Next Article in Journal
First Record of Phlebotomus (Larroussius) perfiliewi (Diptera: Psychodidae), Vector of Leishmania infantum and Phleboviruses, in Spain
Previous Article in Journal
Distribution of the Riparian Salix Communities in and around Romanian Carpathians
Previous Article in Special Issue
Climate Cycles, Habitat Stability, and Lineage Diversification in an African Biodiversity Hotspot
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Diversity
Volume 15
Issue 3
10.3390/d15030398
diversity-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Phylogeny of Serpulidae (Annelida, Polychaeta) Inferred from Morphology and DNA Sequences, with a New Classification

by
Elena Kupriyanova
1,2,*,
Harry A. ten Hove
3 and
Greg W. Rouse
4,5
1
Australian Museum Research Institute, Australian Museum, 1 William Street, Sydney, NSW 2010, Australia
2
Department of Biological Sciences, Macquarie University, North Ryde, NSW 2109, Australia
3
Naturalis Biodiversity Centre, P.O. Box 5917, 2300 RA Leiden, The Netherlands
4
South Australian Museum, North Terrace, Adelaide, SA 5000, Australia
5
Scripps Institution of Oceanography, University of California San Diego, La Jolla, CA 92093-0202, USA
*
Author to whom correspondence should be addressed.
Diversity 2023, 15(3), 398; https://doi.org/10.3390/d15030398
Submission received: 30 December 2022 / Revised: 14 February 2023 / Accepted: 14 February 2023 / Published: 10 March 2023
(This article belongs to the Special Issue Diversity in 2022)
Browse Figures
Review Reports Versions Notes

Abstract

:
Serpulidae Rafinesque, 1815 is a speciose group of polychaetes that all inhabit calcareous tubes. The family was traditionally subdivided into Serpulinae, Filograninae, and Spirorbinae. Recent phylogenetic analyses have suggested that both Filograninae and Serpulinae are paraphyletic, though with limited sampling. Here we report the first phylogenetic analysis of Serpulidae based on comprehensive sampling of genera (though excluding most spirorbin genera). We include a much-needed revision of serpulid taxonomy based on a phylogenetic hypothesis derived from both morphological and molecular data. We analysed 18S, 28S, histone H3 ribosomal nuclear DNA and cytochrome b (cytb) mitochondrial sequences, combined with morphological data. The proposed new classification includes the re-formulated Serpulinae (with tribes Serpulini and Ficopomatini), Spirorbinae, and Filograninae, with apomorphies highlighted for major taxa.

1. Introduction

Serpulidae Rafinesque, 1815 is a clade of polychaetes permanently living in calcareous tubes. Recent reviews have assessed Serpulidae as having 506–576 accepted species [1]. A comprehensive review of Sabellida by Capa et al. [2] lists 69 genera of Serpulidae, which includes 48 genera with 374 extant species of Serpulinae sensu lato and 23 genera with 188 extant species of Spirorbinae. Over half of the nominal serpulin species belong to four genera: Hydroides (105), Spirobranchus (42), Serpula (26), and Spiraserpula (18). Twenty genera are monotypic, some of them being rare and/or found in the deep sea only (e.g., Bathyditrupa, Chitinopomoides, Microprotula, Vitreotubus, Zibrovermilia), known only from type material (Tanturia) or, at the extreme, known only from a poorly preserved holotype (Paumotella). The recent revisionary studies within Serpulidae include morphology-based studies of Pseudochitinopoma by Kupriyanova et al. [3] and Spirodiscus by Kupriyanova and Ippolitov [4] as well as integrative phylogenetic studies of Hydroides by Sun et al. [5] and Laminatubus by Rouse and Kupriyanova [6]. There are also several other relevant sources on the biodiversity and taxonomy of Serpulidae [7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25].
Serpulidae is placed within the large annelid clade Sabellida that was initially named by Dales [26] for just Sabellidae and Serpulidae. Sabellida became commonly used in major taxonomic works and though the composition of the group has varied (e.g., Fauchald [27], Pettibone [28], Rouse et al. [1]), Serpulidae and Sabellidae have always been maintained as part of this taxon though views on the membership and relationships within have otherwise varied. Smith [29] argued that Sabellidae was paraphyletic with Serpulidae, being the sister group to Sabellinae. This arrangement was also found by Rousset et al. [30], though with limited taxon sampling. Subsequently, further sampling using nuclear and mitochondrial DNA data also showed sabellid paraphyly and a sister-group relationship between Serpulidae and Fabriciinae (Kupriyanova and Rouse [31]). As a result, Fabriciinae was raised to the family rank, Fabriciidae. Most recently, Tilic et al. [32] found Serpulidae to be closer to Sabellidae than to Fabriciidae, based on phylogenomic data.
Earlier hypotheses about relationships within Serpulidae are reviewed in Kupriyanova et al. [33]. Briefly, Serpulidae was initially divided into the subfamilies Serpulinae Rafinesque, 1815 [34] and Spirorbinae Chamberlin, 1919 [35] until Rioja [36] established the subfamily Filograninae in 1923 and later Ficopomatinae was established by Pillai [37] in 1960. The most drastic proposed revision of Serpulidae by Uchida [38] proposed the creation of 11 subfamilies and numerous new genera based on small (partly presumed) differences in chaetal structure. The phylogenetic trees of Uchida [38] were not based on formal datasets with repeatable analyses and, as a result, his classification has hardly been used by other authors.
Spirorbinae was elevated to Spirorbidae by Pillai [39] in 1970. However, Fitzhugh [40] and then Smith [29] suggested that Spirorbidae were more closely related to Serpulinae than to Filograninae and concluded that maintaining the family Spirorbidae was not justified. An analysis of relationships among spirorbin genera by Macdonald [41] also showed that Spirorbinae were more closely related to Serpulinae than to Filograninae. All analyses of molecular data have demonstrated that Spirorbinae should be treated as a sub-taxon of Serpulidae (Kupriyanova et al. [33]; Lehrke et al. [42]; Kupriyanova and Rouse [31]; Kupriyanova et al. [43]; Kupriyanova and Nishi [44]), which was adopted by Rzhavsky et al. [45].
Ficopomatinae was proposed [37,46] with the diagnosis: “stout teeth in collar chaetae, wingless opercular peduncle, vesicular opercula and geniculate abdominal chaetae”. The subfamily was revised by ten Hove and Weerdenburg [47] in 1978 and, as a result, four brackish-water monotypic genera were placed into Ficopomatus. More recently, Ficopomatus talehsapensis Pillai, 2008 [48] and Ficopomatus shenzhensis Li et al., 2012 [49] were added to the genus, while Styan et al. [50] demonstrated that Ficopomatus enigmaticus (Fauvel, 1923) [51] in Australia (supposedly its native range) consists of three genetic groups with overlapping ranges, one of which is morphologically distinct from the other two. Marifugia cavatica Absolon and Hrabĕ, 1930 [52], the only freshwater serpulid, has been shown to be a part of a monophyletic Ficopomatus-Marifugia clade [43,48], which is treated as Ficopomatinae by some authors [48,49,53].
Both Filograninae and Serpulinae have been problematic from the phylogenetic point of view. When Filograninae was proposed by Rioja [36], he stated that “presence of pinnules on the opercular peduncle …. indicates that the species included in this subfamily are very primitive, …, corroborated by a hardly developed operculum”. Rioja included Filograna and Salmacina that have fin-and-blade special collar chaetae, as well as Apomatus and Protula with simple collar chaetae. He also tentatively included Josephella marenzelleri Caullery and Mesnil, 1896 [54] in Filograninae. Rioja also included Spirodiscus grimaldii (Fauvel, 1909) [55] in the subfamily because of the pinnulated opercular peduncle, even though this species has a well-developed chitinized operculum. Finally, Rioja [36] also mentioned Protis as a possible member of the group, with collar chaetae like those of Filograna and Salmacina and without an operculum. In her catalogue, Hartman [56] classified Apomatus, Protula, and Spirodiscus as Serpulinae. Fauchald [27] included Filogranula, Filograna, Salmacina, Salmacinopsis, and Spirodiscus in Filograninae, but listed Apomatus, Protis, and Protula as Serpulinae. Neither Hartman [56] nor Fauchald [27] gave any reasoning behind such arrangements. ten Hove [57] was the first to suggest that Filograninae may be paraphyletic and a morphology-based cladistic morphological analysis by Kupriyanova [58] also recovered Filograninae as a grade.
Later molecular phylogenetic studies showed Filograninae to potentially be polyphyletic (Kupriyanova et al. [33]) or at least paraphyletic (Lehrke et al. [42]). Kupriyanova et al. [33] assessed phylogenetic relationships within Serpulidae using both molecular and morphological characters while Lehrke et al. [42] conducted a similar analysis using 18S ribosomal DNA data and fewer terminals. Both studies found Serpulinae to be paraphyletic. Kupriyanova et al. [33] refrained from revising serpulid classification but suggested that Serpulidae needed further comprehensive phylogenetic analyses.
Here the phylogenetic relationships within Serpulidae are revisited. We added available and newly obtained molecular sequence data to create a total evidence phylogeny of serpulids based on combined molecular and morphological datasets.

