Plant Pathol J > Volume 34(5); 2018 > Article
Kwak, Kim, Kim, Seo, Kim, and Choi: Complete Genome Sequence Analysis of Two Divergent Groups of Sweet potato chlorotic fleck virus Isolates Collected from Korea

Abstract

The Sweet potato chlorotic fleck virus (SPCFV), of the genus Carlavirus (family Betaflexiviridae), was first detected as one of several viruses infecting sweet potatoes (Ipomea batatas L.) in Korea. Out of 154 sweet potato samples collected in 2012 that were showing virus-like symptoms, 47 (31%) were infected with SPCFV, along with other viruses. The complete genome sequences of four SPCFV isolates were determined and analyzed using previously reported genome sequences. The complete genomes were found to contain 9,104-9,108 nucleotides, excluding the poly-A tail, containing six putative open reading frames (ORFs). Further, the SPCFV Korean isolates were divided into two groups (Group I and Group II) by phylogenetic analysis based on the complete nucleotide sequences; Group I and Group II had low nucleotide sequence identities of about 73%. For the first time, we determined the complete genome sequence for the Group II SPCFV isolates. The amino acid sequence identity in coat proteins (CP) between the two groups was over 90%, whereas the amino acid sequence identity in other proteins was less than 80%. In addition, SPCFV Korean isolates had a low amino acid sequence identity (61% CPs and 47% in the nucleotide- binding protein [NaBp] region) to that of Melon yellowing-associated virus (MYaV), a typical Carlavirus.

