’-D’’’’**) Schematics of endocardial protrusions, endocardial touchdowns, CM delamination, and trabecular expansion. Black asterisks indicate delaminating CMs; purple asterisks indicate trabeculae. (**E-H**) Still images from a spinning disc time-lapse movie of a 48 hpf Tg(myl7:mCherry-CAAX); Tg(cdh5:Gal4ff); Tg(UAS:LIFEACT-GFP) heart; white asterisks indicate endocardial touchdowns; numbers in the bottom right corner refer to seconds. All images are ventral views, anterior to the top. V, ventricle; A, atrium.

Genetically blocking endocardial protrusion formation reduces myocardial trabeculation

Since we observed a correlation between the presence of endocardial protrusions and myocardial trabeculation, we next aimed to examine the function of endocardial protrusions during cardiac morphogenesis. To this aim, we generated a transgenic line, Tg(UAS: irsp53^dn-p2a-RFP), to specifically block protrusion formation in the endothelium. IRSp53 regulates the actin cytoskeleton to enable cells to form different types of membrane extensions (Nakagawa et al., 2003; Millard et al., 2005; Scita et al., 2008). By crossing the Tg(UAS: irsp53^dn-p2a-RFP) line to the TgBAC(cdh5:Gal4ff) line to overexpress Irsp53^dn specifically in ECs, we observed a 70% reduction in the number of endocardial protrusions at 48 hpf (Figure 2A, B and E), while their distribution appeared mostly unaffected (Figure 2A, B and F). To test the hypothesis that endocardial protrusions modulate myocardial trabeculation, we analyzed embryos overexpressing irsp53^dn in their ECs in a CM membrane line (Tg(myl7:BFP-CAAX)). Upon irsp53^dn overexpression in ECs, we detected fewer endocardial touchdowns (Figure 2A and B), as well as a reduction in cardiac trabeculation (Figure 2C, D, G and G’). In order to identify a possible effect of endocardial protrusions on CM proliferation, we overexpressed irsp53^dn in the endothelium in the context of the Tg(myl7:mVenus-gmnn) reporter to visualize cycling CMs. Compared with controls, endothelial overexpression of irsp53^dn led to significantly fewer mVenus-Gmnn⁺ CMs in the ventricle (Figure 2H and I).

Figure 2

Download asset Open asset

Blocking endocardial protrusion formation reduces cardiac trabeculation.

(**A–D**) Confocal projection images of the heart of *Tg(myl7:BFP-CAAX); Tg(cdh5:Gal4ff); Tg(UAS:LIFEACT-GFP*);±*Tg(UAS:irsp53^dn-p2a-tagRFP*) zebrafish at 48 (**A–B**) and 72 (**C–D**) hours post-fertilization (hpf). (**A–B**) Endocardial protrusions (white arrows) and touchdowns (white asterisks) are reduced in embryos with endothelial overexpression of *irsp53^dn*. (**C–D**) Cardiac trabeculation (arrowheads) is reduced in larvae with endothelial overexpression of *irsp53^dn*; (C’–D) 3D rendering. (E) Quantification of the number of endocardial protrusions in wild-type and in embryos with endothelial overexpression of *irsp53^dn* at 48 hpf. (**F-F’**) Illustration of the division of the 48 hpf ventricle into four regions (F). Distribution and average number of endocardial protrusions in different regions of mid-sagittal sections of the ventricle from 48 hpf wild-type and *irsp53^dn* embryos (F’). (**G–G’**) Illustration of the division of the 72 hpf ventricle into the outer and inner curvature (G). Quantification of the percentage of trabecular cardiomyocytes (CMs) in the outer curvature of wild-type and *irsp53^dn* larvae at 72 hpf (G’). (**H–H’**) 72 hpf larvae with endothelial overexpression of *irsp53^dn* display a reduced number of *myl7:*mVenus-Gmnn⁺ CMs (yellow arrows) in their ventricle. (I) Quantification of the number of mVenus-Gmnn⁺ CMs in the ventricle of wild-type and *irsp53^dn* larvae at 72 hpf. All images are ventral views, anterior to the top. V, ventricle; A, atrium. Data in graphs expressed as mean ± SEM.

Apelin signaling positively regulates endocardial protrusion formation and myocardial trabeculation

We have recently found that Apelin signaling regulates endothelial filopodia formation during angiogenesis in the zebrafish trunk (Helker et al., 2020). Therefore, we hypothesized that Apelin signaling also regulates endocardial protrusion formation. In order to visualize the expression of apln and aplnrb at single-cell resolution in the heart, we examined the TgBAC(apln:EGFP) reporter line (Helker et al., 2020) and generated a novel Tg(aplnrb:VenusPEST) reporter line. We detected apln:EGFP expression in the myocardium at 48 and 72 hpf (Figure 3A and B). Furthermore, we detected aplnrb:VenusPEST expression in the endocardium at 48 and 72 hpf (Figure 3C and D). These results suggest that apln is expressed in the myocardium while aplnrb is expressed in EdCs. Based on these results, we hypothesized that Apelin signaling plays a role during endocardium-myocardium interactions.

Figure 3

Download asset Open asset

Expression pattern of Apelin signaling pathway components.

(**A–D**) Confocal projection images of the heart of *TgBAC(apln:EGFP); Tg(myl7:MKATE-CAAX*) (**A, B**) and *TgBAC(aplnrb:VenusPEST); Tg(kdrl:HsHRAS-mCherry*) (**C, D**) zebrafish at 48 (**A, C**) and 72 (**B, D**) hours post-fertilization (hpf). (**A’–’D’**) Maximum intensity projections. (**A–B**) *TgBAC(apln:*EGFP) expression is detectable in the myocardium at 48 (A) and 72 (B) hpf. (**C–D**) *TgBAC(aplnrb:*VenusPEST) expression is detectable in the endocardium with higher expression in the ventricular endocardium at 48 (C) and 72 (D) hpf. All images are ventral views, anterior to the top. V, ventricle; A, atrium.

To test this hypothesis, we used mutants for aplnra (Helker et al., 2015), aplnrb (Helker et al., 2015), apln (Helker et al., 2015), and apela (Chng et al., 2013). Since apela mutants fail to form a heart (Chng et al., 2013), we did not analyze them. While most aplnrb mutants fail to form a heart (D’Amico et al., 2007; Zeng et al., 2007), a low number of them do. By analyzing aplnrb mutants that do form a heart, we observed that they exhibit a reduced number of endocardial protrusions at 48 hpf (Figure 4—figure supplement 1A, B) and a reduced number of trabeculae at 72 hpf (Figure 4—figure supplement 1C, D). In wild-type embryos, the CJ between the endocardium and myocardium in the outer curvature of the ventricle appears to be mostly degraded at 72 hpf (Figure 4—figure supplement 1C); however, the CJ in aplnrb mutants appears to be thicker at this stage (Figure 4—figure supplement 1D). In addition, aplnra mutants also exhibit a reduced number of trabeculae at 72 hpf (Figure 4—figure supplement 1E and F). We further observed that apln mutants exhibit a significantly lower number of endocardial protrusions at 24 and 48 hpf (Figure 4A–D–). In line with fewer endocardial protrusions, apln mutants also exhibit a reduced number of endocardial touchdowns at 48 hpf (Figure 4C and D), and a reduced number of trabeculae at 72 hpf (Figure 4E, F and J). Altogether, these results indicate that Apelin signaling regulates endocardial protrusion formation and myocardial trabeculation.

Figure 4 with 6 supplements see all

Download asset Open asset

Loss of Apelin signaling leads to reduced endocardial protrusion and reduced myocardial trabeculation.