2. Materials and Methods

2.1. Taxa Used in This Study and Morphological Matrix

This study is based on all genera currently included in Serpulidae according to Capa et al. [2] but excluding most Spirorbinae. At least one representative from each genus was used in the analysis. The selection of taxa was based on the availability of fresh material for combined analyses of morphological and molecular data. The type species of a genus could not always be used to score the characters, as material was not available and/or the original description was inadequate. In total, molecular data were available for 93 ingroup terminals from 35 genera (Table 1). Phylogenetic positions of poorly known genera Bathyditrupa, Chitinopomoides, Microprotula, Neomicrorbis, Omphalopomopsis, Paumotella, Spirodiscus, Tanturia, Vitreotubus, and Zibrovermilia were inferred from morphological data only. Both previously published and new sequences were used. Whether the currently accepted as valid serpulid genera are monophyletic remains unknown, even questionable (e.g., ten Hove and Kupriyanova [59]: 66, 71, 83, 102 on Neovermilia, Paraprotis, Protula, and Vermiliopsis, respectively, Kupriyanova and Rouse [31]) and the monophyly of each non-monotypic genus with only a single representative included here needs to be assessed in more restricted analyses.
The genera not included in the analysis are Membranopsis, synonymised with Protula by ten Hove and Kupriyanova [59], Pomatoleios and Pomatoceros synonymized with Spirobranchus by Pillai [15], as well as monotypic genera Kimberleya and Pseudoprotula that have not been formally synonymised yet, but in our opinion most likely should be attributed to Protula. Given that the monophyly of Spirorbinae is undisputed, its position within Serpulidae has been determined in previous studies [33,42,58] and phylogenetic relationships among Spirorbinae have been assessed [41,60], only four spirorbins were included in this study.
The morphology of Serpulidae sensu lato was reviewed and illustrated by ten Hove and Kupriyanova [59] with special reference to the features that can provide characters for a phylogenetic analysis. The morphology of all species used in the analysis was examined by us and details of the structure of their chaetae and uncini were elucidated with the help of SEM. For complex features where the whole feature (such as the operculum) could be absent, absence–presence was treated as a separate character, whereas different states of the compound character were coded as subsidiary characters. Terminals coded as absent for the more general characters were coded as ‘inapplicable’ with a “-” [61] for the subsidiary characters, which is treated as ? by PAUP * version 40b10 [62]. Unknown character states were coded with a “?”. The characters for the morphological matrix are listed in Appendix A, the description of characters is available in Supplementary File S1, morphological matrix in nexus format as Supplementary File S2, and combined matrix of morphological and molecular data in nexus format as Supplementary File S3.

2.2. DNA Extraction, Amplification, and Sequencing

Specimens for molecular work were preserved in ethanol and stored at −20 °C. Voucher specimens were preserved in 10% formalin and transferred to 70% ethanol after rinsing in water. The vouchers were deposited in South Australian Museum (SAM), Naturalis Biodiversity Centre (including the former Zoological Museum of University of Amsterdam, ZMA), and Australian Museum (AM), unless indicated otherwise (see Table 1).
Molecular work was conducted at the University of Adelaide Evolutionary Biology Unit (EBU), molecular laboratory of Japanese Agency for Marine Science and Technology, Yukosuka, Japan (JAMSTEC), and Australian Center for Wildlife Genomics at the Australian Museum (ACWG AM).
Total DNA was extracted using Qiagen DNeasy Kit or using a Bioline Isolate II genomic DNA kit following the manufacturer’s protocols. Stock DNA was diluted 1:10 or 1:100 with deionized water to produce optimal template strength DNA for Polymerase Chain Reactions (PCR).
Partial or near complete 18S rRNA gene (18S) sequences were amplified in two overlapping fragments, one of approximately 1100 bp with the primers TimA (AMCTGGTTGATCCTGCCA G) and 1100R2 (CGGTATCTGATCGTCTTCGA) [63]; the other of approximately 1300 bp using 18s2F (GTTGCT GCAGTTAAA) and 18s2R (ACCTTGTTAGCTGTTTTACTTCCTC) [33]. An approximately 900 bp fragment of 28S rRNA gene (28S) was amplified using primers LSUD1F (ACCCGCTGAATTTAAGCATA) and D3ar (ACGAACGATTTGCACGTCAG) [64]. In some cases, a shorter D1 fragment (approximately 350 bp) was amplified using primers ACCCSCTGAAYTTAAGCAT and AACTCTCTCMTTCARAGTTC [65]. A part of the mitochondrial Cytochrome b (Cytb) gene (approximately 350 bp) was amplified with the primer pair Cytb424F (GGWTAYGTWYTWCCWTGRGGWCARAT) and cobr825 (AARTAYCAYTCYGGYTTRATRTG) [66]. An approximately 350 bp fragment of Histone H3 (H3) gene was amplified with the primers (1) ATGGCTCGTACCAAGCAGACVGC and ATATCCTTRGGC ATRATRGTGAC or (2) ATGGCTCGTACCAAGCAGAC and ATRTCCTTGGGCATGATTGTTAC [65].
The PCR products were separated by gel electrophoresis in 1.5% agarose gel and visualized under UV after staining with ethidium bromide or staining with gel red (Biotium TM, San Francisco, CA, USA).
At AM, successful PCR products were sent to Macrogen TM, South Korea for purification and standard Sanger sequencing. The successful PCR products were purified with UltraClean PCR Clean-up DNA purification kit by MoBio Laboratories following the manufacturer’s protocol (EBU) or with Gel and PCR Clean-up DNA purification kit (Promega) following the manufacturer’s protocol (JAMSTEC). At EBU and JAMSTEC, PCR products were sequenced in both directions using Big Dye Ver. 3 chemistry with the same primers as in PCR.
At EBU, sequenced products were purified using the magnetic method with CleanSeq kit by Agencourt Biosciences Corporation, whereas the Performa® DTR Gel Filtration Cartridge kit (EdgeBio) was used at JAMSTEC. Products of the sequencing reactions were read on an automated capillary sequencer ABI 3130 Genetic Analyzer (Applied Biosystems) at the Institute of Medical and Veterinary Sciences (IMVS) in Adelaide or at JAMSTEC molecular laboratory.
Sequences were edited using SeqEd ver. 1.0.3 (Applied Biosystems Inc.) or Geneious. BLAST searches [67] confirmed the correct gene regions had been amplified and the new sequences were submitted to GenBank (Table 1).

2.3. Phylogenetic Analyses

Analyses were performed on three datasets: Molecular data only, Morphology data only, and a combined Morphology and Molecular dataset. Morphology was coded for representatives of all available genera, but molecular data was not available for Bathyditrupa, Chitinopomoides, Omphalopomopsis, Microprotula, Neomicrorbis, Paumotella, Spirodiscus, Vitreotubus, Tanturia, and Zibrovermilia. Manayunkia athalassia (Fabriciidae) and Schizobranchia insignis (Sabellidae) were chosen as the most appropriate outgroups based on previous phylogenomic results [32].

2.3.1. Morphology Only Dataset

The 75-character morphology dataset was analysed using PAUP* v.4.0a166 [62]. Characters were initially treated as unordered. Owing to their being 93 terminals and many ‘inapplicable’ character scores, the dataset could not be run with simple parameters to explore tree space properly. Therefore, a parsimony ratchet approach [68] was used with PRAP v. 2.0 [69] in association with PAUP*. Ten runs with 200 ratchet iterations were performed and the resulting shortest trees, after filtering for duplicates, were then used for further searching with the command “hsearch start = current swap = TBR steepest = no multrees = yes” to find all the shortest trees. A strict consensus tree was generated from the resulting trees.

2.3.2. Molecular Dataset

The gene partitions were aligned using Muscle (H3, CytB) [70] or MAFFT (18S, 28S) [71] and concatenated using Sequence Matrix [72]) or RAxML-NG [73,74], resulting in an alignment of 4483 base pairs. This data set was partitioned by gene and appropriate models selected by ModelTest-NG [75] under the Bayesian information criterion (BIC) before maximum likelihood (ML) analysis with RaxML-NG. Models used were GTR + I + Γ (18S, 28S, Cytb) or TIM2 + I + Γ (Histone H3). Fifty random addition searches were performed as well as node support assessment via ‘thorough’ bootstrapping (with 1000 pseudoreplicates). Bayesian inference (BI) analysis of the concatenated data, partitioned by gene, was conducted using Mr. Bayes v.3.2.7a [76]. All partitions were run using GTR + I + Γ. Default priors in MrBayes were used and data partitions were unlinked for parameter estimations. Two iterations of four Markov chain Monte Carlo (MCMC) chains were run for 50 million generations, sampling every thousand generations. A majority rule consensus tree was made from the trees remaining after discarding 25% of trees as burn-in, after checking with Tracer 1.7.1 [77].

2.3.3. Molecular + Morphology Dataset

The molecular dataset was treated the same as in the molecular-only analyses above. These partitions were concatenated with the morphology dataset. In RaXML-NG, the morphology partition was run with the MULTIx MK model (with x as 6 for the maximum six-character states), while in MrBayes, the morphology dataset was analysed under the Mkv model. Both these models are derived from Lewis’ [78] likelihood model for discrete morphology data. Several morphological characters were traced on the BI tree topology from the molecular + morphology dataset in Mesquite [79] using likelihood ancestral state reconstruction, with the Mk1 probability model.

3. Results

3.1. Morphology Only Dataset

The parsimony ratchet analysis and subsequent heuristic search of the morphology data matrix resulted in 1,192,317 shortest trees of 352 steps. Seventy of the seventy-five characters used were parsimony informative. The consistency index was 0.27 and the retention index 0.78. The strict consensus of these trees resulted in a major polytomy (Figure 1). The only partially resolved larger clades included Apomatus-Protula, Crucigera-Serpula-Hydroides-Floriprotis, Galeolaria-Pyrgopolon-Spirobranchus, Ditrupa-Ficopomatus-Hyalopomatus-Placostegus-Marifugia, and Spirodiscus-Bathyditrupa. Spirorbin taxa were recovered as a clade with Helicosiphon as sister group to Spirorbis-(Protolaeospira-Romanchella). Apart from Spirorbinae, no major clades were recovered and the relationships within Serpulidae were largely unresolved. Genera with multiple terminals such as Apomatus, Protula, Crucigera, Ficopomatus, Galeolaria, Pomatostegus, and Semivermilia were recovered as clades. Notably other important genera such as Hydroides, Protis, Serpula, Spirobranchus, and Vermiliopsis were not recovered as monophyletic.