Sweet potatoes (Ipomea batatas L., family Convolvulaceae) are grown extensively throughout tropical and temperate regions and are the seventh most important food crop in the world in terms of production. According to Food and Agriculture Organization Corporate Statistical Database (FAOSTAT) data from 2014, sweet potatoes have been cultivated across 8.4 million ha, with the production of 107 million tons worldwide. In Korea, sweet potatoes are cultivated across 20,515 ha, resulting in the production of 322,071 tons, with output increasing every year (FAOSTAT, 2014).
Viral diseases affecting sweet potatoes have become widespread, causing serious crop losses around the world. To date, more than 30 viruses have been identified that infect sweet potatoes (Brunt et al., 1996; Clark et al., 2012). In Korea, eight viruses have been reported, including the Sweet potato feathery mottle virus (SPFMV), Sweet potato virus C (SPVC), Sweet potato virus G (SPVG), Sweet potato virus 2 (SPV2), and Sweet potato latent virus (SPLV) belonging to the genus Potyvirus in the family Potyviridae; Sweet potato leaf curl virus (SPLCV), belonging to the genus Begomovirus in the family Geminiviridae; Sweet potato symptomless virus 1 (SPSMV-1), belonging to the genus Mastrevirus in the family Geminiviridae; and Sweet potato chlorotic fleck virus (SPCFV), belonging to the genus Carlavirus in the family Betaflexiviridae (Kwak et al., 2006, 2014). Most sweet potato virus symptoms result from a mixed infection of at least two of these eight viruses (Kwak et al., 2014). Among these eight viruses, SPFMV and SPVC are very prevalent in Korea (Kwak et al., 2014).
SPCFV was first detected in sweet potatoes showing fine chlorotic spots in Peru. It has since been detected in several countries of South America, Asia, and South Africa, and the complete genome sequence of an isolate from Uganda has been characterized (Aritua et al., 2007). SPCFV reportedly causes a synergistic disease when sweet potatoes are co-infected with Sweet potato chlorotic stunt virus (SPCSV) (Untiveros et al., 2007). In Korea, SPCFV occurred in 31% of samples collected from most areas of Korea in 2012 (Kwak et al., 2014). However, the incidence rates of SPCFV decreased to 0% and 2.5% in 2013 and 2014, respectively (Kim et al., 2017).
SPCFV is a positive-sense single-stranded RNA virus with a genome of approximately 9.1 kb that potentially includes six open reading frames (ORFs). ORF1 encodes a viral replicase (Rep), ORF2 to ORF4 encode triple gene block (TGB) proteins (TGB1, TGB2, and TGB3), and ORF5 encodes the coat protein (CP). Further, ORF6 encodes a putative nucleotide-binding protein (NaBp) (Aritua et al., 2007).
In this study, to analyze the genetic structure and variability of Korean SPCFV isolates, we determined the complete genome sequences of four SPCFV isolates based on geographic location from sweet potato samples collected in 2012 (Kwak et al., 2014).
Total RNA was extracted from the infected sweet potato leaf, petiole, and stem samples using an Easy-spin™ total RNA extraction kit (Intron, Korea) according to the manufacturer’s instructions. Reverse transcription polymerase chain reaction (RT-PCR) was performed as a two-step procedure; RT was conducted using Avian myeloblastosis virus (AMV) reverse transcriptase (Promega, USA), and PCR was carried out using high-fidelity LA taq polymerase (Takara, Japan). Specific PCR primer pairs were designed for primer walking and subsequent sequencing to obtain the complete genome sequences based on previously reported SPCFV nucleotide sequences (Table 1, 2). End sequences of each RNA segment were obtained according to the 5′ and 3′ rapid amplification of cDNA ends (RACE) protocol (BM, Germany). cDNA clones containing the 5′ end of the genome were obtained using the Xec primer (5′-AAAGAATTCCCCCCCCCCCCC-3′) and SPCFV_5′-race-R primer complementary to nucleotides 262-239 of the SPCFV genome. In addition, cDNA clones containing the 3′ end of the genome were obtained using a SPCFV 3′-race-F primer complementary to nucleotides 8,718-8,737 and an anchor primer (5′-GACCACGCGTATCGATGTCGACTTTTTTTTTTTTTTTTV-3′).
The complete genomes of Korean SPCFV isolates ranged from 9,104 to 9,108 nucleotides, excluding the poly-A tails, and encoded six ORFs. The genomic organization of the Korean SPCFV isolates was typical for members of the Carlavirus genus. ORF1 encodes a viral replicase (2,090 aa in size), and ORF2 to ORF4 encode TGB proteins, including TGB1, TGB2, and TGB3 (240 aa, 108 aa, and 67 aa in size, respectively). ORF5 encodes the CP (299 aa), and ORF6 encodes a NaBp (133 aa). The 5′ and 3′ non-coding regions (NCR) are 65 and 52 nucleotides in length, respectively. The full-length genome sequences are available in the GenBank database, with the accession numbers listed in Table 3.
To analyze phylogenetic relationships, the complete nucleotide sequences and deduced amino acid (aa) sequences were aligned using the ClustalX2 program and Geneious methods in Geneious Pro 8 and compared to those of previously reported isolates (Table 3). Melon yellowing-associated virus (MYaV, accession no. AY373028) was used as an outgroup. Genius Pro 8 software was used to calculate the percentages of nucleotide and aa identities. Phylogenetic analyses were performed according to the maximum-likelihood method implemented in MEGA 6 (Tamura et al., 2013). All phylogenic tests were conducted using the best substitution model for nucleotides or amino acids, with 1,000 bootstrap replicates.
The complete nucleotide and deduced aa sequences of 4 SPCFV isolates were compared to those previously reported for virus isolates. According to a previous report, SPCFV is divided geographically into African and Peruvian isolates and Asian isolates (Aritua et al., 2009). Phylogenetic analysis indicated that Korean SPCFV isolates are clustered into the Asian isolates, including Chinese, Taiwanese, and Australian isolates. Furthermore, Korean SPCFV isolates could be largely divided into two groups (Group I and Group II) (Fig. 1). The nucleotide and aa sequence identities between SPCFV isolates are summarized in Table 4. Based on the full-length and partial genome nucleotide sequences, SPCFV isolates can be split into two groups with low nucleotide sequence identities of about 73-78%, while the intragroup nucleotide sequence identity ranged from 86% to 98%. Especially, the Korean SPCFV-SC20 isolate belonging to Group I showed 88.4% nucleotide sequence identity with the Uganda isolate, SPCFV-Hoima 4; 73% nucleotide sequence identity with SPCFV-HG176, belonging to Group II; and 61% nucleotide sequence identity with the closest Carlavirus, MYaV. The complete genome sequence of Group II SPCFV isolates (HG176) was determined in this study for the first time.
Regarding the deduced aa sequences of six individual proteins, the aa sequence identity in CPs between Group I and Group II was over 90%, whereas the identities in other proteins were less than 80%. The Korean SPCFV-SC20 isolate showed a relatively high aa sequence identity (91-100%) with Group I, including the Uganda isolate, SPCFV-Hoima 4. However, the Korean SPCFV-SC20 isolate showed 69-93% aa sequence identity with Group II, including the Korean isolate, SPCFV-HG176. Further, the Korean SPCFV-SC20 isolate showed low aa sequence identities (61% and 47% in CPs and NaBp region, respectively) with those of MYaV.
According to a report by the International Committee on Taxonomy of Viruses (ICTV), criteria for species classification of the family Betaflexiviridae include less than 72% nucleotide identity (or 80% aa identity of the encoded proteins) in the CP or replicase genes (Adams et al., 2011). Two groups of SPCFV Korean isolates belong to the same species to meet the criteria above.
Recently, the complete genome sequences of two SPCFV isolates (Tm37 and AusCan isolates) and other partial sequences have been reported, and phylogenetic relationships of SPCFV based on CPs and NaBp nucleotide sequences have been analyzed (Maina et al., 2016; Tugume et al., 2016). According to these reports, SPCFV isolates, including Korean isolates, can be divided into East African and Asian groups (Asian 1 and Asian 2) geographically.
Recombination has been shown to significantly contribute to virus diversity. To examine whether recombination events have occurred within the SPCFV isolates, we aligned full-length nucleotide sequences of seven isolates including four Korean isolates, using the Geneious method in Geneious Pro 8 and analyzed them using the RDP, GENECONV, BootScan, MaxChi, Chimaera, SiScan and 3Seq methods implemented in the RDP4 software with a highest acceptable P-value of 0.01. In total, 10 potential recombinant events were detected by at least one of the methods (Table 5). However, most isolates seemed to be ‘tentative’ recombinants, as they were supported by less than four methods or one of the parental isolates was labeled as ‘unknown’. No significant recombination was detected in seven isolates. Korean SPCFV isolate HN83 showed some recombination spots, however, it is likely that genetic exchange by recombination is infrequent in natural populations of SPCFV. Further analyses of genetic population structure of SPCFV with more diverse full-genome sequences of worldwide isolates will be required for in-depth understanding of the evolutionary history of SPCFV.
In conclusion, it is essential to understand the molecular variation of viruses when designing knowledge-based control strategies. This study reports the complete genome sequences of SPCFV Group II isolates (denoted Asian 2 group by Tugume et al., 2016) for the first time. However, all SPCFV isolates found in Korea were infected with multiple viruses. Further, these SPCFV isolates have not been shown to mechanically infect previously reported host plants (Aritua et al., 2009). To better understand the relationship between genetic variation and pathogenicity in Korean SPCFV isolates, full-length infectious clones of two divergent SPCFV isolates will be required to elucidate biological characteristics of the two groups, including symptoms and host range.