(**A–F**) Confocal projection images of the heart of *Tg(cdh5:Gal4ff); Tg(UAS:LIFEACT-GFP*) zebrafish at 24 hours post-fertilization (hpf) (**A–B**) and of the heart of *Tg(myl7:mCherry-CAAX); Tg (cdh5:Gal4ff); Tg(UAS:LIFEACT-GFP*) (**C–F**) zebrafish at 48 (**C–D**) and 72 (**E–F**) hpf. Maximum intensity projections (**A–B**) and mid-sagittal sections (**C–F**). (A) Endocardial protrusions (arrows) in *apln^+/+* embryos at 24 hpf. (B) The number of endocardial protrusions (arrows) is reduced in *apln^-/-* siblings at 24 hpf. (**C–D**) The numbers of endocardial protrusions (arrows) and touchdowns (white asterisks) are reduced in *apln^-/-* embryos (D) at 48 hpf compared with *apln^+/+* siblings (C). (**E–F**) *apln^-/-* larvae (F) exhibit reduced trabeculation (arrowheads) and thicker cardiac jelly (CJ) (yellow asterisks) at 72 hpf compared with *apln^+/+* siblings (E). (**G–H**) Quantification of the number of endocardial protrusions in the ventricle of *apln^+/+* and *apln^-/-* siblings at 24 (G) and 48 (H) hpf. (I) Distribution and average number of endocardial protrusions in different regions of mid-sagittal sections of the ventricle from 48 hpf *apln^+/+* and *apln^-/-* siblings. (J) Quantification of the percentage of trabecular cardiomyocytes (CMs) in the outer curvature of *apln^+/+* and *apln^-/-* siblings at 72 hpf. (**K–K’**) Maximum intensity projections. *apln^-/-* larvae (K’) exhibit a thicker CJ at 72 hpf compared with *apln^+/+* siblings (K). (L) Quantification of the CJ volume in the outer curvature of *apln^+/+* and *apln^-/-* siblings at 72 hpf. All images are ventral views, anterior to the top. V, ventricle; A, atrium; *+/+*, *apln^+/+; -/-*, *apln^-/-*. Data in graphs expressed as mean ± SEM.

To further examine the function of Apelin-dependent endocardial protrusions during cardiac trabeculation, we next analyzed CM proliferation in apln mutants using EdU labeling. Homozygous apln mutants exhibit a significantly decreased number of EdU⁺ CMs in their ventricle compared with apln^+/+ siblings (Figure 4—figure supplement 2). In addition, apln mutants also display a significantly thicker CJ compared with apln^+/+ siblings at 72 hpf (Figure 4C–F, K and L). However, we did not observe any obvious defects in sarcomere formation (Figure 4—figure supplement 3A and B), heart rate, ejection fraction, or blood circulation in apln mutants (Figure 4—figure supplement 3C and D; Figure 4—videos 1–2), indicating that the myocardial trabeculation phenotype is caused by the endocardial protrusion defect and is not secondary to cardiac dysfunction.

Notch signaling negatively regulates endothelial sprouting and protrusion formation in several vascular beds (Hellström et al., 2007; Leslie et al., 2007; Siekmann and Lawson, 2007; Suchting et al., 2007). In order to determine whether Notch signaling also regulates endocardial protrusion formation, we treated embryos with the γ-secretase inhibitor RO4929097 and observed a decrease in Notch reporter expression in the endocardium (Figure 4—figure supplement 4A and B) as well as an increased number of endocardial protrusions in the ventricle (Figure 4—figure supplement 4E, F, and H). However, and in line with the touchdown reduction phenotype in Notch-deficient mice, we observed a reduction in endocardial touchdowns in Notch inhibitor treated zebrafish larvae at 48 hpf (Figure 4—figure supplement 4C, D, and G).

Altogether, these results indicate that myocardial derived Apelin promotes endocardial protrusion formation while Notch signaling inhibits it. Furthermore, Apelin signaling is required for cardiac trabeculation, possibly via the formation of endocardial protrusions.

The function of endocardial Nrg2a in trabeculation requires endocardial protrusions

Nrg-ErbB signaling is indispensable for cardiac trabeculation in mouse and zebrafish (Gassmann et al., 1995; Lee et al., 1995; Meyer and Birchmeier, 1995; Lai et al., 2010; Liu et al., 2010; Peshkovsky et al., 2011; Rasouli and Stainier, 2017). To determine whether endocardial protrusions are required for Nrg-ErbB signaling, we first overexpressed nrg2a in the endothelium using the Tg(fli1a:nrg2a-p2a-tdTomato) line (Rasouli and Stainier, 2017). Overexpression of nrg2a in the endothelium results in hypertrabeculation as well as a multilayered myocardium (Figure 5A, B and E–G; Figure 5—figure supplement 1A and B). Strikingly, overexpressing nrg2a in the endothelium while blocking endocardial protrusion formation by endothelial overexpression of irsp53^dn is not sufficient to restore cardiac trabeculation or induce CM multilayering (Figure 5C-C' and E-G). In line with these results, overexpressing nrg2a in the endothelium of homozygous apln mutants is not sufficient to restore cardiac trabeculation or induce CM multilayering (Figure 5D-D' and E-G). Importantly, we did not detect a change in the expression levels of nrg2a in apln mutant hearts at 48 hpf (Figure 5—figure supplement 1C). Taken together, these data indicate that endocardial protrusions are required for Nrg-ErbB signaling during cardiac trabeculation.

Figure 5 with 1 supplement see all

Download asset Open asset

Endocardial protrusions are necessary for *nrg2a* function.

(**A–D**) Confocal projection images of the heart of *Tg(myl7:HsHRAS-EGFP*) larvae at 72 hours post-fertilization (hpf). (**A–B**) Overexpression of *nrg2a* in the endothelium (B) leads to an increased number of trabeculae (arrowheads) and the multilayering of cardiomyocytes (CMs) (brackets) compared with wild-type (A). (C) Larvae with endothelial overexpression of *nrg2a* and *irsp53^dn* exhibit a reduced number of trabeculae (arrowheads) and of multilayered CMs (brackets) compared with larvae with endothelial overexpression of *nrg2a* alone (B). (D) *apln* mutant larvae with endothelial overexpression of *nrg2a* exhibit a reduced number of trabeculae (arrowheads) and of multilayered CMs (brackets) compared with wild-type larvae with endothelial overexpression of *nrg2a* (B). (E) Quantification of the number of trabeculae. (F) Quantification of the number of trabecular CMs. (G) Quantification of the number of multilayered CMs in the ventricle. Brackets indicate multilayered CMs. All images are ventral views, anterior to the top. V, ventricle. Data in graphs expressed as mean ± SEM.

Genetically blocking endocardial protrusion formation attenuates Erk signaling in cardiomyocytes

An important molecule in the Nrg/ErbB signaling pathway is the extracellular signal-regulated kinase Erk (Lai et al., 2010). In order to visualize Erk activity in CMs in living zebrafish, as a readout of ErbB signaling, we generated novel reporter lines (Tg(myl7:ERK-KTR-Clover-p2a-H2B-tagBFP) and Tg(myl7:ERK-KTR-Clover-p2a-H2B-mScarlet)) that use the kinase translocation reporter (KTR) technology (Regot et al., 2014; de la Cova et al., 2017). When Erk is inactive, the KTR is unphosphorylated and Clover can be detected in the nucleus; in contrast, when Erk is active, the KTR is phosphorylated and Clover can be detected in the cytoplasm (de la Cova et al., 2017). We observed that most ventricular CMs in wild-type larvae display active Erk signaling with cytoplasmic Clover expression (Figure 6A). Treating embryos expressing the reporter with a MEK inhibitor led to an increased number of ventricular CMs with nuclear Clover expression (i.e., inactive Erk signaling) indicating that the reporter is functional (Figure 6—figure supplement 1). Next, we treated embryos expressing the reporter with an ErbB2 inhibitor and found an increased number of ventricular CMs with nuclear Clover expression (Figure 6B). To determine whether endocardial protrusions modulate myocardial Erk signaling activity, we genetically blocked endocardial protrusion formation via endothelial overexpression of irsp53^dn and observed more ventricular CMs with nuclear Clover expression (Figure 6C and E) compared with control (Figure 6A and E), indicating more ventricular CMs with inactive Erk signaling. In line with these results, we observed more ventricular CMs with inactive Erk signaling in homozygous apln mutants (Figure 6D and E) compared with apln^+/+ siblings (Figure 6A and E). Altogether, these observations indicate that Apelin signaling-dependent endocardial protrusions promote Nrg/ErbB/Erk signaling in CMs.