3.2. Molecular Only Dataset

The ML and BI analyses of the molecular-only data set resulted in identical tree topologies (Figure 2). The analyses inferred three well-supported major clades within Serpulidae. One included those taxa typically attributed to the subfamily Serpulinae and was further split into two well-supported sister clades. One included a monophyletic well-supported Hydroides clade along with representatives Serpula, Crucigera, Spiraserpula, and Floriprotis. We refer to this as Serpulini. The other major serpulin clade is referred to here as Ficopomatini. Notably, Neovermilia globula was the sister group to all other Ficopomatini, which had a relatively long branch and formed a highly supported clade. Within Ficopomatini, Spirobranchus formed a well-supported clade that was the sister group to Pyrgopolon. Laminatubus alvini was recovered as sister to the Spirobranchus–Pyrgopolon clade and similarly Ditrupa was sister to a Pseudochitinopoma clade, both with high support. Other highly supported groups include monophyletic Placostegus and Galeolaria clades. Marifugia cavatica was nested within Ficopomatus forming a well-supported clade that was sister to Galeolaria, though with low support. The phylogenetic positions of Hyalopomatus mironovi and relationships among the Placostegus and Pseudochitinopoma-Ditrupa clades can be regarded as relatively uncertain owing to low support.
The second well-supported major clade included many terminals that had been attributed to Filograninae (Apomatus, Filograna, Filogranula, Josephella, Protis, Protula, Rhodopsis, Salmacina), as well as several traditionally attributed to Serpulinae (Bathyvermilia, Chitinopoma, Dasynema, Metavermilia, Pomatostegus, Pseudovermilia, Semivermilia, Vermiliopsis) and others not explicitly attributed to a subfamily before (Janita, Filogranella, Neovermilia, Turbocavus, and Paraprotis). We apply the name Filograninae to this clade. Together, this assemblage constituted the sister group to a highly supported Spirorbinae clade, which included Spirorbis as the sister group to a Romanchella-Protolaeospira-Helicosiphon clade. Other minor clades with good support were: Pomatostegus, Chitinopoma-Filogranula, Protula, Apomatus, Filograna-Salmacina, Vermiliopsis, Dasynema-Vermiliopsis, and Filogranella-Dasynema-Vermiliopsis. The Filograna-Salmacina clade was nested within Protis, forming a well-supported clade. Semivermilia and Pseudovermilia were not recovered as monophyletic, but instead formed a well-supported mixed clade along with Rhodopsis. The two Paraprotis terminals did not form a clade and the three Apomatus terminals appeared in two places within Filograninae. The positions of Josephella, Bathyvermilia, Janita, and Metavermilia within Filograninae were poorly supported.

3.3. Molecular + Morphology Dataset

The BI and ML analyses of the combined morphological and molecular data set resulted in slightly different topologies, with the BI result shown here and congruent nodes for the ML analysis are indicated (Figure 3). Overall support values were markedly lower than seen in the molecular-only analyses but allowing for the additional taxa, the relationships were nearly identical to those shown in Figure 2. Most terminals for which DNA sequence data were not available (Bathyditrupa, Chitinopomoides, Microprotula, Neomicrorbis, Omphalopomopsis, Paumotella, Spirodiscus, Tanturia, Vitreotubus, and Zibrovermilia) were recovered within Filograninae and in this clade some differences between the ML and BI analyses were observed. Notably, while the BI placed Omphalopomopsis as sister to all other Filograninae terminals except for Pomatostegus (Figure 3), in the ML result (not shown) Omphalopomopsis was recovered as sister to the Filograninae + Spirorbinae clade. Furthermore, in the ML analysis Chitinopomoides was recovered outside the clade containing Rhodopsis, Semivermilia-Pseudovermilia, and (Bathyditrupa-Spirodiscus) Zibrovermilia clade, while in the BI analysis Chitinopomoides formed sister to the (Semivermilia-Pseudovermilia)-Rhodopsis clade, but support for both placements was low. The deep-sea (abyssal) terminals Spirodiscus and Bathyditrupa formed a highly supported clade and were recovered with low support as sister to bathyal Zibrovermilia. Paumotella was recovered as sister taxon to Dasynema with this clade being the sister group to Vermiliopsis. Tanturia was found in a poorly supported clade with Josephella. Microprotula and Turbocavus formed a clade and were the sister group to Protula. A questionable spirorbin Neomicrorbis was recovered within Spirorbinae as the sister taxon to Helicosiphon with low support. Within Serpulinae, the topology was the same as in the molecular-only analyses with the difference being the placement of Vitreotubus (morphology only data) recovered in a clade with Laminatubus with a reasonable support.

3.4. Transformations

Monophyly of Serpulidae was unequivocally supported by synapomorphies such as the presence of a calcareous tube (char 8), the presence of the operculum (char 22, Figure 4), though with subsequent reversals (see below), and the presence of the thoracic membranes (char 53, Figure 5A).
Serpulinae was not supported by any morphological apomorphies. Filograninae-Spirorbinae was supported by the presence of Apomatus chaetae (char 56, Figure 5A). Filograninae was supported by the presence of abdominal flat geniculate chaetae (char 75). Body asymmetry due to tube coiling (char 16) appeared in Spirorbinae and in Spiraserpula. Spirorbinae was also characterised by incomplete chaetal inversion (char 2), distinguished from a more synapomorphy for Sabellida which is characterised by complete chaetal inversion. Serpulini was supported by several apomorphies such as Serpula-type operculum (char 32), bayonet collar chaetae (char 52), the presence of pseudoperculum (char 23), and abdominal flat trumpet shaped chaetae (char 70, Figure 5B). Within Serpulini, the presence of opercular verticil (a crown of chitinous spines, char 33) was an apomorphy for Hydroides. The presence of abdominal true trumpet chaetae (char 71, Figure 5C) was an apomorphy for Ficopomatini, while Ficopomatus was supported by distinct collar chaetae with stout teeth (char 50, Ficopomatus-type chaetae). Other apomorphies with ficopomatin groups were collar tonguelets (char 48) found in Placostegus and Spirobranchus-Pyrgopolon and peduncular wings (char 41) of Spirobranchus.
Transformations for the 75 morphological characters can be traced on the BI topology of the combined morphological and molecular data set (Supplemental File S3). Here some of them are highlighted. Figure 4 shows the transformation for the binary character based on the operculum. Under a likelihood transformation, the plesiomorphic state for Serpulidae can be inferred as operculum present with four subsequent losses and one reappearance.
Figure 5 shows the transformation of four chaetal characters. Figure 5A shows the transformation for the distinctive Apomatus chaetae and that their presence is an apomorphy for the Filograninae plus Spirorbinae clade with four losses. Figure 5B shows the transformation for abdominal flat trumpet-shaped chaetae and that their presence is an apomorphy for the Serpulini. Figure 5C shows the transformation for abdominal true trumpet-shaped chaetae and that their presence is an apomorphy for the Ficopomatini. Figure 5D shows the transformation for the flat geniculate chaetae and that their presence is an apomorphy for the Filograninae plus Spirorbinae clade with two losses.

4. Discussion

This study presents the first analysis of phylogenetic relationships within Serpulidae sensu lato based on comprehensive taxonomic sampling of the genera and combined molecular and morphological data. The results of this study are generally consistent with those of earlier molecular studies [33,42,43,44] based on a more restricted taxonomic sampling and DNA sequence data.
The molecular and combined data analyses of Kupriyanova et al. [33] in 2006 provided the first well-supported phylogenetic tree topologies conflicting those obtained from earlier morphology-only analyses where Spirorbinae was recovered as the sister group to Serpulinae [58]. As in this study, in [33] Spirorbinae was recovered as the sister group to a clade composed of both ‘filogranin’ and ‘serpulin’ taxa, thus demonstrating that the traditionally formulated subfamilies Serpulinae and Filograninae were not monophyletic. The authors [33] called for a major revision of serpulid taxonomy but refrained from doing so suggesting that further taxon sampling and molecular sequencing were required. The results based on comprehensive sampling here further confirm non-monophyly of both traditional serpulid subfamilies Filograninae and Serpulinae and allow us to propose a new classification within Serpulidae.
The traditional taxonomy of serpulids relied largely on the absence (=many Filograninae) or presence (=all Serpulinae) of an operculum. When present, the structural details were used to delineate genera, such as being simple and membranous or reinforced with chitinous and/or structures such as endplates or spines of varying complexity. The operculum-bearing radiole could be unmodified and pinnulate, or modified into a smooth thickened peduncle (reviewed in [59]). No morphological synapomorphies have previously been proposed to support the traditional Filograninae. Moreover, in 1984 ten Hove [57] had noted that Filograninae was erected on the basis of apparently plesiomorphic (or possibly paedomorphic) features of pinnules on the opercular peduncle.
While all species characterized by unmodified pinnulated operculum-bearing radioles (or thickened pinnulated peduncle in Spirodiscus and Bathyditrupa) belong to Filograninae, many taxa in the filogranin clade have smooth peduncles and some even have complex chitinized opercula, notable examples being Pomatostegus, Metavermilia, or Vermiliopsis. While some filogranins are non-operculate (e.g., Protula, Turbocavus, Filogranella, Salmacina, some Protis spp.), some serpulins, such as Floriprotis sabiuraensis, Spirobranchus nigranucha, and some Hyalopomatus and Spiraserpula spp. also lack opercula, secondarily according to Figure 4. Furthermore, whereas opercular calcification is a common feature of serpulins in Galeolaria and especially in the Pyrgopolon-Spirobranchus clade, some Bathyvermilia spp. and Vermiliopsis labiata have calcified opercular endplates. The observed incongruence of molecular and morphological results in [33] led to the suggestion that the morphological characters traditionally used in serpulid taxonomy, especially opercular structures, may be misleading.
The results of this study strongly support the subdivision of Serpulidae into two major clades, and thus, we suggest that these groups should retain ranks of two previously erected subfamilies, Serpulinae and Filograninae, as well as maintaining the subfamily Spirorbinae, with the type genus Spirorbis. However, here we propose the formulation of the subfamilies based on chaetal rather than opercular characters. The suggested characters are the presence/absence of thoracic Apomatus chaetae and the structure of abdominal chaetae.
The presence of thoracic Apomatus chaetae (sometimes also termed sickle-shaped chaetae) (Figure 6G,H) was recovered as a synapomorphy for the first time and supported Filograninae plus Spirorbinae (Figure 5A). Another synapomorphy supporting subfamilies was the structure of the abdominal chaetae (Figure 5B–D, Figure 6E,F, Figure 7F and Figure 8E). In Filograninae, these chaetae are always some variant of flat geniculate type (sickle-shaped, flat triangular, flat narrow geniculate, retro-geniculate sensu ten Hove and Kupriyanova [59], Figure 6E,F). The notable exceptions are capillary abdominal chaetae of Bathyditrupa (although the closely related Spirodiscus shows typical for filogranin chaetae) and acicular chaetae of Paumotella. This newly formulated subfamily contains very morphologically variable taxa (Figure 6A–D) ranging from non-operculate taxa (e.g., Salmacina, Protula, Filogranella, Turbocavus) to taxa with simple membranous opercula lacking any re-enforcements (Apomatus, Filograna, Paraprotis) and those with distinct chitinous opercular re-enforcements (e.g., Vermiliopsis, Dasynema, Semivermilia, Pseudovermilia, and especially Pomatostegus).
In Serpulinae, for which we recovered no apomorphy, thoracic Apomatus chaetae are invariably absent and two very distinct types of abdominal chaetae, flat trumpet-shaped and true trumpet-shaped, are found (Figure 5B,C and Figure 7F). The original “trumpet-shaped chaetae” received this name because, when examined under a compound microscope, they looked widened into what in profile resembles a chalice or trumpet edged with apparently two rows of thin elongated teeth. However, examination with SEM showed [59] that these chaetae are not hollow as the name might suggest, but rather flat, with a single row of marginal acute teeth. This is in contrast with true trumpet-shaped abdominal chaetae, which when examined with SEM proved to be distally hollow, with two parallel rows of sharp denticles, extending into a long lateral spine [59]. These had been incorrectly lumped together with the completely different flat geniculate abdominal chaetae of filogranins. We suggest that the flat trumpet-shaped and true trumpet-shaped chaetae are synapomorphies supporting two main groups within Serpulinae, the tribes Serpulini and Ficopomatini, respectively.
Serpulini, including Crucigera, Floriprotis, Hydroides, and Spiraserpula, with type genus Serpula, is well supported by morphological apomorphies (Figure 7A–D, Supplemental File S3). In addition to the flat trumpet-shaped chaetae, Serpulini synapomorphies include the presence of funnel-shaped (Figure 7A,C,D) Serpula-type opercula (additionally topped with a chitinous verticil of chitinous spines in Hydroides (Figure 7C) and provided with basal opercular bosses (Figure 7A) in Crucigera), pseudoperculum on a shortened peduncle, and distinct bayonet-shaped special collar chaetae (Figure 7E). Based on morphology alone, the genera Serpula, Crucigera, and Hydroides formed the earliest monophyletic group recognized within the family [57]. Hydroides was recently revised, its monophyly confirmed by DNA data and the phylogenetic relationships within the genus have been accessed (Sun et al. [5]), but it was not recovered as a monophyletic group on morphology alone in this study. On the contrary, Crucigera and Serpula were not recovered as monophyletic in this study, a result already demonstrated previously [80], so the clade including terminals of Crucigera, Serpula, and Spiraserpula was a not unexpected outcome of this study. Interestingly, the fact that the usually non-operculate coral-associated Floriprotis (Figure 7B) also belongs to this group has not been explicitly proposed before, even though the taxon shows the chaetal pattern identical to that found in Serpula and Hydroides. Whether Spiraserpula is monophyletic needs to be tested in further analyses.
Ficopomatini, as proposed here, includes serpulins with true trumpet-shaped chaetae (Figure 8E), but no other synapomorphy supported the clade. Originally, Ficopomatinae was proposed by Pillai [37] for four monotypic brackish water serpulid genera (Neopomatus, Ficopomatus, Mercierella, and Sphaeropomatus), which were later synonymised with Ficopomatus [47]. The freshwater monotypic genus Marifugia was subsequently added to Ficopomatinae by Pillai, the author of the original subfamily [48]. Here we maintain Ficopomatus (supported by distinct collar chaetae (Figure 8H) with stout teeth, an apomorphy for the clade) and Marifugia (collar chaetae absent, no clear apomorphies proposed), even though in our analysis Marifugia was recovered as nested within Ficopomatus. Furthermore, we lower the previously erected subfamilial name Ficopomatinae to the tribe Ficopomatini and broaden the composition of the new tribe to include all genera from Neovermilia (positioned as sister to all other members of the tribe) to Galeolaria (Figure 2, Figure 3 and Figure 8) with the type genus Ficopomatus. This new tribe contains morphologically variable taxa with distinct significant opercular calcification (Galeolaria, Spirobranchus, and especially Pyrgopolon), with chitinous opercular endplates (Placostegus, Pseudochitinopoma, Ditrupa, Neovermilia, Laminatubus) and even with soft vesicular opercula without any re-enforcement (Hyalopomatus).
The phylogenetic position of poorly known and/or deep-sea taxa Bathyditrupa, Chitinopomoides, Microprotula, Neomicrorbis, Spirodiscus, Omphalopomopsis, Paumotella, Tanturia (all filogranins), as well as Vitreotubus and Zibrovermilia (Ficopomatini) inferred from morphological data only in this study needs to be confirmed with DNA sequence data when the molecular grade material becomes available. Furthermore, to obtain a robust phylogeny with optimal support, further analyses of serpulid phylogenetic relationships should be based on transcriptome data as performed for Sabellidae [32] or mitogenomes.