Acknowledgments

This research was supported by grants from the Agenda Program (PJ PJ01130602) of the Rural Development Administration and Agricultural Biotechnology Development Program (iPET: No. 110034-05-5-HD110) from Ministry of Agriculture, Food and Rural Affairs of Republic of Korea.

Fig. 1
Phylogenetic trees reconstructed using the complete and partial nucleotide sequences of the SPCFV isolates. Phylogenetic trees were reconstructed using the maximum-likelihood method in MEGA 6.
ppj-34-451f1.gif
Table 1
Full sequencing primers for Group I of SPCFV
Fragment Name Sequence (5’ → 3’) Loci* Size (bp)
P1 spcfv-full-1f TGCTGAAGAGGCACTATCCTCC 86-107 1060
spcfv-full-1r AGCAGACTGAACATCTGGCTTC 1145-1124
spcfv-full-2f-1 TGCAATGATGGTACWGTCTATAGTG 897-921 1173
spcfv-full-2r-1 CCTTTGAGRCTTCTARWGCTTC 2070-2049
spcfv-full-3f ACGGGCTCATTTGGTTCTTG 1810-1829 1027
spcfv-full-3r GCTTCAGTGTCCCTGGATTCAC 2836-2815
spcfv-full-4f AGATGCCAAGAGATTTCCAAGAG 2629-2651 1050
spcfv-full-4r AGGTGCCACCTCCTCTAGCTC 3678-3658