Figure 6 with 2 supplements see all

Download asset Open asset

Blocking endocardial protrusion formation reduces myocardial extracellular signal-regulated kinase (Erk) signaling activity.

(**A–D**) Maximum intensity projections of confocal images of the heart of *Tg(myl7:ERK-KTR-Clover-p2a-H2B-tagBFP/mScarlet*) larvae at 72 hours post-fertilization (hpf). (A) Visualization of Erk activity by a cardiomyocyte (CM)-specific ERK-kinase translocation reporter (KTR) reporter. Nuclear Clover expression (arrows) indicates CMs with inactive Erk signaling. (B) Larvae treated with an ErbB2 inhibitor exhibit an increased number of CMs with inactive Erk signaling (arrows) compared with control larvae (A). (C) Larvae with endothelial overexpression of *irsp53^dn* exhibit an increased number of CMs with inactive Erk signaling (arrows) compared with control larvae (A). (D) *apln* mutant larvae exhibit an increased number of CMs with inactive Erk signaling (arrows) compared with *apln^+/+* siblings. (E) Quantification of the percentage of ventricular CMs with nuclear Clover expression. All images are ventral views, anterior to the top. V, ventricle. Data in graphs expressed as mean ± SEM.

Discussion

Endocardial protrusions are required for trabeculation

Cardiac trabeculation is initiated, at least in zebrafish, by individual CMs delaminating from the myocardial monolayer and protruding into the lumen (Liu et al., 2010; Peshkovsky et al., 2011; Staudt et al., 2014; Jiménez-Amilburu et al., 2016; Priya et al., 2020). In contrast, the myocardium in mouse is multilayered at the onset of trabeculation. Several studies have reported that the endocardium plays an important role during cardiac trabeculation (Grego-Bessa et al., 2007; Lai et al., 2010; D’Amato et al., 2016; Rasouli and Stainier, 2017; Del Monte-Nieto et al., 2018; Qu et al., 2019). Furthermore, it has recently been shown that EdCs, similar to ECs, undergo sprouting (Del Monte-Nieto et al., 2018). However, in comparison with endothelial sprouting, little is known about the morphogenetic events underlying endocardial sprouting and their effect on cardiac morphogenesis including trabeculation.

In mouse, endocardial sprouting and touchdown formation occur early during cardiac trabeculation (Del Monte-Nieto et al., 2018). These observations are in line with our data in zebrafish, suggesting that the morphogenetic events of cardiac trabeculation are evolutionarily conserved. However, endocardial sprouts in mouse appear to be cellular (Del Monte-Nieto et al., 2018), whereas endocardial protrusions in zebrafish appear more similar to filopodia, although these differences may be due to the fact that fixed tissue was used for the mouse work compared with live tissue for the zebrafish work. CM delamination and trabeculation occur in the outer curvature of the ventricle (Liu et al., 2010; Jiménez-Amilburu et al., 2016; Rasouli and Stainier, 2017). Consistent with these observations, we find that endocardial protrusions are mostly located in the outer curvature of the ventricle and extend along delaminating CMs as well as trabecular CMs. The temporal and spatial correlation between the emergence and location of endocardial protrusions and CM delamination therefore suggests a role for endocardial protrusions in cardiac trabeculation.

Molecular regulators of endocardial sprouting

During sprouting angiogenesis, so-called tip cells lead the new sprouts (Gerhardt, 2008). Tip cells dynamically extend filopodia to identify growth factors in their environment (Gerhardt, 2008). Apelin and Notch signaling have been previously identified as regulators of endothelial filopodia formation (Hellström et al., 2007; Suchting et al., 2007; Helker et al., 2020). In contrast, the pathways regulating endocardial sprouting are largely unknown. Only Tie2 signaling has been identified to date as a regulator of endocardial sprouting, and Tie2-deficient mice exhibit fewer endocardial touchdowns (Qu et al., 2019). We have recently shown that Apelin signaling regulates filopodia formation during sprouting angiogenesis in the trunk (Helker et al., 2020). In line with these published observations, we now show that Apelin regulates endocardial filopodia formation and endocardial sprouting (Figure 6—figure supplement 2), revealing a conserved role for Apelin signaling during endothelial and endocardial sprouting.

Consistent with the negative regulation of sprouting angiogenesis by Notch signaling in ECs (Hellström et al., 2007; Leslie et al., 2007; Siekmann and Lawson, 2007; Suchting et al., 2007), we found that Notch signaling also negatively regulates endocardial protrusion formation. Interestingly, inhibition of Notch signaling also leads to an increased number of delaminated CMs and trabeculae, although Notch signaling may also affect CM behavior cell autonomously (Han et al., 2016; Priya et al., 2020).

Endocardium-myocardium communication is essential for trabeculation

Cell communication between the endocardial and myocardial cells is required for cardiac trabeculation (Gassmann et al., 1995; Lee et al., 1995; Meyer and Birchmeier, 1995; Lai et al., 2010; Liu et al., 2010; Rasouli and Stainier, 2017; Gunawan et al., 2021). Several studies have shown that endocardial-derived Nrg is required to activate ErbB receptor complexes on CMs (Gassmann et al., 1995; Meyer and Birchmeier, 1995; Grego-Bessa et al., 2007; Rasouli and Stainier, 2017). In zebrafish, nrg2a, which is expressed in the developing endocardium, is required for trabeculation (Rasouli and Stainier, 2017), and nrg2a overexpression in the endothelium results in an increased number of trabeculae and trabecular CMs (Figure 5), indicating that endocardial nrg2a is necessary and sufficient for trabeculation. Notably, blocking endocardial protrusion formation compromises the function of endocardial nrg2a during trabeculation, suggesting that endocardial protrusions are required for nrg2a function during trabeculation. The membrane-bound form of Nrg2a has a molecular weight of 55 kD, and after cleavage, the presumed secreted form has a molecular weight of 22 kD. In contrast, the most active form of Apelin is 13 amino acids long, with a molecular weight of 1.52 kD. Therefore, it is possible that due to its small size, Apelin is able to diffuse through the CJ, while Nrg2a needs to be transported by endocardial protrusions toward the myocardium.

Like other receptor tyrosine kinases, ErbB receptors activate multiple signaling cascades, including the MAPK cascade, upon ligand stimulation, leading to the phosphorylation of ERK1/2 (Sweeney et al., 2001; Wee and Wang, 2017). Accordingly, attenuated ERK phosphorylation is observed in CMs in Nrg1/ErbB signaling-deficient mice (Lai et al., 2010). By analyzing a novel reporter of Erk activity in CMs, we observed that the inhibition of endocardial protrusion formation, as well as the genetic inactivation of Apelin signaling, leads to attenuated Erk phosphorylation in CMs. Altogether, these data suggest that Apelin signaling-dependent endocardial protrusions modulate ErbB signaling in CMs (Figure 6—figure supplement 2).

It has recently been shown that EC filopodia modulate neurogenesis by affecting progenitor cell proliferation in the developing brain of mice and zebrafish (Di Marco et al., 2020; Taberner et al., 2020). Of interest, ErbB signaling is also known for its function within the nervous system (Buonanno and Fischbach, 2001). Thus, one might speculate that Nrg/ErbB signaling also plays a role during the modulation of neurogenesis by endothelial filopodia. Several studies have reported cell-to-cell communication by cytonemes in different animal models (Ramírez-Weber and Kornberg, 1999; Holzer et al., 2012; Luz et al., 2014; Pröls et al., 2015). Whether endocardial protrusions qualify as cytonemes needs further analysis. However, our data indicate that Apelin-dependent endocardial protrusions are required for the communication between endocardial and myocardial cells via Nrg/ErbB signaling (Figure 6—figure supplement 2).

In summary, our work describes how endocardial sprouting is required for Nrg/ErbB signaling during cardiac trabeculation. Furthermore, we identify Apelin signaling as a positive regulator of endocardial sprouting.