5. Conclusions

Morphological characters traditionally used in serpulid taxonomy, especially opercular and peduncular structures, appear to be poor indicators of phylogenetic relationships within the family. Based on results of comprehensive phylogenetic analyses of combined molecular and morphological data, we propose a new classification of Serpulidae that includes re-formulated subfamilies Serpulinae (with tribes Serpulini and Ficopomatini), Spirorbinae, and Filograninae supported by chaetal characters (presence of thoracic Apomatus chaetae and the structure of abdominal chaetae).

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/d15030398/s1, File S1: Description of morphological characters. File S2: Matrix of morphological characters used in this study in nexus format. File S3: Combined molecular and morphology dataset and BI tree used for Figure 3 and show transformations of morphological characters (Figure 4 and Figure 5). References [81,82,83,84,85] are cited in the supplementary materials (File S1).

Author Contributions

Conceptualization, E.K., G.W.R. and H.A.t.H.; methodology, G.W.R., H.A.t.H. and E.K.; validation, G.W.R., H.A.t.H. and E.K.; formal analysis, G.W.R.; investigation, G.W.R., H.A.t.H. and E.K.; resources, G.W.R. and E.K; data curation, E.K. and G.W.R. and; writing—original draft preparation, E.K. and G.W.R.; writing—review and editing, E.K., G.W.R. and H.A.t.H.; visualization, G.W.R.; supervision, G.W.R.; project administration, G.W.R.; funding acquisition, G.W.R. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Australian Research Council (ARC), grant DP0558736 to G.W.R, as well as Japan Society for the Promotion of Science (JSPS) grant S42300038 and Australian Biological Resource Study (ABRS) grant RG18-21 to E.K. Antarctic serpulids were collected on expeditions funded by the National Science Foundation (ANT-1043749) to G.W.R and others.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data are contained within the article or supplementary material.

Acknowledgments

We thank staff of Evolutionary Biology Unit (EBU) at University of Adelaide, Australia, molecular biology laboratory of Japanese Agency for Marine Science and Technology (JAMSTEC) in Yukosuka, Japan and Wildlife Genomics Lab at the Australian Museum in Sydney. Yoshihiro Fujiwara (JAMSTEC) helped with EK’s access to the molecular laboratory of JAMSTEC. We thank Lauren Helgen (formerly at University of Adelaide), Masaru Kawato (JAMSTEC), Ingo Burghardt (AM), Guillemine Daffe (visiting AM from University of Bordeaux, France) and Avery Hiley (SIO) for their help in the respective molecular labs. Thanks are due to Elly Beglinger and Sue Lindsay for their help with SEM in Zoological Museum of Amsterdam, Netherlands and the Australian Museum, respectively. The late Alexander Rzhavsky (Institute of Ecology and Evolution, Moscow, Russia) helped to code spirorbins. Ejiroh Nishi (Yokohama National University, Japan) hosted EK during her stay in Japan. Hiromi Uchida (Kushimoto Marine Park Center, Japan) kindly helped with examination of the type material of Microprotula ovicellata and with collecting Floriprotis sabiuraensis from the type locality. Nancy Prentiss (University of Maine, Farmington, ME, USA) kindly provided specimens of Turbocavus and Tara Macdonald (Biologica Environmental Services Ltd., Perth, ON, Canada) provided spirorbins for this study.

Conflicts of Interest

The authors declare no conflict of interest.

