Coded serum samples from 442 HCV G1-infected patients were used in the study. These included 240 samples previously tested by first-generation line probe assay (Inno-LiPA v1.0) obtained from the hospital Liver Unit HCV serum bank, which were used to develop the technique, and 202 plasma samples from patients with HCV subtype 1a and 1b infection attending our hospital outpatient clinic, used to validate the method. The prevalence of the Q80K polymorphism in our setting was determined in both groups of samples studied.

HCV RNA was extracted from 650 μL of serum by automatic RNA extraction using a total nucleic acid isolation (TNAI) kit (AmpliPrep system; Roche Diagnostics, West Sussex, United Kingdom) or from 140 μL of serum by manual extraction using the QIAamp viral RNA minikit (Qiagen, Hilden, Germany). The measures to prevent contamination suggested by Kwok and Higuchi were strictly applied[12].

The first step in detection of the Q80K polymorphism was to obtain cDNA from the extracted HCV RNA. The NS3 target for Q80K detection was a 611-nucleotide (nt)-long region spanning nt 3426 to 4036, in accordance with the H77 reference sequence (GenBank NC_004102.1). NS3 target cDNA was obtained using degenerate primers: forward, N3u1bR3426 5’-ATCACGGCYTACKCYCAACARAC-3’ and reverse, N3d1bR4036 5’-GTRGGDGCGTGHARRTGKGCCAC-3’. These primers were able to amplify both HCV subtypes 1a and 1b.

The RT-PCR was performed using the Transcriptor One-Step RT-PCR kit (Roche Applied Science, Basel, Switzerland). The reaction was carried out in a final volume of 25 μL containing 5 μL of 5 × reaction buffer, 1.25 μL of 5% DMSO, 0.6 μmol/L of each primer, (0.75 μL of the two 20-μmol/L forward and reverse primers), 0.5 μL of Transcriptor One-Step enzyme mix, and 5 μL of extracted HCV RNA. The RT-PCR program was run as follows: one cycle at 55 °C for 30 min (reverse transcription) and one cycle at 94 °C for 7 min (reverse enzyme inactivation step), followed by 35 cycles each of 10 s at 94 °C, 30 s at 51 °C and 40 s at 68 °C, followed by 1 final extension cycle at 68 °C for 7 min (amplification), subsequently maintained at 4 °C. A final product of 611 nucleotides was obtained.

A negative control was included in each PCR step to ensure that no contamination had occurred. All the PCR mixes were performed in a DNA-free room and within the laboratory cabin. After each manipulation, the bench surface and cabin were both cleaned with 70% ethanol.

The main problem involved in using specific probes to detect HCV single point mutations is the high variability of the virus. Hence, the aim of the procedure developed was to homogenize the regions flanking Q80K and thereby eliminate the existing variability. This was accomplished by designing two specific long primers [named homogenize the flanking regions (HOMO)-PCR primers] that covered the entire region of interest, except for the single nucleotide base at position 80 causing the C/A polymorphism, which was left uncovered between the primers Thus, the PCR obtained identical sequences throughout except for the nucleotide causing the Q80K mutation (polymorphic nucleotide). The following primers were used for HOMO-PCR: forward primer (5’-GTTGTAAAACGACGGCCAGTCCAAGGGTCCTGTCATCCAGATGTATACCAATGTGGAC-3’) and reverse primer (5’-CACAGGAAACAGCTATGACCCGGGAACCTTGAGGAGCGGGCCAGCCCACAAGGTCTT). The two primers contained a complementary universal M13 primer, which was needed for the next step. A final product of 116 nucleotides was obtained.

Briefly, the PCR reaction mixture consisted of 5 μL of cDNA sample, 2.5 μL of 10 × FastStart reaction buffer, 1.25 μL of 5% DMSO, 0.5 μL of each 0.4-mmol/L dNTP, 1 μL of the two 10-μmmol/L (upstream and downstream) primers, and 0.25 U of FastStart high-fidelity enzyme blend (5 U/μL) (Roche Diagnostics, Mannheim, Germany) in a final volume of 25 μL. After denaturing for 2 min at 95 °C, 35 cycles of 30 s at 95 °C, 30 s at 50 °C, and 10 s at 72 °C were performed, with a final 4-min step at 72 °C, subsequently maintained at 4 °C. The amplification products were analyzed by 2% agarose gel electrophoresis, and negative controls (amplifications in the absence of RNA) were included in parallel to ensure the absence of contamination. All amplicons were purified in agarose gel, using the QIAquick gel extraction kit (Qiagen, Valencia, CA, United States).

Real-time PCR was performed in the LightCycler 2.0 analyzer (Roche Diagnostic, Mannheim, Germany). This thermal cycler detects mutations by analyzing the melting point of one of the two adjacent fluorescent-labeled probes. A schematic representation of the oligonucleotide primers, fluorescence resonance energy transfer (FRET) probes, and sequences used to detect the Q80K variation is shown in Figure 1. To enable sequencing of the fragment of interest, the two HOMO PCR primers (forward and reverse), used to homogenize the regions flanking position 80 were designed with the universal M13 sequencing primer at the 5´end: M13 forward (5’-GTTGTAAAACGACGGCCAGT-3’) and M13 reverse (5’-CACAGGAAACAGCTATGACC-3’). Two FRET probes that hybridize closely together were used to detect the mutation: Anchor (5’-GTCCTGTCATCCAGATGTATAC--FL) spanning nt 3625 to 3646 and labeled with fluorescein at the 3’ end, and Sensor Mut (5’-LC640-ATGTGGACAAAGACCTTGT-PH) spanning nt 3649 to 3666 and labeled with red fluorophore LC640 at the 5’ end. This last probe hybridizes over the mutation position and perfectly matches the mutated sequence while showing a single mismatch with the wild-type variant.