Materials and methods

Key resources table

Reagent type (species) or resource	Designation	Source or reference	Identifiers	Additional information
Genetic reagent (Danio rerio)	TgBAC(apln:EGFP)^bns157	Helker et al., 2020	ZFIN: bns157
Genetic reagent (Danio rerio)	TgBAC(cdh5:Gal4ff)^mu101	Bussmann et al., 2011	ZFIN: mu101
Genetic reagent (Danio rerio)	Tg(UAS:LIFEACT-GFP)^mu271	Helker et al., 2013	ZFIN: mu271
Genetic reagent (Danio rerio)	Tg(fli1a:nrg2a-p2a-tdTomato)^bns199	Rasouli and Stainier, 2017	ZFIN: bns199
Genetic reagent (Danio rerio)	Tg(myl7:mCherry-CAAX)^bns7	Uribe et al., 2018	ZFIN: bns7
Genetic reagent (Danio rerio)	Tg(myl7:BFP-CAAX)^bns193	Guerra et al., 2018	ZFIN: bns193
Genetic reagent (Danio rerio)	Tg(myl7:MKATE-CAAX)^sd11	Lin et al., 2012	ZFIN: sd11
Genetic reagent (Danio rerio)	Tg(kdrl:HsHRAS-mCherry)^s896	Chi et al., 2008	ZFIN: s896
Genetic reagent (Danio rerio)	Tg(myl7:HRAS-EGFP)^s883	D’Amico et al., 2007	ZFIN: s883
Genetic reagent (Danio rerio)	Tg(tp1-MmHbb:EGFP)^um14	Parsons et al., 2009	ZFIN: um14
Genetic reagent (Danio rerio)	Tg(myl7:mVenus-gmnn)^ncv43Tg	Jiménez-Amilburu et al., 2016	ZFIN: ncv43Tg
Genetic reagent (Danio rerio)	Tg(UAS: irsp53^dn-p2a-tagRFP)^bns440	This paper	bns440	See Materials and methods section
Genetic reagent (Danio rerio)	TgBAC(aplnrb:VenusPEST)^mr13	This paper	mr13	See Materials and methods section
Genetic reagent (Danio rerio)	Tg(–0.8myl7:ERK-KTR-Clover-p2a-Hsa.H2B-tagBFP)	This paper		See Materials and methods section
Genetic reagent (Danio rerio)	Tg(–0.8myl7:ERK-KTR-Clover-p2a-Hsa.H2B-mScarlet)^bns565	This paper	bns565	See Materials and methods section
Genetic reagent (Danio rerio)	apln^mu267 mutant	Helker et al., 2015	ZFIN: mu267
Genetic reagent (Danio rerio)	aplnrb^mu281 mutant	Helker et al., 2015	ZFIN: mu281
Genetic reagent (Danio rerio)	aplnra^mu296 mutant	Helker et al., 2015	ZFIN: mu296
Antibody	Alexa Fluor 488 anti-Chicken IgG (H + L) (goat polyclonal)	Thermo Fisher Scientific	Cat# A-11039	(1:500)
Antibody	Alexa Fluor 568 anti-Mouse IgG (H + L) (goat polyclonal)	Thermo Fisher Scientific	Cat# A-11004	(1:500)
Antibody	Alexa Fluor 647 anti-Rabbit IgG (H + L) (goat polyclonal)	Thermo Fisher Scientific	Cat# A-21244	(1:500)
Antibody	Anti-GFP (chicken polyclonal)	AvesLab	Cat#: GFP-1020	(1:500)
Antibody	Anti-mCherry (mouse monoclonal)	Takara Bio Clontech	Cat# 632,543	(1:500)
Chemical compound, drug	Agarose, low gelling temperature	Sigma	A9414-25g
Chemical compound, drug	EdU	Thermo Fisher Scientific	Cat# A10044	(1 mM)
Chemical compound, drug	ErbB2 inhibitor PD168393	Sigma	Cat# PZ0285	(10 µM)
Chemical compound, drug	MEK inhibitor PD0325901	Sigma	Cat# PZ0162	(1 µM)
Chemical compound, drug	RO 4929097	MedChemExpress	Cat# HY-11102	(1 µM)
Other	DAPI	Sigma	Cat# D9542	(1 μg/ml)
Commercial assay or kit	Alexa Fluor 568 Phalloidin	Thermo Fisher Scientific	Cat# A12380	(1:100)
Commercial assay or kit	Click-iT EdU Cell Proliferation Kit for Imaging, Alexa Fluor 647 dye	Thermo Fisher Scientific	Cat# C10340
Commercial assay or kit	DyNAmo ColorFlash SYBR Green qPCR Mix	Thermo Fisher Scientific	Cat# F416S
Commercial assay or kit	In-Fusion HD Cloning Plus	Takara Bio	Cat# 638,910
Commercial assay or kit	Maxima First Strand cDNA kit	Thermo Fisher Scientific	Cat# K1641
Commercial assay or kit	RNA clean and concentrator-5	Zymo Research	R1016
Software, algorithm	Fiji Image J	Schindelin et al., 2012	RRID:SCR_002285
Software, algorithm	GraphPad Prism 8	GraphPad Software	RRID:SCR_002798
Software, algorithm	Imaris – version 9.6.0	Bitplane	RRID:SCR_007370
Software, algorithm	ZEN Digital Imaging	Zeiss	RRID:SCR_013672

Zebrafish lines

Request a detailed protocol

All zebrafish housing and husbandry were performed under standard conditions in accordance with institutional (Max Planck Society) and national ethical and animal welfare guidelines approved by the ethics committee for animal experiments at the Regierungspräsidium Darmstadt, Germany, as well as the FELASA guidelines (Aleström et al., 2020). Embryos were staged by hpf at 28.5°C (Kimmel et al., 1995).

Transgenic lines used in the study: TgBAC(apln:EGFP)^bns157 (Helker et al., 2020), TgBAC(cdh5:Gal4ff)^mu101 (Bussmann et al., 2011), Tg(UAS:LIFEACT-GFP)^mu271 (Helker et al., 2013), Tg(fli1a:nrg2a-p2a-tdTomato)^bns199 (Rasouli and Stainier, 2017), Tg(myl7:mCherry-CAAX)^bns7 (Uribe et al., 2018), Tg(myl7:BFP-CAAX)^bns193 (Guerra et al., 2018), Tg(myl7:MKATE-CAAX)^sd11 (Lin et al., 2012), Tg(kdrl:HsHRAS-mCherry)^s896 (Chi et al., 2008), Tg(myl7:HRAS-EGFP)^s883 (D’Amico et al., 2007), Tg(tp1-MmHbb:EGFP)^um14 (Parsons et al., 2009), Tg(myl7:mVenus-gmnn)^ncv43Tg (Jiménez-Amilburu et al., 2016), Tg(UAS:irsp53^dn-p2a-tagRFP)^bns440 (this study), TgBAC(aplnrb:VenusPEST)^mr13 (this study), Tg(–0.8myl7:ERK-KTR-Clover-p2a-Hsa.H2B-tagBFP) (this study, abbreviated as Tg(myl7:ERK-KTR-Clover-p2a-H2B-tagBFP)) and Tg(–0.8myl7:ERK-KTR-Clover-p2a-Hsa.H2B-mScarlet)^bns565 (this study, abbreviated as Tg(myl7:ERK-KTR-Clover-p2a-H2B-mScarlet)).

Mutant lines used in the study: apln^mu267 (Helker et al., 2015), aplnrb^mu281 (Helker et al., 2015), aplnra^mu296 (Helker et al., 2015).

Generation of transgenic lines

Request a detailed protocol

To generate the Tg(UAS:irsp53^dn-p2a-tagRFP) line, a dominant negative form of irsp53 (Millard et al., 2005; Meyen et al., 2015) was amplified by PCR using the primers: forward, 5’- TTCGAATTAGATCTGTCGACCGCCACCATGTCTCGCACCGACGAGGT-3’; reverse, 5’- GTAGCTCCGCTTCCACGCGTCTGTGCAAAGCCTGCCATGC-3’. The amplification was cloned into a 5xUAS-p2a vector upstream of tagRFP.