Appendix A

Matrix of combined A/P and multistate morphological characters. Unknown is coded with “?”
  • Body symmetry: symmetrical—0, asymmetrical—1.
  • Chaetal inversion: complete—0, incomplete—1.
  • Radiolar lobes: fused—0, separate—1.
  • Inter-radiolar membrane: absent—0, present —1.
  • Radiolar eyespots: absent—0, present—1.
  • Arrangements of radioles: in semi-circles—0, pectinately—1, in spiral—2.
  • Radiolar stylodes: present—0, absent—1.
  • Tube material: mucous—0, calcareous—1.
  • Tube keels: absent—0, present—1.
  • Tube (semi)circular in cross-section: no—0, yes—1.
  • Tube triangular in cross-section: no—0, yes—1.
  • Tube trapezoid in cross-section: no—0, yes—1.
  • Tube quadrangular in cross-section: no—0, yes—1.
  • Granular overlay: absent—0, present—1.
  • Tube wall transparency: completely opaque—0, with outer hyaline and inner opaque layer—1, completely hyaline—2.
  • Tube coiling: straight or irregular—1, spirally coiled—2.
  • Colonies due to asexual budding: absent—0, present—1.
  • Adult tube attachment: attached—0, unattached—1.
  • Internal tube structures: absent—0, present—1.
  • Tabulae: absent—0, present—1.
  • Colour of opaque tubes: white opaque—0, coloured—2.
  • Operculum: absent—0, present—1.
  • Pseudoperculum: absent—0, present—1.
  • Pseudoperculum: borne on pinnulated radiole—0, borne on smooth short radiole—1.
  • Opercular reinforcement: absent—0, present—1.
  • Chitinous reinforcement: absent—0, present—1.
  • Calcareous reinforcement: absent—0, present—1.
  • Thickened cuticle: absent—0, present—1.
  • Chitinous opercular reinforcement: without spines—0, with spines—1.
  • Chitinous endplate: flat opercular plate or concave—0, elongated opercular cap—1, multi-tiered structure—2.
  • Basal processes below operculum: absent—0, present—1.
  • Serpula-type operculum: absent—0, present—1.
  • Verticil on Serpula-type operculum: absent—0; present—1
  • Type of calcareous opercular reinforcement: operculum infested with calcareous flakes—1, calcareous deposits forming distal plate—2, entirely calcified operculum—3.
  • Calcareous opercular spines: absent—0, non-movable—1, movable—2.
  • Calcareous opercular talon: absent—0, short, embedded in opercular ampulla—1, long, continues into opercular peduncle—2.
  • Opercular constriction: operculum gradually merges into peduncle without constriction—0, operculum separated from the peduncle by a constriction—1.
  • Ontogeny of operculum: indirect—0, direct—1.
  • The operculum-bearing radiole is not different from all other radioles—0, operculum-bearing radiole is modified into a thickened peduncle—1.
  • Peduncle smooth, without pinnules—0, peduncle with pinnules—1.
  • Distal peduncular wings: absent—0, present—1.
  • Proximal peduncular wings: absent—0, present—1.
  • Insertion of the opercular peduncle: as second dorsal radiole—0, as the first radiole—1, at the base of radiolar crown, median insertion covering several opercular radioles—2.
  • Peduncle cross-section: circular—0, triangular—1, flattened—2.
  • Peduncle width: as wide as normal radioles—0, wider than normal radioles—1, much wider than normal radioles—2.
  • Peduncle surface texture: smooth—0, wrinkled—1.
  • Collar: unlobed—0, trilobed—1.
  • Collar tonguelets: absent—0, present—1.
  • Chaetae on the collar segment (collar chaetae): absent—0, present—1.
  • Special collar chaetae: absent—0, with basal modification—1, with distal modification—2.
  • Special fin-and-blade collar chaetae: absent—0, present—1
  • Special bayonet collar chaetae: absent—0, present—1.
  • Special Spirobranchus collar chaetae: absent—0, present—1.
  • Thoracic membranes: absent—0, present—1.
  • Thoracic membranes end: short, second segment—0, mid-thorax—1, end of thorax—2, form apron—3.
  • Thoracic Apomatus chaetae: absent—0, present—1.
  • Thoracic uncini rasp-shaped: absent—0, present—1.
  • Thoracic uncini saw-to-rasp: absent—0, present—1.
  • Thoracic uncini saw-shaped: absent—0, present—1.
  • Anterior tooth of thoracic uncini pointed: absent—0, present—1.
  • Anterior tooth of thoracic uncini blunt elongated, with rows of teeth implanted over almost entire length of peg (Protula type): absent—0, present—1.
  • Anterior tooth of thoracic uncini blunt rounded: absent—0, present—1.
  • Anterior tooth of thoracic uncini blunt flattened, often gouged underneath: absent—0, present—1.
  • Number of teeth in thoracic uncini in profile: < 8–0; 8–19–1; > 20–2.
  • Number of uncinigerous thoracic segments: seven—0, six—1, five—2, four—3, three—4.
  • Variable number of thoracic uncinigerous chaetigers: no—0, yes—1.
  • Ventral arrangement of thoracic uncini: parallel, not forming triangular depression—0, converging posteriorly forming triangular depression—1, fused—2.
  • Achaetous region in the beginning of abdomen: absent—0, present—1.
  • Abdominal chaetae capillary: no—0, yes—1.
  • Abdominal chaetae flat trumpet-shaped: no—0, yes—1.
  • Abdominal chaetae true trumpet shaped: no—0, yes—1.
  • Abdominal chaetae flat geniculate: no—0, yes—1.
  • Abdominal chaetae acicular: no—0, yes—1.
  • Posterior glandular pad: absent—0, present—1.
  • Long capillary chaetae in posterior abdominal segments: absent—0, present—1.