P2 spcfv-full-5f-1 TTTGATATWTGCGGGGTGTGC 3462-3482 1016
spcfv-full-5r GCGAGGGCACGACATTCCT 4477-4459
spcfv-full-6f-1 CAAAGTGATTATGACTCTCTGCG 4254-4276 1108
spcfv-full-6r-1 TCGAAGTCCTGYACAGCCTTATC 5361-6340
spcfv-full-7f AGAGATTTGCAGCCATCTACCC 5149-5161 1027
spcfv-full-7r ATTGCATAATTATCCAGGCATTC 6175-6153
spcfv-full-8f AACACTTAAGACAGAGCATGATGG 5978-6001 1085
spcfv-full-8r TTAGAATAGTCCGCGGGTGG 7063-7044

P3 spcfv-full-9f GGCCACAAGAAGTGAGGGG 6894-6912 1061
SPCFV 1R AAGGTCTGTAGTTTTCCATGTACC 7954-7931
SPCFV 1F ATGTTTGCTGGGGAGAGTCAGG 7555-7576
SPCFV 2F-1 AAAGTGGAACAGGGAGCCCG 8067-8086 1038
SPCFV 2R GCTCAAAAGTACTTTAAAACATGC 9104-9081

RACE SPCFV 3’-F GTGATTGGGAYYGYTGTCTT 8718-8737 387
SPCFV 5’-R GGTGAAACAGGTGAGAGGTATATC 262-239 262

* Reference sequence: SPCFV- Hoima 4 (AY461421)

Table 2
Full sequencing primers for Group II of SPCFV
Fragment Name Sequence (5’ → 3’) Loci* Size (bp)
P1 spcfv-full-1f TGCTGAAGAGGCACTATCCTCC 86-107 1060
spcfv-full-1r AGCAGACTGAACATCTGGCTTC 1145-1124
SPCFV(II)-2F ATTCGCCCACCACTTAATTAGTATC 944-968 1089
SPCFV(II)-2R TGGTGATTCAACTGCATTCGGGTC 2032-2009
SPCFV(II)-3F AAGGGCAAGTGGTTTTCAAGTAAC 1850-1870 1032
SPCFV(II)-3R GGGCCTCATGACTACCAGAGTCAG 2881-2858
SPCFV(II)-4F GCCTGAGGGGTTTCAGGAGAAGT 2638-2660 1103
SPCFV(II)-4R GCAGAAGGTCCAAAATGTAGTCCTT 3740-3720

P2 SPCFV(II)-5F GCAAGATCGAAGCACTCAAGGATC 3602-3625 744
SPCFV(II)-5R CGGAACCAAGGCTCTACACTCATC 4483-4460
spcfv-full-6f-1 CAAAGTGATTATGACTCTCTGCG 4254-4276 1108
spcfv-full-6r-1 TCGAAGTCCTGYACAGCCTTATC 5361-6340
SPCFV(II)-7F ATTGACCAATGCCGCAGAGAGG 5126-5146 1096
SPCFV(II)-7R GGTAGGACCTTCTCTCCCAA 6222-6200
spcfv-full-8f AACACTTAAGACAGAGCATGATGG 5978-6001 1085
spcfv-full-8r TTAGAATAGTCCGCGGGTGG 7063-7044

P3 SPCFV(II)-9F ACTACAGCCTATTTGGCCAAGC 6738-6760 1149
SPCFV(II)-9R GGAGATCTCACCCTGCGCA 7887-7879
SPCFV 1F ATGTTTGCTGGGGAGAGTCAGG 7555-7576
SPCFV 2F-1 AAAGTGGAACAGGGAGCCCG 8067-8086 1038
SPCFV 2R GCTCAAAAGTACTTTAAAACATGC 9104-9081

RACE SPCFV 3’-F GTGATTGGGAYYGYTGTCTT 8718-8737 387
SPCFV 5’-R GGTGAAACAGGTGAGAGGTATATC 262-239 262

* Reference sequence: SPCFV- Hoima 4 (AY461421)

