Amenis ponina subsp. rogeri Orellana 2010, stat. nov.
Creators
- 1. Department of Biophysics, University of Texas Southwestern Medical Center, 5323 Harry Hines Blvd., Dallas, TX 75390 - 9050, USA Department of Biochemistry, University of Texas Southwestern Medical Center, 5323 Harry Hines Blvd., Dallas, TX 75390 - 9050, USA
- 2. Department of Biophysics, University of Texas Southwestern Medical Center, 5323 Harry Hines Blvd., Dallas, TX 75390 - 9050, USA Department of Biochemistry, University of Texas Southwestern Medical Center, 5323 Harry Hines Blvd., Dallas, TX 75390 - 9050, USA & Department of Eugene McDermott Center For Human Growth & Development, University of Texas Southwestern Medical Center, 5323 Harry Hines Blvd., Dallas, TX 75390 - 9050, USA
- 3. Universidad Nacional Experimental del Táchira, Vicerrectorado Académico, Decanato de Docencia, Departamento de Ingeniería de Producción Animal, San Cristóbal, Táchira, Venezuela
- 4. Laubacher Str. 4, 35423 Lich, Hessen, Germany
- 5. Caixa postal 1206, 84.145 - 000 Carambeí, Paraná, Brazil
- 6. Departamento de Zoologia, Universidade Federal do Paraná, Caixa postal 19020, 81531 - 980 Curitiba, Paraná, Brazil
- 7. Museo del Instituto de Zoología Agrícola " Francisco Fernandez Yépez ", Universidad Central de Venezuela, Maracay 2103, Venezuela and res. Las Cumbres, avenida Las acacias, La Florida, Caracas 1050, Venezuela
- 8. Department of Biophysics, University of Texas Southwestern Medical Center, 5323 Harry Hines Blvd., Dallas, TX 75390 - 9050, USA Department of Biochemistry, University of Texas Southwestern Medical Center, 5323 Harry Hines Blvd., Dallas, TX 75390 - 9050, USA & National Museum of Natural History, Smithsonian Institution, Washington, DC, USA
Description
Amenis ponina rogeri Orellana, [2010], stat. nov.
The original description of Amenis rogeri Orellana, [2010] discussed and illustrated the similarity of its genitalia with Amenis ponina (Herrich-Schäffer, 1869), suggesting that there are no diagnostic differences in their genitalia: “y dado la variabilidad individual observada en ambas especies, podemos afirmar que tales estructuras son iguales.” (Orellana [2010]). Equally, we found strong genetic similarities between A. rogeri and A. ponina: the holotype of A. rogeri (in MIZA) is sister to the two specimens of A. ponina and is closer to them that any other pair of species in the trees (Fig. 1). Their COI barcodes differ by only 0.5% (3 bp). The major difference between A. rogeri and A. ponina is in their wing patterns: A. rogeri is unexpectedly more similar to A. pionia (e.g., both have whitish fringes) than to A. ponina (distinctly orange fringes), as detailed in the original description (Orellana [2010]). Therefore, due to the lack of genitalic and genetic differences at the level characteristic for species-level, we propose to treat A. rogeri as a subspecies: Amenis ponina rogeri Orellana, [2010], stat. nov. However, we sequenced only one A. p. rogeri specimen (the holotype), and we have not yet studied Amenis pionia sandra Orellana, [2010]. Hence, additional work on these taxa may bring further insights. The COI barcode sequence of the holotype of A. p. rogeri, sample NVG-22029C08, GenBank accession OR178491, 658 base pairs is:
AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAATTGGAACATCTTTAAGACTATTAATCCGAACTGAATTAGGAACTCCAGGATCTTTAATTGGA GACGATCAAATTTATAATACTATTGTAACAGCTCATGCATTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTAG TCCCTCTTATATTAGGAGCCCCTGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGATTATTACCCCCTTCATTAATTCTACTTATTTCTAGCAG TATTGTAGAAAATGGTGCTGGAACTGGATGAACTGTTTACCCTCCTCTTTCTTCTAATATTGCTCATCAAGGAGCTTCTGTAGATTTAGCTATTTTTTCC CTACATTTAGCTGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATCATTAATATACGAATTAAAAATTTATCTTTTGACCAAATACCTT TATTTGTATGAGCTGTTGGTATTACAGCATTATTATTACTTTTATCTTTACCTGTTTTAGCAGGAGCTATTACAATATTATTAACAGACCGAAATATTAA TACTTCTTTTTTTGATCCTGCAGGAGGAGGAGATCCTATTTTATACCAACATCTATTT
Notes
Files
Files
(2.7 kB)
| Name | Size | Download all |
|---|---|---|
|
md5:060babca4ad4597b52fd0654e1f3e0bc
|
2.7 kB | Download |
System files
(22.4 kB)
| Name | Size | Download all |
|---|---|---|
|
md5:f5317cb9f860a52b9276b4e02dbb5ad0
|
22.4 kB | Download |
Linked records
Additional details
Identifiers
Biodiversity
- Family
- Hesperiidae
- Genus
- Amenis
- Kingdom
- Animalia
- Order
- Lepidoptera
- Phylum
- Arthropoda
- Scientific name authorship
- Orellana
- Species
- rogeri
- Taxonomic status
- stat. nov.
- Taxon rank
- subSpecies
- Taxonomic concept label
- Amenis ponina subsp. rogeri (Orellana, 2010) sec. Zhang, Cong, Shen, Song, Orellana, Brockmann, Mielke, Mielke, Costa & Grishin, 2023
References
- Orellana, A. M. ([2010]) Pyrrhopyginae de Venezuela (Lepidoptera: Hesperioidea: Hesperiidae). Entomotropica, 23, 177 - 291.