References

  1. Rouse, G.W.; Pleijel, F.; Tilic, E. Annelida; Oxford University Press: London, UK; New York, NY, USA, 2022; pp. 1–418. [Google Scholar] [CrossRef]
  2. Capa, M.; Kupriyanova, E.K.; Nogueira, J.M.; Bick, A.; Tovar-Hernández, M.A. Fanworms: Yesterday, today and tomorrow. Diversity 2021, 13, 130. [Google Scholar] [CrossRef]
  3. Kupriyanova, E.K.; ten Hove, H.A.; Nishi, E. A taxonomic revision of the genus Pseudochitinopoma Zibrowius, 1969 (Serpulidae, Annelida) with descriptions of two new species. Zootaxa 2012, 3507, 57–78. [Google Scholar] [CrossRef] [Green Version]
  4. Kupriyanova, E.K.; Ippolitov, A.P. Deep-sea serpulids (Annelida: Polychaeta) in tetragonal tubes: On a tube convergence path from Mesozoic to Recent. Zootaxa 2015, 4044, 151–200. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  5. Sun, Y.; Wong, E.; Ahyong, S.T.; Williamson, J.E.; Hutchings, P.A.; Kupriyanova, E.K. Barcoding and multi-locus phylogeography of the globally distributed calcareous tubeworm genus Hydroides Gunnerus, 1768 (Annelida, Polychaeta, Serpulidae). Mol. Phylogenet. Evol. 2018, 127, 732–745. [Google Scholar] [CrossRef]
  6. Rouse, G.W.; Kupriyanova, E.K. Laminatubus (Serpulidae, Annelida) from eastern Pacific hydrothermal vents and methane seeps, with description of two new species. Zootaxa 2021, 4915, 1–27. [Google Scholar]
  7. Kupriyanova, E.K.; Rzhavsky, A.V.; ten Hove, H.A. Family Serpulidae Rafinesque, 1815. In Handbook of Zoology. A Natural History of the Phyla of the Animal Kingdom; Schmidt–Rhaesa, A., Ed.; De Gruyter Publishers: Berlin, Germany, 2020; pp. 213–275. [Google Scholar]
  8. WoRMS. Serpulidae Rafinesque, 1815. 2022. Available online: https://www.marinespecies.org/aphia.php?p=taxdetails&id=988 (accessed on 23 December 2022).
  9. Pamungkas, J.; Glasby, C.J.; Read, G.B.; Wilson, S.P.; Costello, M.J. Progress and perspectives in the discovery of polychaete worms (Annelida) of the world. Helgol. Mar. Res. 2019, 73, 4. [Google Scholar] [CrossRef]
  10. Bastida-Zavala, J.R. Serpulids (Annelida: Polychaeta) from the Eastern Pacific, including a brief mention of Hawaiian serpulids. Zootaxa 2008, 1722, 1–61. [Google Scholar]
  11. Bastida-Zavala, R. Serpula and Spiraserpula (Polychaeta, Serpulidae) from the Tropical Western Atlantic and Gulf of Guinea. ZooKeys 2012, 198, 1–23. [Google Scholar] [CrossRef] [Green Version]
  12. Çinar, M.E. Alien polychaete species (Annelida: Polychaeta) on the Southern coast of Turkey (Levantine Sea, Eastern Mediterranean), with 13 new records for the Mediterranean Sea. J. Nat. Hist. 2009, 43, 2283–2328. [Google Scholar] [CrossRef]
  13. Nogueira, J.M.D.M.; Abbud, A. Three new serpulids (Polychaeta: Serpulidae) from the Brazilian Exclusive Economic Zone. Zoosymposia 2009, 2, 201–227. [Google Scholar]
  14. Tovar-Hernández, M.A.; Méndez, N.; Villalobos-Guerrero, T.F. Fouling polychaete worms from the Southern Gulf of California: Sabellidae and Serpulidae. Syst. Biodivers. 2009, 7, 319–336. [Google Scholar] [CrossRef]
  15. Pillai, T.G. A revision of the genera Galeolaria and Pyrgopolon (Polychaeta: Serpulidae), with discussions on opercular insertion as a character in their taxonomy and relationships, and their zoogeography. Zootaxa 2009, 2060, 47–58. [Google Scholar] [CrossRef] [Green Version]
  16. Sanfilippo, R. New species of Hyalopomatus Marenzeller, 1878 (Annelida, Polychaeta, Serpulidae) from Recent Mediterranean deep-water coral mounds and comments on some congeners. Zoosystema 2009, 31, 147–161. [Google Scholar] [CrossRef]
  17. Bailey-Brock, J.H.; Magalhães, W.F. A new species and record of Serpulidae (Annelida: Polychaeta) from Cross Seamount in the Hawaiian Chain. Zootaxa 2012, 3192, 49–58. [Google Scholar] [CrossRef]
  18. Bailey-Brock, J.H.; Magalhães, W.F.; Brock, R.E. Coral reef inhabiting tubeworms (Polychaeta: Serpulidae) from Enewetak, Kwajalein, Rongelap and Utirik Atolls, Marshall Islands. J. Mar. Biol. Assoc. UK 2012, 92, 967–988. [Google Scholar] [CrossRef]
  19. Prentiss, N.K.; Vasileiadou, K.; Faulwetter, S.; Arvanitidis, C.; ten Hove, H.A. A new genus and species of Serpulidae (Annelida, Polychaeta, Sabellida) from the Caribbean Sea. Zootaxa 2014, 3900, 204–222. [Google Scholar] [CrossRef] [Green Version]
  20. Pernet, B.; Barton, M.; Fitzhugh, K.; Harris, L.; Lizárraga, D.; Ohl, R.; Whitcraft, C. Establishment of the reef-forming tubeworm Ficopomatus enigmaticus (Fauvel, 1923) (Annelida: Serpulidae) in Southern California. Bioinvasions Rec. 2016, 5, 13–19. [Google Scholar] [CrossRef]
  21. Bastida-Zavala, J.R.; Buelna, A.S.R.; De León-González, J.A.; Camacho-Cruz, K.A.; Carmona, I. New records of sabellids and serpulids (Polychaeta: Sabellidae, Serpulidae) from the Tropical Eastern Pacific. Zootaxa 2016, 4184, 401–457. [Google Scholar] [CrossRef]
  22. Bastida-Zavala, J.R.; McCann, L.D.; Keppel, E.; Ruiz, G.M. The fouling serpulids (Polychaeta: Serpulidae) from United States coastal waters: An overview. Eur. J. Taxon. 2017, 344, 1–76. [Google Scholar] [CrossRef] [Green Version]
  23. Yee, A.; Mackie, J.; Pernet, B. The distribution and unexpected genetic diversity of the non-indigenous annelid Ficopomatus enigmaticus in California. Aquat. Invasions 2019, 14, 250–266. [Google Scholar] [CrossRef]
  24. Oliva, M.; De Marchi, L.; Sanches, M.V.; Pires, A.; Cuccaro, A.; Baratti, M.; Chiellini, F.; Morelli, A.; Freitas, R.; Pretti, C. Atlantic and Mediterranean populations of the widespread serpulid Ficopomatus enigmaticus: Developmental responses to carbon nanotubes. Mar. Pollut. Bull. 2020, 156, 111265. [Google Scholar] [CrossRef] [PubMed]
  25. Grosse, M.; Pérez, R.; Juan-Amengual, M.; Pons, J.; Capa, M. The elephant in the room: First record of invasive gregarious species of serpulids (calcareous tube annelids) in Majorca (Western Mediterranean). Sci. Mar. 2021, 81, 15–28. [Google Scholar] [CrossRef]
  26. Dales, R.P. The nature of the pigments in the crown of sabellid and serpulid polychaetes. J. Mar. Biol. Assoc. UK 1962, 42, 259–274. [Google Scholar] [CrossRef] [Green Version]
  27. Fauchald, K. The polychaete worms. Definitions and keys to the orders, families and genera. Nat. Hist. Mus. LA City. Sci. Ser. 1977, 28, 1–188. [Google Scholar]
  28. Pettibone, M.H. Annelida. In Synopsis and Classification of Living Organisms; Parker, S.P., Ed.; McGraw-Hill Book Co.: New York, NY, USA, 1982; Volume 2, pp. 1–43. [Google Scholar]
  29. Smith, R.S. Relationships within the order Sabellida (Polychaeta). Ophelia Suppl. 1991, 5, 249–260. [Google Scholar]
  30. Rousset, V.; Rouse, G.W.; Siddall, M.E.; Tillier, A.; Pleijel, F. The phylogenetic position of Siboglinidae (Annelida), inferred from 18S rRNA, 28S rRNA, and morphological data. Cladistics 2004, 20, 518–533. [Google Scholar] [CrossRef]
  31. Kupriyanova, E.K.; Rouse, G.W. Yet another example of paraphyly in Annelida: Molecular evidence that Sabellidae contains Serpulidae. Mol. Phylogenet. Evol. 2008, 46, 1174–1181. [Google Scholar] [CrossRef]
  32. Tilic, E.; Sayyari, E.; Stiller, J.; Mirarab, S.; Rouse, G.W. More is needed—Thousands of loci are required to elucidate the relationships of the ‘Flowers of the Sea’ (Sabellida, Annelida). Mol. Phylogenet. Evol. 2020, 151, 106892. [Google Scholar] [CrossRef]
  33. Kupriyanova, E.K.; McDonald, T.A.; Rouse, G.W. Phylogenetic relationships within Serpulidae (Annelida: Polychaeta) inferred from molecular and morphological data. Zool. Scr. 2006, 35, 421–439. [Google Scholar] [CrossRef]
  34. Rafinesque, S.C. L’analyse de la Nature, Palermo, Italy, 1815; 224 p.
  35. Chamberlin, R.V. The Annelida Polychaeta. “Albatross” Expedition. Mem. Mus. Comp. Zool. Harv. Coll. 1919, 48, 1–518. [Google Scholar]
  36. Rioja, E. Estudio sistemático de las especies Ibéricas del Suborden Sabelliformia. Trab. Mus. Nac. Cien. Nat. Ser. Zool. 1923, 48, 1–144. [Google Scholar]
  37. Pillai, T.G. Some marine and brackish-water serpulid polychaetes from Ceylon, including new genera and species. Ceylon J. Sci. Biol. Sci. 1960, 3, 1–40. [Google Scholar]
  38. Uchida, H. Serpulid tube worms (Polychaeta, Sedentaria) from Japan with the systematic review of the group. Bull. Mar. Park Res. Stat. 1978, 2, 1–98. [Google Scholar]
  39. Pillai, T.G. Studies on a collection of spirorbids from Ceylon, together with a critical review and revision of spirorbid systematics and an account of their phylogeny and zoogeography. Ceylon J. Sci. Biol. Sci. 1970, 8, 100–172. [Google Scholar]
  40. Fitzhugh, K. A systematic revision of the Sabellidae-Caobangiidae-Sabellongidae complex (Annelida: Polychaeta). Bull. Am. Mus. Nat. Hist. 1989, 192, 1–104. [Google Scholar]
  41. Macdonald, T.A. Phylogenetic relations among spirorbid subgenera and the evolution of opercular brooding. Hydrobiologia 2003, 496, 125–143. [Google Scholar] [CrossRef]
  42. Lehrke, J.; ten Hove, H.A.; Macdonald, T.A.; Bartolomaeus, T.; Bleidorn, C. Phylogenetic relationships of Serpulidae (Annelida: Polychaeta) based on 18S rDNA sequence data, and implications for opercular evolution. Org. Divers. Evol. 2007, 7, 195–206. [Google Scholar] [CrossRef] [Green Version]
  43. Kupriyanova, E.K.; ten Hove, H.A.; Sket, B.; Zakšek, V.; Trontelj, P.; Rouse, G.W. Evolution of a unique freshwater cave-dwelling serpulid polychaete Marifugia cavatica Absolon and Hrabĕ, 1930. Syst. Biodivers 2009, 7, 389–401. [Google Scholar] [CrossRef]
  44. Kupriyanova, E.K.; Nishi, E. Serpulidae (Annelida, Polychaeta) from Patton-Murray Seamount, Gulf of Alaska, North Pacific Ocean. Zootaxa 2010, 2665, 51–68. [Google Scholar] [CrossRef]
  45. Rzhavsky, A.V.; Kupriyanova, E.K.; Sikorski, A.V. Two new species of serpulid polychaetes from the Barents Sea. Fauna Norv. 2013, 32, 27–38. [Google Scholar] [CrossRef] [Green Version]
  46. Pillai, T.G. Studies on a collection of marine and brackish-water polychaete annelids of the family Serpulidae from Ceylon. Ceylon J. Sci. Biol. Sci. 1971, 9, 88–130. [Google Scholar]
  47. ten Hove, H.A.; Weerdenburg, J.C.A. A generic revision of the brackish-water serpulid Ficopomatus Southern 1921 (Polychaeta: Serpulinae), including Mercierella Fauvel 1923, Sphaeropomatus Treadwell 1934, Mercierellopsis Rioja 1945 and Neopomatus Pillai 1960. Biol. Bull. 1978, 154, 96–120. [Google Scholar] [CrossRef] [PubMed]