To generate the aplnrb bacterial artificial chromosome (BAC) construct, we used the BAC clone CH211-102K containing the aplnrb locus. All recombineering steps were performed as described in Bussmann and Schulte-Merker, 2011, with the modifications as described in Helker et al., 2019. The following homology arms were used to generate the targeting PCR product of the Venus-pest_Kan cassette: aplnrb_HA1_GFP_fw: GAGCACATGACAAACAACTTCTCTGTGATCACTTCAAAGATTTTCTTGAAACCATGGTGAGCAAGGGCGAGGAG and aplnrb_HA2_kanR_rev: TCGTCGAAGTAATCTGGGCTATAGTCAGCAGTCATGTTGTCCATGGCATTTTCCAGAAGTAGTGAGGAG. The Kanamycin cassette was removed with a flippase.

To generate the Tg(–0.8myl7:ERK-KTR-Clover-p2a-Hsa.H2B-tagBFP) and Tg(–0.8myl7:ERK-KTR-Clover-p2a-Hsa.H2B-mScarlet) lines, ERK-KTR-Clover was amplified from addgene plasmid #59150 using forward primer: GCAAAGCAGACAGTGAACAAGCTTGCTAGCCCACCATGAAGGGCCGAAAGCCTCGGG and reverse primer: GTTAGTAGCTCCGCTTCCGTCGACGGCGGCGGTCACGAACTCCAGCAGG. The PCR product was cloned into a Tol2 enabled vector containing p2a and H2B. Of note, no F1 adults were recovered for the Tg(–0.8myl7:ERK-KTR-Clover-p2a-Hsa.H2B-tagBFP) line.

All constructs were injected into AB embryos at the one-cell stage (30 pg/embryo) together with Tol2 mRNA (25 pg/embryo) to establish the line.

Live imaging of stopped hearts

Request a detailed protocol

Zebrafish embryos and larvae were mounted in 1.4% low-melt agarose containing 1.6 mg/ml tricaine, to stop the heartbeat, on glass-bottom dishes. The samples were imaged with a Zeiss LSM800 confocal microscope using a 40×/1.1 W objective or a Zeiss LSM880 confocal microscope using a 20×/1.1 W objective.

Live imaging of beating hearts

Request a detailed protocol

Zebrafish embryos were mounted in 0.8% low-melt agarose containing 0.2 mg/ml tricaine on glass-bottom dishes and kept in water containing 0.2 mg/ml tricaine through the experiment. Videos were acquired at 100 frames per second with a Hamamatsu ORCA flash 4.0 sCMOS camera and the image was binned 4 × 4 to achieve a calculated pixel resolution of 0.7 µm (40× objective).

Inhibitor treatments

Request a detailed protocol

Zebrafish embryos were treated with 1 µM Notch inhibitor RO 4929097 for 24 hr (from 24 to 48 hpf), washed twice with egg water containing 0.1% (w/v) 1-phenyl-2-thiourea (PTU) and mounted in 1.4% low-melt agarose with 1.6 mg/ml tricaine for imaging.

Zebrafish embryos were treated with 1 µM MEK inhibitor PD 0325901 or 10 µM ErbB2 inhibitor PD 168393 from 56 to 72 hpf, washed twice with egg water containing 0.1% (w/v) PTU and mounted in 1.4% low-melt agarose with 1.6 mg/ml tricaine for imaging.

EdU staining

Request a detailed protocol

Zebrafish embryos were treated with 1 mM EdU dissolved in 1% DMSO for 24 hr (from 48 to 72 hpf) or 44 hr (from 28 to 72 hpf) in egg water containing 0.1% (w/v) PTU. After treatment, embryos and larvae were washed twice with egg water containing 0.1% (w/v) PTU, anesthetized with 0.2% (w/v) tricaine for 5 min and fixed in 4% PFA at room temperature for 2 hr. The CLICK-IT reaction for EdU labeling was performed as per manufacturer’s protocol (Invitrogen). Samples were processed for immunostaining with anti-GFP, anti-mCherry, and DAPI using the procedure described below.

Immunostaining

Request a detailed protocol

Zebrafish embryos and larvae were collected at different stages and fixed in 4% FPA at room temperature for 2 hr. Next, animals were washed with PBS/1% BSA/1%DMSO/0.5% Triton X-100 (PBDT) and blocked with PBDT/10% goat serum for 1 hr before incubating in primary antibody at 4°C overnight. Samples were washed in PBDT for 30 min × four times and incubated in secondary antibody for 2 hr at room temperature and then incubated with 1 μg/ml DAPI for 10 min and washed with PBS/0.1% Tween.

Primary antibodies used were GFP and mCherry. Phalloidin Alexa Fluor 568 was used to mark F-actin. Secondary antibodies were goat anti-chicken Alexa Fluor 488, goat anti-mouse Alexa Fluor 568, and goat anti-rabbit Alexa Fluor 647.

Image processing

Request a detailed protocol

Confocal data were processed on Imaris x64. Images were prepared using Adobe Photoshop.

Quantification and statistical analysis

Request a detailed protocol

The number of endocardial protrusions at 24 hpf was quantified from maximum intensity projections of the ventricle. The number of endocardial protrusions at 48 hpf was quantified from the mid-sagittal plane of the ventricle. The ratio of trabecular CMs was quantified as previously described (Jiménez-Amilburu et al., 2016). The number of trabeculae in the outer curvature of the ventricle was quantified from the mid-sagittal plane, and delaminating CMs were also counted as trabeculae. The number of trabecular CMs in the outer curvature of the ventricle was quantified from the mid-sagittal plane. The number of multilayered CMs in the outer curvature of the ventricle was also quantified from the mid-sagittal plane. EdU⁺ and Gmnn⁺ CMs were quantified in the entire ventricle. To quantify the volume of the CJ, the drawing tool paintbrush in Fiji was used to mark the space between the endocardium and myocardium in the outer curvature of the ventricle, followed by a 3D surface reconstruction by Imaris. Systolic and diastolic ventricular areas were measured to calculate ejection fractions. Sample sizes are indicated in each figure, one dot representing one sample. All quantifications were analyzed by the Student’s t-test (two tailed) and considered significant at p < 0.05. p-Values are indicated in the figures.

Data availability

Figure 2 - Source Data 1, Figure 4 - Source Data 1, Figure 5 - Source Data 1, Figure 6 - Source Data 1, and Supplementary File 1 contain the numerical data used to generate the figures.