Table 3
Database of the complete and partial nucleotide sequences of SPCFV isolates infecting sweet potato
Virus Isolatec Origin Genome size (nt) NCBI accession No.
SPCFVa SC20 Sacheon, Korea 9,104 KP115606
UN210 Muan, Korea 9,104 KP115607
HN83 Haenam, Korea 9,104 KP115605
HG176 Muan, Korea 9,108 KP715159

Hoima 4 Uganda 9,104 AY461421
KBL38 Uganda EU375903
94-15 Kenay EU375900
KY5 Kenay EU375904
CIP Peru EU375899
Tar Tanzania AJ781296
Gwangzhu1 China EU375901
B-Guangdong-11-5 China KC130184
B-Jiangxi-11-4 China KC130185
AusCan Australia EF990647
TN340 Taiwan EU375898

MYaVb MB-10 Brazil AY373028

a Sweet potato chlorotic fleck virus (SPCFV),

b Melon yellowing-associated virus (MYaV),

c Isolates analyzed in this study are shown in boldface.

Table 4
Nucleotide and amino acid sequence identities (%) between Korean isolates SPCFV-SC20 and other SPCFV isolates infecting sweet potato
Virus isolate Genome (nt) 5’UTR (nt) Rep (aa) TGB1 (aa) TGB2 (aa) TGB3 (aa) CP (aa) NaBp (aa) 3’UTR (nt)
UN210-Korea 98.4 100.00 98.7 100.00 100.00 97.0 99.7 99.2 100.00
HN83-Korea 88.5 93.8 93.1 91.3 97.2 92.5 97.7 94.0 98.1
Hoima 4-Uganda 88.4 96.8 92.9 91.3 96.3 86.6 96.0 93.2 98.1
KBL38-Uganda 88.4 - - - - 95.7 88.7 96.2
94-15-Kenay 88.7 - - - - - 95.7 91.7 98.1
Tar-Tanzania 88.7 - - - - - 95.3 92.5 98.1
CIP -Peru 88.7 - - - - - 95.7 91.7 98.1
KY5-Kenay 89.5 - - - - - 96.7 91.0 94.2
Gwangzhu1-China 88.5 - - - - - 96.3 90.3 98.1
AusCan -Aus 86.3 - - - - - 95.7 - -
B-Guangdong-11-5-China 85.9 - - - - - 95.7 - -

HG176-Korea 73.2 90.8 78.4 77.6 89.8 68.7 93.3 77.4 96.2
B-Jiangxi-11-4-China 76.5 - - - - - 92.6 - -
TN340-Taiwan 77.6 - - - - - 91.3 78.9 98.1
MB-10-Brazil* 61.3 - - 52.6 69.7 24.6 61.9 46.7 69.1

* MYaV (Melon yellowing-associated virus) as an outgroup

Table 5
Recombination in SPCFV isolates
Recombination event No. Recombinant isolate Recombination site in genome Genesaffected Parental isolatesa RDP4b P-valuec

start End
1 Hoima 4 744 4167 Rep HN83 × AusCan MCS3 2.41E-04
2 HN83 4521 4718 Rep SC20 × Hoima 4 BS 1.04E-05
3 HN83 8725 8969 NaBp SC20 × AusCan RBMCS3 9.30E-03
4 HN83 6663 6860 TGB1 SC20 × Unknown BS 7.20E-03
5 AusCan 6786 6817 TGB1 Unknown × HN83 MC3 5.94E-03
6 Hoima 4 2938 2972 Rep SC20 × HN83 GC 2.16E-02
7 HN83 1048 1254 Rep Unknown × Hoima 4 RS 3.07E-02
8 HN83 2673 2679 Rep Hoima 4 × HG176 N3 3.28E-02
9 Hoima 4 7532 7833 TGB3, CP Unknown × HN83 MCS 6.69E-03
10 Tm37 6836 6851 TGB1 HG176 × Unknown S3 1.03E-10

a ‘Parental isolates’ indicates the most likely isolates among those analyzed; Major parent × minor parent.

b RDP4-implemented methods that supported the corresponding recombination site: R (RDP), G (GENECONV), B (BootScan), M (MaxChi), C (Chimaera), and S (SiScan), 3 (3Seq).

c The highest P-value among the RDP4-implemented methods is reported. The corresponding method is shown boldface.