  48. Pillai, T.G. Ficopomatus talehsapensis, a new brackish-water species (Polychaeta: Serpulidae: Ficopomatinae) from Thailand, with discussions on the relationships of taxa constituting the subfamily, opercular insertion as a taxonomic character and their taxonomy, a key to its taxa, and their zoogeography. Zootaxa 2008, 1967, 36–52. [Google Scholar]
  49. Li, S.-C.; Wang, A.-T.; Deng, L. A new euryhaline species of the genus Ficopomatus Southern 1921 (Polychaeta: Serpulidae) from China. Zool. Stud. 2012, 51, 1165–1174. [Google Scholar]
  50. Styan, C.A.; McCluskey, C.F.; Sun, Y.; Kupriyanova, E.K. Cryptic sympatric species across the Australian range of the global estuarine invader Ficopomatus enigmaticus (Serpulidae, Annelida). Aquat. Invasions 2017, 12, 53–65. [Google Scholar] [CrossRef]
  51. Fauvel, P. Un nouveau serpulien d’eau saumâtre Mercierella n. g. enigmatica n. sp. Bull. Soc. Zool. France 1923, 47, 424–430. [Google Scholar]
  52. Absolon, K.; Hrabĕ, S. Über einen neuen Süsswasser–Polychaeten aus den Höhlengewässern der Herzegowina. Zool. Anz. 1930, 88, 249–264. [Google Scholar]
  53. Arteaga-Flórez, C.; Fernández-Rodríguez, V.; Londoño-Mesa, M.H. First record of the polychaete Ficopomatus uschakovi (Pillai, 1960) (Annelida, Serpulidae) in the Colombian Caribbean, South America. Zookeys 2014, 371, 1–11. [Google Scholar] [CrossRef] [Green Version]
  54. Caullery, M.; Mesnil, F. Note sur deux serpuliens nouveaux (Oriopsis metchnikowi n. g., n.sp. et Josephella marenzelleri n.g., n.sp.). Zool. Anz. 1896, 10, 482–486. [Google Scholar]
  55. Fauvel, P. Deuxième note préliminaire sur les Polychètes provenant des campagnes de l’Hirondelle et de la Princesse- Alice, ou déposées dans la Musée Océanographique de Monaco. Bull. Inst. Océanogr. 1909, 142, 1–76. [Google Scholar]
  56. Hartman, O. Catalogue of the Polychaetous Annelids of the World; University of Southern California Press: Los Angeles, CA, USA, 1959; Volume 23, pp. 1–628. [Google Scholar]
  57. ten Hove, H.A. Towards a phylogeny in serpulids (Annelida; Polychaeta). In Proceedings of the First International Polychaete Conference; Hutchings, P.A., Ed.; Linnean Society of New South Wales: Sydney, Australia, 1984; pp. 181–196. [Google Scholar]
  58. Kupriyanova, E.K. Life history evolution in Serpulimorph polychaetes: A phylogenetic analysis. Hydrobiologia 2003, 496, 105–114. [Google Scholar] [CrossRef]
  59. ten Hove, H.A.; Kupriyanova, E.K. Taxonomy of Serpulidae (Annelida, Polychaeta): The state of affairs. Zootaxa 2009, 2036, 1–126. [Google Scholar] [CrossRef] [Green Version]
  60. Rzhavsky, A.V.; Kupriyanova, E.K. Evolution of spirorbin brooding: A phylogenetic analysis and a test of an oxygen limitation hypothesis. Invertebr. Zool. 2019, 16, 409–430. [Google Scholar] [CrossRef]
  61. Pleijel, F. On character coding for phylogeny reconstruction. Cladistics 1995, 11, 309–315. [Google Scholar] [CrossRef]
  62. Swofford, D.L. PAUP*. Phylogenetic Analysis Using Parsimony (and Other Methods); Version 4; Sinauer Associates: Sunderland, MA, USA, 2002. [Google Scholar]
  63. Nóren, M.; Jordelius, U. Phylogeny of Prolecithophora (Platyhelminthes) inferred from 18S rDNA sequences. Cladistics 1999, 15, 103–112. [Google Scholar] [CrossRef] [PubMed]
  64. Osborn, K.J.; Rouse, G.W.; Goffredi, S.K.; Robison, B.H. Description and relationships of Chaetopterus pugaporcinus, an unusual pelagic polychaete (Annelida, Chaetopteridae). Biol. Bull. 2007, 212, 40–54. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  65. Brown, A.C.; Rouse, G.W.; Hutchings, P.; Colgan, D. Assessing the usefulness of histone H3, U2 snRNA and 28S rDNA in analyses of polychaete relationships. Austr. J. Zool. 1999, 47, 499–516. [Google Scholar] [CrossRef]
  66. Burnette, A.B.; Struck, T.H.; Halanych, K.M. Holopelagic Poeobius meseres (“Poeobiidae,” Annelida) is derived from benthic flabelligerid worms. Biol. Bull. 2005, 208, 213–220. [Google Scholar] [CrossRef] [Green Version]
  67. Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic Local Alignment Search Tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef]
  68. Nixon, K.C. The Parsimony Ratchet, a new method for rapid parsimony analysis. Cladistics 1999, 15, 407–414. [Google Scholar] [CrossRef]
  69. Müller, K. PRAP—Computation of Bremer support for large data sets. Mol. Phylogenet. Evol. 2004, 31, 780–782. [Google Scholar] [CrossRef] [PubMed]
  70. Edgar, R.C. MUSCLE: Multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 2004, 32, 1792–1797. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  71. Katoh, K.; Standley, D.M. MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  72. Vaidya, G.; Lohman, D.J.; Meier, R. Sequence Matrix: Concatenation software for the fast assembly of multi-gene datasets with character set and codon information. Cladistics 2011, 27, 171–180. [Google Scholar] [CrossRef]
  73. Edler, D.; Klein, J.; Antonelli, A.; Silvestro, D. RaxmlGUI 2.0: A graphical interface and toolkit for phylogenetic analyses using RAxML. Methods Ecol. Evol. 2021, 12, 373–377. [Google Scholar] [CrossRef]
  74. Kozlov, A.M.; Diego, D.; Flouri, T.; Morel, B.; Stamatakis, A. RAxML-NG: A fast, scalable and user-friendly tool for maximum likelihood phylogenetic inference. Bioinformatics 2019, 35, 4453–4455. [Google Scholar] [CrossRef] [Green Version]
  75. Darriba, D.; Posada, D.; Kozlov, A.M.; Stamatakis, A.; Morel, B.; Flouri, T. ModelTest-NG: A new and scalable tool for the selection of DNA and protein evolutionary models. Mol. Biol. Evol. 2020, 37, 291–294. [Google Scholar] [CrossRef] [Green Version]
  76. Ronquist, F.; Teslenko, M.; van der Mark, P.; Ayres, D.L.; Darling, A.; Höhna, S.; Larget, B.; Liu, L.; Suchard, M.A.; Huelsenbeck, J.P. MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Syst. Biol. 2012, 61, 539–542. [Google Scholar] [CrossRef] [Green Version]
  77. Rambaut, A.; Drummond, A.J.; Xie, D.; Baele, G.; Suchard, M.A. Posterior summarisation in Bayesian phylogenetics using Tracer 1.7. Syst. Biol. 2018, 67, 901–904. [Google Scholar] [CrossRef] [Green Version]
  78. Lewis, P.O. A likelihood approach to estimating phylogeny from discrete morphological character data. Syst. Biol. 2001, 50, 913–925. [Google Scholar] [CrossRef] [Green Version]
  79. Maddison, W.P.; Maddison, D.R. Mesquite: A Modular System for Evolutionary Analysis. Version 3.70. Available online: http://mesquiteproject.org (accessed on 12 December 2022).
  80. Kupriyanova, E.K.; Bastida-Zavala, R.; Halt, M.N.; Lee, M.; Rouse, G.W. Phylogeny of the Serpula-Crucigera-Hydroides clade (Serpulidae; Annelida) using molecular and morphological data: Implications for operculum evolution. Invertebr. Syst. 2008, 22, 425–437. [Google Scholar] [CrossRef]
  81. Bastida-Zavala, J.R.; ten Hove, H.A. Revision of Hydroides Gunnerus, 1768 (Polychaeta: Serpulidae) from the Eastern Pacific Region and Hawaii. Beaufortia 2003, 53, 67–110. [Google Scholar]
  82. Bok, M.J.; Capa, M.; Nilsson, D.-E. Here, there and everywhere: The radiolar eyes of fan worms (Annelida, Sabellidae). Integr. Comp. Biol. 2016, 56, 784–795. [Google Scholar] [CrossRef] [Green Version]
  83. Vinn, O.; Kirsimiäe, K.; ten Hove, H.A. Tube ultrastructure of Pomatoceros americanus (Polychaeta, Annelida): Implications for the tube formation of serpulids. Est. J. Earth Sci. 2009, 58, 148–152. [Google Scholar] [CrossRef]
  84. Ippolitov, A.P.; Vinn, O.; Kupriyanova, E.K.; Jäger, M. Written in stone: History of serpulid polychaetes through time. Mem. Mus. Vict. 2014, 71, 123–160. [Google Scholar] [CrossRef] [Green Version]
  85. Simon, C.; van Niekerk, H.; Burghardt, I.; ten Hove, H.A.; Kupriyanova, E.K. Not out of Africa: Spirobranchus kraussii (Baird, 1865) is not a global fouling and invasive serpulid of Indo-Pacific origin. Aquat. Invasions 2019, 14, 221–249. [Google Scholar] [CrossRef]
Diversity 15 00398 g001 550
Figure 1. Strict consensus of 1,192,317 shortest trees resulted from the maximum parsimony analysis of 75-character morphology dataset. Outgroups are excluded.
Figure 1. Strict consensus of 1,192,317 shortest trees resulted from the maximum parsimony analysis of 75-character morphology dataset. Outgroups are excluded.
Diversity 15 00398 g001
Diversity 15 00398 g002 550
Figure 2. Maximum likelihood (RaXML) best tree based on the molecular data set. Outgroups are excluded. The BI analysis topology was congruent. ML bootstrap values are shown followed by posterior probabilities for the BI analysis. Nodes with bootstrap values of 100 and posterior probabilities of 1.0 are indicated with *. Nodes with bootstrap values < 50% and posterior probabilities < 0.5 are blank.
Figure 2. Maximum likelihood (RaXML) best tree based on the molecular data set. Outgroups are excluded. The BI analysis topology was congruent. ML bootstrap values are shown followed by posterior probabilities for the BI analysis. Nodes with bootstrap values of 100 and posterior probabilities of 1.0 are indicated with *. Nodes with bootstrap values < 50% and posterior probabilities < 0.5 are blank.
Diversity 15 00398 g002
Diversity 15 00398 g003 550
Figure 3. Bayesian majority rule consensus phylogram of the combined molecular and morphological data set. The ML analysis of the same dataset had some incongruities. Bootstrap values of 100 and posterior probabilities 1.0 are indicated with *. Nodes with bootstrap values < 50% and posterior probabilities < 0.5 are blank. Nodes that were not found in the ML analysis are indicated by -.
Figure 3. Bayesian majority rule consensus phylogram of the combined molecular and morphological data set. The ML analysis of the same dataset had some incongruities. Bootstrap values of 100 and posterior probabilities 1.0 are indicated with *. Nodes with bootstrap values < 50% and posterior probabilities < 0.5 are blank. Nodes that were not found in the ML analysis are indicated by -.
Diversity 15 00398 g003
Diversity 15 00398 g004 550
Figure 4. Ancestral state reconstruction, using Mesquite under a likelihood model, of the character 22 from the morphology matrix, Operculum, traced on the Bayesian majority rule consensus phylogram of the combined molecular and morphological data set. The plesiomorphic state for Serpulidae can be inferred as operculum present with four subsequent losses and one reappearance.