References

(2020) Zebrafish: Housing and husbandry recommendations
Laboratory Animals 54:213–224.
https://doi.org/10.1177/0023677219869037
- PubMed
- Google Scholar
1. Brutsaert DL
2. De Keulenaer GW
3. Fransen P
4. Mohan P
5. Kaluza GL
6. Andries LJ
7. Rouleau J-L
8. Sys SU
(1996) The cardiac endothelium: Functional morphology, development, and physiology
Progress in Cardiovascular Diseases 39:239–262.
https://doi.org/10.1016/S0033-0620(96)80004-1
- PubMed
- Google Scholar
1. Buonanno A
2. Fischbach GD
(2001) Neuregulin and ErbB receptor signaling pathways in the nervous system
Current Opinion in Neurobiology 11:287–296.
https://doi.org/10.1016/s0959-4388(00)00210-5
- PubMed
- Google Scholar
1. Bussmann J
2. Schulte-Merker S
(2011) Rapid BAC selection for tol2-mediated transgenesis in zebrafish
Development (Cambridge, England) 138:4327–4332.
https://doi.org/10.1242/dev.068080
- PubMed
- Google Scholar
(2011) Arterial-venous network formation during brain vascularization involves hemodynamic regulation of chemokine signaling
Development 138:1717–1726.
https://doi.org/10.1242/dev.059881
- PubMed
- Google Scholar
1. Chi NC
2. Shaw RM
3. De Val S
4. Kang G
5. Jan LY
6. Black BL
7. Stainier DYR
(2008) Foxn4 directly regulates tbx2b expression and atrioventricular canal formation
Genes & Development 22:734–739.
https://doi.org/10.1101/gad.1629408
- PubMed
- Google Scholar
1. Chng SC
2. Ho L
3. Tian J
4. Reversade B
(2013) ELABELA: a hormone essential for heart development signals via the apelin receptor
Developmental Cell 27:672–680.
https://doi.org/10.1016/j.devcel.2013.11.002
- PubMed
- Google Scholar
(2017) A Real-Time Biosensor for ERK Activity Reveals Signaling Dynamics during C. elegans Cell Fate Specification
Developmental Cell 42:542–553.
https://doi.org/10.1016/j.devcel.2017.07.014
- PubMed
- Google Scholar
1. Del Monte-Nieto G
2. Ramialison M
3. Adam AAS
4. Wu B
5. Aharonov A
6. D’Uva G
7. Bourke LM
8. Pitulescu ME
9. Chen H
10. de la Pompa JL
11. Shou W
12. Adams RH
13. Harten SK
14. Tzahor E
15. Zhou B
16. Harvey RP
(2018) Control of cardiac jelly dynamics by NOTCH1 and NRG1 defines the building plan for trabeculation
Nature 557:439–445.
https://doi.org/10.1038/s41586-018-0110-6
- PubMed
- Google Scholar
1. Di Marco B
2. Crouch EE
3. Shah B
4. Duman C
5. Paredes MF
6. Ruiz de Almodovar C
7. Huang EJ
8. Alfonso J
(2020) Reciprocal Interaction between Vascular Filopodia and Neural Stem Cells Shapes Neurogenesis in the Ventral Telencephalon
Cell Reports 33:108256.
https://doi.org/10.1016/j.celrep.2020.108256
- PubMed
- Google Scholar
(2016) Sequential Notch activation regulates ventricular chamber development
Nature Cell Biology 18:7–20.
https://doi.org/10.1038/ncb3280
- PubMed
- Google Scholar
(2007) A mutation in zebrafish hmgcr1b reveals A role for isoprenoids in vertebrate heart-tube formation
Current Biology 17:252–259.
https://doi.org/10.1016/j.cub.2006.12.023
- PubMed
- Google Scholar
(2013) Cadherin-dependent filopodia control preimplantation embryo compaction
Nature Cell Biology 15:1424–1433.
https://doi.org/10.1038/ncb2875
- PubMed
- Google Scholar
1. Gassmann M
2. Casagranda F
3. Orioli D
4. Simon H
5. Lai C
6. Klein R
7. Lemke G
(1995) Aberrant neural and cardiac development in mice lacking the ErbB4 neuregulin receptor
Nature 378:390–394.
https://doi.org/10.1038/378390a0
- PubMed
- Google Scholar
1. Gerhardt H
2. Golding M
3. Fruttiger M
4. Ruhrberg C
5. Lundkvist A
6. Abramsson A
7. Jeltsch M
8. Mitchell C
9. Alitalo K
10. Shima D
11. Betsholtz C
(2003) VEGF guides angiogenic sprouting utilizing endothelial tip cell filopodia
The Journal of Cell Biology 161:1163–1177.
https://doi.org/10.1083/jcb.200302047
- PubMed
- Google Scholar
1. Gerhardt H
(2008) VEGF and endothelial guidance in angiogenic sprouting
Organogenesis 4:241–246.
https://doi.org/10.4161/org.4.4.7414
- PubMed
- Google Scholar
1. Grego-Bessa J
2. Luna-Zurita L
3. del Monte G
4. Bolós V
5. Melgar P
6. Arandilla A
7. Garratt AN
8. Zang H
9. Mukouyama Y-S
10. Chen H
11. Shou W
12. Ballestar E
13. Esteller M
14. Rojas A
15. Pérez-Pomares JM
16. de la Pompa JL
(2007) Notch signaling is essential for ventricular chamber development
Developmental Cell 12:415–429.
https://doi.org/10.1016/j.devcel.2006.12.011
- PubMed
- Google Scholar
1. Guerra A
2. Germano RF
3. Stone O
4. Arnaout R
5. Guenther S
6. Ahuja S
7. Uribe V
8. Vanhollebeke B
9. Stainier DY
10. Reischauer S
(2018) Distinct myocardial lineages break atrial symmetry during cardiogenesis in zebrafish
eLife 7:e32833.
https://doi.org/10.7554/eLife.32833
- PubMed
- Google Scholar
(2021) Sculpting the heart: Cellular mechanisms shaping valves and trabeculae
Current Opinion in Cell Biology 73:26–34.
https://doi.org/10.1016/j.ceb.2021.04.009
- PubMed
- Google Scholar
1. Han P
2. Bloomekatz J
3. Ren J
4. Zhang R
5. Grinstein JD
6. Zhao L
7. Burns CG
8. Burns CE
9. Anderson RM
10. Chi NC
(2016) Coordinating cardiomyocyte interactions to direct ventricular chamber morphogenesis
Nature 534:700–704.
https://doi.org/10.1038/nature18310
- PubMed
- Google Scholar
(2013) The zebrafish common cardinal veins develop by a novel mechanism: lumen ensheathment
Development (Cambridge, England) 140:2776–2786.
https://doi.org/10.1242/dev.091876
- PubMed
- Google Scholar
1. Helker CSM
2. Schuermann A
3. Pollmann C
4. Chng SC
5. Kiefer F
6. Reversade B
7. Herzog W
(2015) The hormonal peptide Elabela guides angioblasts to the midline during vasculogenesis
eLife 4:e06726.
https://doi.org/10.7554/eLife.06726
- PubMed
- Google Scholar
1. Helker CSM
2. Mullapudi S-T
3. Mueller LM
4. Preussner J
5. Tunaru S
6. Skog O
7. Kwon H-B
8. Kreuder F
9. Lancman JJ
10. Bonnavion R
11. Dong PDS
12. Looso M
13. Offermanns S
14. Korsgren O
15. Spagnoli FM
16. Stainier DYR
(2019) A whole organism small molecule screen identifies novel regulators of pancreatic endocrine development
Development (Cambridge, England) 146:dev172569.
https://doi.org/10.1242/dev.172569
- PubMed
- Google Scholar
1. Helker CS
2. Eberlein J
3. Wilhelm K
4. Sugino T
5. Malchow J
6. Schuermann A
7. Baumeister S
8. Kwon H-B
9. Maischein H-M
10. Potente M
11. Herzog W
12. Stainier DY
(2020) Apelin signaling drives vascular endothelial cells toward a pro-angiogenic state
eLife 9:e55589.
https://doi.org/10.7554/eLife.55589
- PubMed
- Google Scholar
1. Hellström M
2. Phng L-K
3. Hofmann JJ
4. Wallgard E
5. Coultas L
6. Lindblom P
7. Alva J
8. Nilsson A-K
9. Karlsson L
10. Gaiano N
11. Yoon K
12. Rossant J
13. Iruela-Arispe ML
14. Kalén M
15. Gerhardt H
16. Betsholtz C
(2007) Dll4 signalling through Notch1 regulates formation of tip cells during angiogenesis
Nature 445:776–780.
https://doi.org/10.1038/nature05571
- PubMed
- Google Scholar
1. Holzer T
2. Liffers K
3. Rahm K
4. Trageser B
5. Ozbek S
6. Gradl D
(2012) Live imaging of active fluorophore labelled Wnt proteins
FEBS Letters 586:1638–1644.
https://doi.org/10.1016/j.febslet.2012.04.035
- PubMed
- Google Scholar
(2019) Glutamate signaling at cytoneme synapses
Science (New York, N.Y.) 363:948–955.
https://doi.org/10.1126/science.aat5053
- PubMed
- Google Scholar
(2016) In Vivo Visualization of Cardiomyocyte Apicobasal Polarity Reveals Epithelial to Mesenchymal-like Transition during Cardiac Trabeculation
Cell Reports 17:2687–2699.
https://doi.org/10.1016/j.celrep.2016.11.023
- PubMed
- Google Scholar
(1995) Stages of Embryonic-Development of the Zebrafish
Developmental Dynamics 203:253–310.
https://doi.org/10.1002/aja.1002030302
- PubMed
- Google Scholar
1. Lai D
2. Liu X
3. Forrai A
4. Wolstein O
5. Michalicek J
6. Ahmed I
7. Garratt AN
8. Birchmeier C
9. Zhou M
10. Hartley L
11. Robb L
12. Feneley MP
13. Fatkin D
14. Harvey RP
(2010) Neuregulin 1 sustains the gene regulatory network in both trabecular and nontrabecular myocardium
Circulation Research 107:715–727.
https://doi.org/10.1161/CIRCRESAHA.110.218693
- PubMed
- Google Scholar
1. Lee KF
2. Simon H
3. Chen H
4. Bates B
5. Hung MC
6. Hauser C
(1995) Requirement for neuregulin receptor erbB2 in neural and cardiac development
Nature 378:394–398.
https://doi.org/10.1038/378394a0
- PubMed
- Google Scholar
(2007) Endothelial signalling by the Notch ligand Delta-like 4 restricts angiogenesis
Development (Cambridge, England) 134:839–844.
https://doi.org/10.1242/dev.003244
- PubMed
- Google Scholar
(2012) Multiple influences of blood flow on cardiomyocyte hypertrophy in the embryonic zebrafish heart
Developmental Biology 362:242–253.
https://doi.org/10.1016/j.ydbio.2011.12.005
- PubMed
- Google Scholar
1. Liu J
2. Bressan M
3. Hassel D
4. Huisken J
5. Staudt D
6. Kikuchi K
7. Poss KD
8. Mikawa T
9. Stainier DYR
(2010) A dual role for ErbB2 signaling in cardiac trabeculation
Development (Cambridge, England) 137:3867–3875.
https://doi.org/10.1242/dev.053736
- PubMed
- Google Scholar