Open in New Tab   Full Size Figure   Download Figure

Figure 1 Diagram of the Q80K testing protocol. RT-PCR was performed to obtain cDNA from the NS3 target containing the Q80K polymorphism, followed by HOMO-PCR performed to homogenize the Q80K flanking region using specific long primers. This PCR prepared the Q80K flanking region for the next step, in which specific probes are used to detect Q80K. The last step is a real-time PCR, in which the Q80K mutation was detected by analyzing the melting point of one of the two adjacent fluorescent-labeled probes. The specific and universal primers used are specified in each amplification step.

The reaction was conducted at a final volume of 20 μL containing 1.6 mmol/L MgCl₂, 0.4 μmol/L of each primer, 0.16 μmol/L of each FRET probe, 2 μL of LightCycler Fast Start DNA master hybridization probe mix (Roche Diagnostics, Mannheim, Germany) and 5 μL of purified HOMO-PCR product. The PCR program was run as follows: an initial denaturation step of 95 °C for 10 min, 15 cycles of denaturation at 95 °C for 10 s, annealing at 43 °C for 10 s, and extension at 72 °C for 15 s. After amplification, melting curves were generated by denaturation at 95 °C for 20 s, maintaining the sample at 40 °C for 20 s and slowly heating the sample at 85 °C. Fluorescent measurements were recorded during each annealing step and during heating in the melting step, with measurements at a wavelength of 640 nm once the run was completed. To analyze the results, the melting curves were converted to melting peaks by LightCycler software, thus enabling the normal and mutated form to be easily differentiated by their characteristic peak patterns based on the differing melting temperatures.

All samples tested using the PCR method developed here underwent Sanger sequencing to verify the reliability of the new method. The PCR product was directly sequenced using the BigDye Terminator v3.1 cycle sequencing kit (Applied Biosystems, Foster City, CA, United States). All sequenced samples were aligned using the BioEdit software and checked for concordance.

To evaluate the sensitivity of the new technique for detecting Q80K variants from HCV G1 samples, one sample containing each variant (Q and K) was selected to provide pure copies of the HCV strands carrying the two variants by molecular cloning.

The nested amplicon with the Q80K polymorphism was 531 nt long and contained a 491-nt-long region (nt 3492 to 3982), in accordance with the H77 reference sequence (GenBank NC_004102.1), as well as the M13 universal primers. The following PCR primers were used: upstream, 13u31b3492 5’- GTTGTAAAACGACGGCCAGTGACARRAACCARGTBGADGGDGA -3’ and downstream, 13d31b3982 5’-CACAGGAAACAGCTATGACCGARTTRTCYGTGAARACCGGRGACC-3’.

The nested reaction mixture contained 5 μL 10 × PfuUltra II reaction buffer, 1.25 μL of each 10mmol/L dNTP, 0.5 μL of each 10-mmol/L forward and reverse primers and 1 μL of PfuUltra II Fusion HS DNA polymerase in a final volume of 50 μL. After denaturing for 2 min at 95 °C, 30 cycles of 20 s at 95 °C, 20 s at 50 °C, and 15 s at 72 °C were performed, with a final 3-min step at 72 °C, subsequently maintained at 4 °C.

Molecular cloning of the two variants (Q and K) was performed using the Zero Blunt Topo PCR cloning kit for sequencing. After treating the colonies with a restriction enzyme and purifying with the Miniprep kit (QIAprep Spin Miniprep Kit), 12 clones of each variant were obtained and identified by direct Sanger sequencing.

To prepare the samples for the next step, 1 sample of each cloned variant (Q and K) was selected and subjected to HOMO-PCR with the following conditions: 1 denaturation cycle for 2 min at 95 °C, 35 cycles of 30 s at 95 °C, 30 s at 50 °C, and 10 s at 72 °C, and a final 4-min step at 72 °C, subsequently maintained at 4 °C.

The 2 amplification products (Q and K) were analyzed by 2% agarose gel electrophoresis including a negative control (amplifications in the absence of RNA) to ensure an absence of contamination. The amplicons were purified using the QIAquick gel extraction kit (Qiagen, Valencia, CA, United States). The purified PCR product was quantified using the PicoGreen assay (Invitrogen, Carlsbad, CA, United States).

Of note, proper serum sample storage and RNA manipulation are essential to succeed in Q80K evaluation. A viral load below 10⁴ copies/mL is an important limitation for this and any other method based on PCR amplification. The protocol presented was designed and validated for Q80K detection because of the high reported prevalence of this mutation, but our aim was to create a procedure that can be adapted for screening resistance mutations occurring in other regions of the HCV genome.

Detection of resistance-associated amino acid substitutions in patients with hepatitis C virus (HCV) infection is clinically relevant information for personalizing therapy. Low-cost, highly sensitive techniques enabling routine detection of any single point mutation would be useful to identify patients at a risk of treatment failure.

Diagnose techniques to detect single point mutations in HCV have been hampered by the huge amount of variation generated by HCV.

A fast, low-cost diagnostic strategy based on real-time PCR and fluorescence resonance energy transfer (FRET) robe melting curve analysis (LightCycler method) has been successfully developed to identify single point mutations in highly variable genomes, in this case for HCV.

This technique can be adapted to detect any single point mutation in highly variable genomes.

With sufficient details presented so that others could repeat and validate this work easily. The logic of what the authors present is well laid out and the figures add to the manuscript. It will likely be used by a limited number of people as SIM pegIFN and Ribavirin are used less frequently than the current second generation direct-acting antivirals (DAAs). However, the authors do make clear that they are doing this for the NS5A mutations, which are much more relevant to the 2^nd generation DAAs.