References

Adams, MJ, Candresse, T, Hammond, J, Kreuze, J, Martelli, GP, Namba, S, Pearson, MN, Ryu, KH, Saldarelli, P and Yoshikawa, N 2011. Family. Betaflexiviridae. In: Virus Taxonomy - Ninth Report on the International Committee on Taxonomy of Viruses, eds. by AMQ King, MJ Adams, EB Carstens and EJ Lefkowitz, 920-941. Elsevier Academic Press, London, UK.
Aritua, V, Barg, E, Adipala, E and Vetten, HJ 2007. Sequence analysis of the entire RNA genome of Sweet potato chlorotic fleck virus reveals that it belongs to a distinct carlavirus species. Arch Virol. 152:813-818.
crossref pmid
Aritua, V, Barg, E, Adipala, E, Gibson, RW, Lesemann, DE and Vetten, HJ 2009. Host range, purification, and genetic variability in Sweet potato chlorotic fleck virus. Plant Dis. 93:87-93.
crossref pmid
Brunt, AA, Crabtree, K, Dallwitz, MJ, Gibbs, AJ and Watson, L 1996. Viruses of Plants Descriptions and Lists from the VIDE Database. CAB International, Wallingford, UK. 1484.
Clark, CA, Davis, JA, Abad, JA, Cuellar, WJ, Fuentes, S, Kreuze, JF, Gibson, RW, Mukasa, SB, Tugume, AK, Tairo, FD and Valkonen, JPT 2012. Sweetpotato viruses: 15 years of progress on understanding and managing complex diseases. Plant Dis. 96:168-185.
crossref pmid
Kim, J, Yang, JW, Kwak, HR, Kim, MK, Seo, JK, Chung, MN, Lee, HU, Lee, KB, Nam, SS, Kim, CS, Lee, GS, Kim, JS, Lee, S and Choi, HS 2017. Virus Incidence of Sweet Potato in Korea from 2011 to 2014. Plant Pathol J. 33:467-477.
crossref pmid pmc
Kwak, HR, Kim, MK, Chung, MN, Lee, SH, Park, JW, Kim, KH and Choi, HS 2006. Virus diseases incidences of sweet potato in Korea. Plant Pathol J. 22:239-247.
Kwak, HR, Kim, MK, Shin, JC, Lee, YJ, Seo, JK, Lee, HU, Jung, MN, Kim, SH and Choi, HS 2014. The Current Incidence of Viral Disease in Korean Sweet Potatoes and Development of Multiplex RT-PCR Assays for Simultaneous Detection of Eight Sweet Potato Viruses. Plant Pathol J. 30:416-424.
crossref pmid pmc
Maina, S, Edwards, OR, de Almeida, L, Ximenes, A and Jones, RAC 2016. Complete genome sequences of the Carlavirus Sweet potato chlorotic fleck virus from East Timor and Australia. Genome Announc. 4:e00414-e00416.
crossref pmid pmc pdf
Tamura, K, Stecher, G, Peterson, D, Filipski, A and Kumar, S 2013. MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Mol Biol Evol. 30:2725-2729.
crossref pmid pmc
Tugume, AK, Mukasa, SB and Valkonen, JP 2016. Mixed infections of four viruses, the incidence and phylogenetic relationships of Sweet potato chlorotic fleck virus (Betaflexiviridae) isolates in wild species and sweetpotatoes in Uganda and evidence of distinct isolates in East Africa. PloS One. 11:e0167769
crossref pmid pmc
Untiveros, M, Fuentes, S and Salazar, LF 2007. Synergistic interaction of Sweet potato chlorotic stunt virus (Crinivirus) with carla-, cucumo-, ipomo-, and potyviruses infecting sweet potato. Plant Dis. 91:669-676.
crossref pmid


ABOUT
BROWSE ARTICLES
EDITORIAL POLICY
FOR CONTRIBUTORS
Editorial Office
Rm,904 (New Bldg.) The Korean Science & Technology Center 22,
Teheran-ro 7-Gil, Gangnamgu, Seoul 06130, Korea
Tel: +82-2-557-9360    Fax: +82-2-557-9361    E-mail: paper@kspp.org                

Copyright © 2024 by Korean Society of Plant Pathology.

Developed in M2PI

Close layer
prev next