(2014) Dynamic association with donor cell filopodia and lipid-modification are essential features of Wnt8a during patterning of the zebrafish neuroectoderm
PLOS ONE 9:e84922.
https://doi.org/10.1371/journal.pone.0084922
- PubMed
- Google Scholar
(2015) Dynamic filopodia are required for chemokine-dependent intracellular polarization during guided cell migration in vivo
eLife 4:e05279.
https://doi.org/10.7554/eLife.05279
- PubMed
- Google Scholar
1. Meyer D
2. Birchmeier C
(1995) Multiple essential functions of neuregulin in development
Nature 378:386–390.
https://doi.org/10.1038/378386a0
- PubMed
- Google Scholar
1. Millard TH
2. Bompard G
3. Heung MY
4. Dafforn TR
5. Scott DJ
6. Machesky LM
7. Fütterer K
(2005) Structural basis of filopodia formation induced by the IRSp53/MIM homology domain of human IRSp53
The EMBO Journal 24:240–250.
https://doi.org/10.1038/sj.emboj.7600535
- PubMed
- Google Scholar
1. Nakagawa H
2. Miki H
3. Nozumi M
4. Takenawa T
5. Miyamoto S
6. Wehland J
7. Small JV
(2003) IRSp53 is colocalised with WAVE2 at the tips of protruding lamellipodia and filopodia independently of Mena
Journal of Cell Science 116:2577–2583.
https://doi.org/10.1242/jcs.00462
- PubMed
- Google Scholar
(2000) Long-term follow-up of 34 adults with isolated left ventricular noncompaction: a distinct cardiomyopathy with poor prognosis
Journal of the American College of Cardiology 36:493–500.
https://doi.org/10.1016/s0735-1097(00)00755-5
- PubMed
- Google Scholar
1. Parsons MJ
2. Pisharath H
3. Yusuff S
4. Moore JC
5. Siekmann AF
6. Lawson N
7. Leach SD
(2009) Notch-responsive cells initiate the secondary transition in larval zebrafish pancreas
Mechanisms of Development 126:898–912.
https://doi.org/10.1016/j.mod.2009.07.002
- PubMed
- Google Scholar
(2011) Dependence of cardiac trabeculation on neuregulin signaling and blood flow in zebrafish
Developmental Dynamics 240:446–456.
https://doi.org/10.1002/dvdy.22526
- PubMed
- Google Scholar
1. Priya R
2. Allanki S
3. Gentile A
4. Mansingh S
5. Uribe V
6. Maischein H-M
7. Stainier DYR
(2020) Tension heterogeneity directs form and fate to pattern the myocardial wall
Nature 588:130–134.
https://doi.org/10.1038/s41586-020-2946-9
- PubMed
- Google Scholar
(2015) Communication between distant epithelial cells by filopodia-like protrusions during embryonic development
Development (Cambridge, England) 142:665–671.
https://doi.org/10.1242/dev.115964
- PubMed
- Google Scholar
(2019) Tie2 regulates endocardial sprouting and myocardial trabeculation
JCI Insight 5:96002.
https://doi.org/10.1172/jci.insight.96002
- PubMed
- Google Scholar
1. Ramírez-Weber FA
2. Kornberg TB
(1999) Cytonemes: cellular processes that project to the principal signaling center in Drosophila imaginal discs
Cell 97:599–607.
https://doi.org/10.1016/s0092-8674(00)80771-0
- PubMed
- Google Scholar
1. Rasouli SJ
2. Stainier DYR
(2017) Regulation of cardiomyocyte behavior in zebrafish trabeculation by Neuregulin 2a signaling
Nature Communications 8:15281.
https://doi.org/10.1038/ncomms15281
- PubMed
- Google Scholar
1. Regot S
2. Hughey JJ
3. Bajar BT
4. Carrasco S
5. Covert MW
(2014) High-sensitivity measurements of multiple kinase activities in live single cells
Cell 157:1724–1734.
https://doi.org/10.1016/j.cell.2014.04.039
- PubMed
- Google Scholar
1. Rottner K
2. Faix J
3. Bogdan S
4. Linder S
5. Kerkhoff E
(2017) Actin assembly mechanisms at a glance
Journal of Cell Science 130:3427–3435.
https://doi.org/10.1242/jcs.206433
- PubMed
- Google Scholar
(2011) Specificity of Drosophila cytonemes for distinct signaling pathways
Science (New York, N.Y.) 332:354–358.
https://doi.org/10.1126/science.1198949
- PubMed
- Google Scholar
(2013) Specialized filopodia direct long-range transport of SHH during vertebrate tissue patterning
Nature 497:628–632.
https://doi.org/10.1038/nature12157
- PubMed
- Google Scholar
1. Sandireddy R
2. Cibi DM
3. Gupta P
4. Singh A
5. Tee N
6. Uemura A
7. Epstein JA
8. Singh MK
(2019) Semaphorin 3E/PlexinD1 signaling is required for cardiac ventricular compaction
JCI Insight 4:125908.
https://doi.org/10.1172/jci.insight.125908
- PubMed
- Google Scholar
1. Schindelin J
2. Arganda-Carreras I
3. Frise E
4. Kaynig V
5. Longair M
6. Pietzsch T
7. Preibisch S
8. Rueden C
9. Saalfeld S
10. Schmid B
11. Tinevez J-Y
12. White DJ
13. Hartenstein V
14. Eliceiri K
15. Tomancak P
16. Cardona A
(2012) Fiji: an open-source platform for biological-image analysis
Nature Methods 9:676–682.
https://doi.org/10.1038/nmeth.2019
- PubMed
- Google Scholar
(2008) IRSp53: crossing the road of membrane and actin dynamics in the formation of membrane protrusions
Trends in Cell Biology 18:52–60.
https://doi.org/10.1016/j.tcb.2007.12.002
- PubMed
- Google Scholar
1. Sedmera D
2. Thomas PS
(1996) Trabeculation in the embryonic heart
BioEssays: News and Reviews in Molecular, Cellular and Developmental Biology 18:607.
https://doi.org/10.1002/bies.950180714
- PubMed
- Google Scholar
(2000) Developmental patterning of the myocardium
The Anatomical Record 258:319–337.
https://doi.org/10.1002/(SICI)1097-0185(20000401)258:4<319::AID-AR1>3.0.CO;2-O
- PubMed
- Google Scholar
1. Siekmann AF
2. Lawson ND
(2007) Notch signalling limits angiogenic cell behaviour in developing zebrafish arteries
Nature 445:781–784.
https://doi.org/10.1038/nature05577
- PubMed
- Google Scholar
1. Stainier DY
2. Fishman MC
(1992) Patterning the zebrafish heart tube: acquisition of anteroposterior polarity
Developmental Biology 153:91–101.
https://doi.org/10.1016/0012-1606(92)90094-w
- PubMed
- Google Scholar
1. Stanganello E
2. Hagemann AIH
3. Mattes B
4. Sinner C
5. Meyen D
6. Weber S
7. Schug A
8. Raz E
9. Scholpp S
(2015) Filopodia-based Wnt transport during vertebrate tissue patterning
Nature Communications 6:5846.
https://doi.org/10.1038/ncomms6846
- PubMed
- Google Scholar
1. Stankunas K
2. Hang CT
3. Tsun Z-Y
4. Chen H
5. Lee NV
6. Wu JI
7. Shang C
8. Bayle JH
9. Shou W
10. Iruela-Arispe ML
11. Chang C-P
(2008) Endocardial Brg1 represses ADAMTS1 to maintain the microenvironment for myocardial morphogenesis
Developmental Cell 14:298–311.
https://doi.org/10.1016/j.devcel.2007.11.018
- PubMed
- Google Scholar
1. Staudt DW
2. Liu J
3. Thorn KS
4. Stuurman N
5. Liebling M
6. Stainier DYR
(2014) High-resolution imaging of cardiomyocyte behavior reveals two distinct steps in ventricular trabeculation
Development (Cambridge, England) 141:585–593.
https://doi.org/10.1242/dev.098632
- PubMed
- Google Scholar
1. Stöllberger C
2. Finsterer J
(2004) Left ventricular hypertrabeculation/noncompaction
Journal of the American Society of Echocardiography 17:91–100.
https://doi.org/10.1016/S0894-7317(03)00514-5
- PubMed
- Google Scholar
1. Suchting S
2. Freitas C
3. le Noble F
4. Benedito R
5. Bréant C
6. Duarte A
7. Eichmann A
(2007) The Notch ligand Delta-like 4 negatively regulates endothelial tip cell formation and vessel branching
PNAS 104:3225–3230.
https://doi.org/10.1073/pnas.0611177104
- PubMed
- Google Scholar
1. Suri C
2. Jones PF
3. Patan S
4. Bartunkova S
5. Maisonpierre PC
6. Davis S
7. Sato TN
8. Yancopoulos GD
(1996) Requisite role of angiopoietin-1, a ligand for the TIE2 receptor, during embryonic angiogenesis
Cell 87:1171–1180.
https://doi.org/10.1016/s0092-8674(00)81813-9
- PubMed
- Google Scholar
1. Sweeney C
2. Fambrough D
3. Huard C
4. Diamonti AJ
5. Lander ES
6. Cantley LC
7. Carraway KL
(2001) Growth factor-specific signaling pathway stimulation and gene expression mediated by ErbB receptors
The Journal of Biological Chemistry 276:22685–22698.
https://doi.org/10.1074/jbc.M100602200
- PubMed
- Google Scholar
(2020) Sensory Neuroblast Quiescence Depends on Vascular Cytoneme Contacts and Sensory Neuronal Differentiation Requires Initiation of Blood Flow
Cell Reports 32:107903.
https://doi.org/10.1016/j.celrep.2020.107903
- PubMed
- Google Scholar
1. Tachibana K
2. Jones N
3. Dumont DJ
4. Puri MC
5. Bernstein A
(2005) Selective role of a distinct tyrosine residue on Tie2 in heart development and early hematopoiesis
Molecular and Cellular Biology 25:4693–4702.
https://doi.org/10.1128/MCB.25.11.4693-4702.2005
- PubMed
- Google Scholar
1. Uribe V
2. Ramadass R
3. Dogra D
4. Rasouli SJ
5. Gunawan F
6. Nakajima H
7. Chiba A
8. Reischauer S
9. Mochizuki N
10. Stainier DYR
(2018) In vivo analysis of cardiomyocyte proliferation during trabeculation
Development 145:dev164194.
https://doi.org/10.1242/dev.164194
- PubMed
- Google Scholar
1. Wee P
2. Wang Z
(2017) Epidermal Growth Factor Receptor Cell Proliferation Signaling Pathways
Cancers 9:E52.
https://doi.org/10.3390/cancers9050052
- PubMed
- Google Scholar
(2007) Apelin and its receptor control heart field formation during zebrafish gastrulation
Developmental Cell 12:391–402.
https://doi.org/10.1016/j.devcel.2007.01.011
- Google Scholar

Article and author information

Author details

Jialing Qi

Department of Developmental Genetics, Max Planck Institute for Heart and Lung Research, Bad Nauheim, Germany

Contribution
Conceptualization, Data curation, Investigation, Methodology, Project administration, Validation, Visualization, Writing – original draft

Competing interests
No competing interests declared
Annegret Rittershaus

Department of Developmental Genetics, Max Planck Institute for Heart and Lung Research, Bad Nauheim, Germany

Present address
Philipps-University Marburg, Faculty of Biology, Cell Signaling and Dynamics, Marburg, Germany

Contribution
Resources

Competing interests
No competing interests declared
Rashmi Priya

Department of Developmental Genetics, Max Planck Institute for Heart and Lung Research, Bad Nauheim, Germany

Present address
The Francis Crick Institute, Organ Morphodynamics Laboratory, London, United Kingdom

Contribution
Resources

Competing interests
No competing interests declared

"This ORCID iD identifies the author of this article:" 0000-0002-0510-7515
Shivani Mansingh

Department of Developmental Genetics, Max Planck Institute for Heart and Lung Research, Bad Nauheim, Germany

Present address
Biozentrum, University of Basel, Basel, Switzerland

Contribution
Resources

Competing interests
No competing interests declared
Didier YR Stainier

Department of Developmental Genetics, Max Planck Institute for Heart and Lung Research, Bad Nauheim, Germany

Contribution
Conceptualization, Funding acquisition, Resources, Software, Supervision, Writing – review and editing

For correspondence
Didier.Stainier@mpi-bn.mpg.de

Competing interests
Senior editor, eLife

"This ORCID iD identifies the author of this article:" 0000-0002-0382-0026
Christian SM Helker

Department of Developmental Genetics, Max Planck Institute for Heart and Lung Research, Bad Nauheim, Germany

Contribution
Conceptualization, Funding acquisition, Project administration, Resources, Supervision, Writing – original draft, Writing – review and editing

For correspondence
christian.helker@biologie.uni-marburg.de

Competing interests
No competing interests declared

"This ORCID iD identifies the author of this article:" 0000-0003-0427-5338

Funding

Max-Planck-Gesellschaft

Didier YR Stainier true

Deutsche Forschungsgemeinschaft (SFB834)

Didier YR Stainier true
Christian SM Helker

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Acknowledgements

We thank Gisela Thana Hartmann, Sarah Howard, Dr Radhan Ramadass, and all fish facility staff for their technical support; Dr Thomas Juan, Dr Samuel Capon, Dr Jordan Welker, Dr Giulia Boezio, and Yiu Chun Law for critical comments on the manuscript; Dr Stefan Baumeister for the schematic model; and Dr Gonzalo del Monte-Nieto for discussion. Research in the Stainier laboratory is supported in part by the Max Planck Society, the DFG (SFB 834/4) and the Leducq Foundation. Research in the Helker laboratory is supported in part by the DFG (SFB 834/4).

Ethics

All zebrafish husbandry was performed under standard conditions in accordance with institutional (MPG) and national (German) ethical and animal welfare regulations. All experiments conducted on animals conform to the guidelines from Directive 2010/63/EU of the European Parliament on the protection of animals used for scientific purposes and were approved by the Animal Protection Committee (Tierschutzkommission) of the Regierungspräsidium Darmstadt (Proposal numbers: B2/1017, B2/1041, B2/1138, B2/1218).

Version history

Received: August 20, 2021
Preprint posted: August 31, 2021 (view preprint)
Accepted: February 25, 2022
Accepted Manuscript published: February 28, 2022 (version 1)
Version of Record published: March 11, 2022 (version 2)

Copyright

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.