Figure 4. Ancestral state reconstruction, using Mesquite under a likelihood model, of the character 22 from the morphology matrix, Operculum, traced on the Bayesian majority rule consensus phylogram of the combined molecular and morphological data set. The plesiomorphic state for Serpulidae can be inferred as operculum present with four subsequent losses and one reappearance.
Diversity 15 00398 g004
Diversity 15 00398 g005 550
Figure 5. Ancestral state reconstruction, using Mesquite under a likelihood model, of four of the chaetal character from the morphology matrix traced on the Bayesian majority rule consensus phylogram of the combined molecular and morphological data set. (A)—Character 56 Apomatus chaetae, (B)—Character 70 (abdominal chaetae flat trumpet-shaped), (C)—Character 71 (abdominal chaetae true trumpet-shaped, (D)—Character 72 (abdominal chaetae flat geniculate).
Figure 5. Ancestral state reconstruction, using Mesquite under a likelihood model, of four of the chaetal character from the morphology matrix traced on the Bayesian majority rule consensus phylogram of the combined molecular and morphological data set. (A)—Character 56 Apomatus chaetae, (B)—Character 70 (abdominal chaetae flat trumpet-shaped), (C)—Character 71 (abdominal chaetae true trumpet-shaped, (D)—Character 72 (abdominal chaetae flat geniculate).
Diversity 15 00398 g005
Diversity 15 00398 g006 550
Figure 6. Representatives of Filograninae and their chaetal characters. (A)—Pomatostegus actinoceras (photo A. Semenov); (B)—Filogranella sp. (photo E. Nishi); (C)—Metavermilia acanthophora (photo G. Rouse); (D)—Salmacina sp. (photo G. Rouse); (E)—SEM of abdominal flat geniculate chaetae in Chitinopoma, (F)—SEM of abdominal flat geniculate chaetae of Metavermilia; (G)—SEM of thoracic Apomatus chaetae of Filograna; (H)—SEM of thoracic Apomatus chaetae of Filogranula ((E–H) photos S. Lindsay).
Figure 6. Representatives of Filograninae and their chaetal characters. (A)—Pomatostegus actinoceras (photo A. Semenov); (B)—Filogranella sp. (photo E. Nishi); (C)—Metavermilia acanthophora (photo G. Rouse); (D)—Salmacina sp. (photo G. Rouse); (E)—SEM of abdominal flat geniculate chaetae in Chitinopoma, (F)—SEM of abdominal flat geniculate chaetae of Metavermilia; (G)—SEM of thoracic Apomatus chaetae of Filograna; (H)—SEM of thoracic Apomatus chaetae of Filogranula ((E–H) photos S. Lindsay).
Diversity 15 00398 g006
Diversity 15 00398 g007 550
Figure 7. Representatives of Serpulini and their chaetal characters. (A)—Crucigera zygophora (photo K. Sanamyan); (B)—Floriprotis sabiuraensis (photo K. Nomura); (C)—Hydroides lirs (photo A. Semenov); (D)—Serpula columbiana (photo A. Semenov); (E)—SEM of collar chaetae of Hydroides; (F)—SEM of flat trumpet chaetae of Hydroides ((E,F) photos S. Lindsay).
Figure 7. Representatives of Serpulini and their chaetal characters. (A)—Crucigera zygophora (photo K. Sanamyan); (B)—Floriprotis sabiuraensis (photo K. Nomura); (C)—Hydroides lirs (photo A. Semenov); (D)—Serpula columbiana (photo A. Semenov); (E)—SEM of collar chaetae of Hydroides; (F)—SEM of flat trumpet chaetae of Hydroides ((E,F) photos S. Lindsay).
Diversity 15 00398 g007
Diversity 15 00398 g008 550
Figure 8. Representatives of Ficopomatini and their chaetal characters. (A)—Spirobranchus tetraceros (photo W. Zhang); (B)—Galeolaria hystrix; (C)—Hyalopomatus sp.; (D)—Neovermilia globula ((B–D) photo G. Rouse); (E)—SEM of true trumpet-shaped abdominal chaeta of Spirobranchus; (F)—Ficopomatus cf. uschakovi, (G)—F. enigmaticus; (H)—collar chaetae of Ficopomatus sp. ((E,F) photos E. Wong).
Figure 8. Representatives of Ficopomatini and their chaetal characters. (A)—Spirobranchus tetraceros (photo W. Zhang); (B)—Galeolaria hystrix; (C)—Hyalopomatus sp.; (D)—Neovermilia globula ((B–D) photo G. Rouse); (E)—SEM of true trumpet-shaped abdominal chaeta of Spirobranchus; (F)—Ficopomatus cf. uschakovi, (G)—F. enigmaticus; (H)—collar chaetae of Ficopomatus sp. ((E,F) photos E. Wong).
Diversity 15 00398 g008
Table
Table 1. Terminals with vouchers and GenBank accession numbers. FMNH–Field Museum of Natural History, Chicago, IL, USA; SIO–Scripps Institution of Oceanography, San Diego, CA, USA; NHMW–Museum of Natural History of Vienna (=Wien), Austria; USNM–United States National Museum, Washington, DC, USA.
Table 1. Terminals with vouchers and GenBank accession numbers. FMNH–Field Museum of Natural History, Chicago, IL, USA; SIO–Scripps Institution of Oceanography, San Diego, CA, USA; NHMW–Museum of Natural History of Vienna (=Wien), Austria; USNM–United States National Museum, Washington, DC, USA.
SpeciesVouchers28S18SHistone H3Cytochrome b
Apomatus globiferZMA V.Pol. 5250EU195362EU195378OQ397982OQ427448
Apomatus sp.FMNH 5201OQ389662 OQ379428OQ397983OQ427449
Apomatus voightaeFMNH 6217OQ389663GU441856-OQ427450
Bathyditrupa hoveiZMA V.Pol 5325----
Bathyvermilia eliasoniFMNH 6189-GU441857--
Chitinopoma serrulaSAM E3524EU195350DQ317112OQ397984-
Chitinopomoides wilsoniZMA V.Pol. 3166----
Crucigera inconstansSAM E3525EU184071DQ317113-EU190464
Crucigera tricornisSAM E3587EU184067EU184056-EU190474
Crucigera zygophoraSAM E3503DQ242577DQ242543EF192929EU190470
Dasynema chrysogyrusAM W.45087OQ397664OQ379429--
Ditrupa arietinaSAM E3527EU195351DQ317114EF192933-
Ficopomatus enigmaticusSAM E3356EU195373DQ317115OQ427487OQ427451
Ficopomatus macrodonSAM E3618EU167535EU167532OQ412612KP863778
Ficopomatus miamiensisSAM E3617EU167534EU167531OQ397989KP863779
Filograna implexaSAM E3528EU195347DQ317116-OQ427452
Filogranella elatensisSAM E3661EU195370EU195385--
Filogranula stellataSAM E3606EU195358EU195374OQ397985-
Floriprotis sabiuraensisSAM E3659EU195371EU195386-OQ427453
Floriprotis sabiuraensisSAM E7192OQ389665 OQ379430-OQ427454
Galeolaria caespitosaSAM E3529OQ389666 OQ379431OQ412631EU184054
Galeolaria hystrixSAM E3526EU256550DQ314839OQ397988EU200441
Helicosiphon biscoeensisSIO-BIC A4000OQ392408OQ379432OQ412613-
Hyalopomatus mironoviSAM E3728OQ651975GU063862MT468421 MT468442
Hydroides elegansSAM E3616EU195369EU195384OQ412614OQ427455
Hydroides ezoensisSAM E3584EU184077EU184062-OQ427456
Hydroides nikaeSAM E3530EU184072DQ317117-EU190466
Hydroides minaxSAM E3597EU184074EU184063-EU190475
Hydroides pseudouncinataZMA V.Pol. 5240EU184075DQ140403-EU190467
Hydroides sanctaecrucisSAM E3625EU184076EU184061--
Hydroides trivesiculosaSAM E3601EU184073EU184060OQ397992EU190476
Hydroides tuberculataSAM E3596OQ389667EU184059-EU190473
Janita fimbriataAM W.42388OQ389668OQ379433-OQ427457
Josephella marenzelleriSAM E3620EU195359EU195375-OQ427458
Laminatubus alviniSAM E3531EU195355DQ317118OQ412616OQ427459
Marifugia cavaticaSAM E3612EU167533EU167530OQ397990OQ427460
Metavermilia acanthophoraSAM E3533EU195352DQ317119-OQ427461
Microprotula ovicellataZMA V.Pol. 4046----
Neomicrorbis azoricusZMA V.Pol. 3905----
Neovermilia globulaSAM E3586EU195363EU195379--
Spirodiscus grimaldiiZMA V.Pol. 3906----
Omphalopomopsis langerhansiiNHMWAN14552.2054----
Paraprotis dendrovaSAM E3591EU195361EU195377--
Paraprotis pulchraSAM E3665OQ389669 OQ379434OQ412629OQ427462
Paumotella takemoanaUSNM 19432----
Placostegus sp.SAM E3589OQ397665OQ379435OQ412628-
Placostegus tridentatusSAM E3585EU195364 OQ379436OQ412622-
Pomatostegus actinocerasAM W.42378OQ389670 OQ379437--
Pomatostegus stellatusSAM E3607EU195367EU195382--
Protis hydrothermicaSAM E3541EU195356DQ317122--
Protis sp.SAM E3727OQ389671 OQ379438-OQ427463
Protula bispiralisSAM E3657OQ389672 OQ379439OQ412609OQ427464
Protula tubulariaSAM E3542EU195349DQ317123EF192934OQ427465
Pseudochitinopoma occidentalisSAM E3501DQ242575DQ242542OQ412626OQ427466
Pseudochitinopoma pavimentataSAM E3660OQ397666OQ379440OQ412627OQ427467
Pseudovermilia occidentalisSAM E3613EU195368EU195383-OQ427468
Pyrgopolon ctenactisSIO-BIC A25451OQ389673OQ379441OQ412625-
Rhodopsis pusillaSAM E3621EU195360EU195376OQ397987OQ427469
Salmacina sp.SAM E3499EU256545DQ317126-OQ427470
Semivermilia annehoggettaeSAM E3628OQ389674 OQ379442-OQ427471
Semivermilia ellipticaSAM E3664EU195372EU195387OQ397986OQ427472
Semivermilia lylevailiSAM E3629OQ397667OQ389601--
Serpula columbianaSAM E3505DQ242576DQ317127-EU190469
Serpula concharumZMA V.Pol. 5245EU184066DQ140408-EU190468
Serpula jukesiiSAM E3536EU184069DQ317129-EU190465
Serpula narconensisSIO-BIC A3469OQ389676OQ379443OQ397991-
Serpula uschakoviSAM E3593EU184078EU184065-EU190477
Serpula vermicularisSAM E3537EU184070DQ317128-EU190479
Serpula vittataSAM E3594EU184079EU184064-EU190471
Serpula watsoniSAM E3595EU184068EU184057-EU190472
Spiraserpula iugoconvexaAM W.42093OQ389680OQ379444-OQ427473
Spirobranchus akitsushimaZMA V.Pol. 3201 EU195365EU195380-OQ427474
Spirobranchus corniculatusZMA V.Pol. 5247 OQ389677OQ379446-OQ427475
Spirobranchus corniculatusSAM E3608EU195366EU195381-OQ427476
Spirobranchus coronatusSAM E3609OQ389678 OQ379445OQ412624OQ427477
Spirobranchus kraussiiAM W.49977OQ397668MK308673OQ412619MK308658
Spirobranchus limaSAM E3538EU256547DQ317130EF192930OQ427478
Spirobranchus richardsmithiSAM E3610OQ389679OQ379447-OQ427479
Spirobranchus taeniatusSAM E3532EU195353DQ317120OQ412618OQ427480
Spirobranchus triqueterSAM E3534EU195348DQ317121EF192932OQ427481
Tanturia zibrowiiZMA V.Pol. 4668 ----
Turbocavus secretusUSNM 251863-OQ379448OQ412611OQ427483
Vermiliopsis infundibulumZMA V.Pol. 5248OQ389681DQ140411-OQ427484
Vermiliopsis labiataSAM E3543 EU256549DQ317131-OQ427485
Vermiliopsis pygidialisSAM E3544EU256546DQ317132--
Vermiliopsis striaticepsSAM E3545EU256548DQ317133EF192931OQ427486
Vitreotubus digeronimoiZMA V.Pol.3907----
Zibrovermilia zibrowiiAM W.46387----
Protolaeospira tricostalisSAM E3487DQ242606DQ318587EF192936-
Romanchella quadricostalisSAM E3491DQ242608DQ242559EF192935-
Spirorbis tridentatusSAM E3477 DQ242602DQ242573OQ412623-
Manayunkia athalassiaSAM E3518DQ209245EF116202EF192917-
Schizobranchia insignisGenBankAY732225AY732222--
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Kupriyanova, E.; ten Hove, H.A.; Rouse, G.W. Phylogeny of Serpulidae (Annelida, Polychaeta) Inferred from Morphology and DNA Sequences, with a New Classification. Diversity 2023, 15, 398. https://doi.org/10.3390/d15030398

AMA Style

Kupriyanova E, ten Hove HA, Rouse GW. Phylogeny of Serpulidae (Annelida, Polychaeta) Inferred from Morphology and DNA Sequences, with a New Classification. Diversity. 2023; 15(3):398. https://doi.org/10.3390/d15030398

Chicago/Turabian Style

Kupriyanova, Elena, Harry A. ten Hove, and Greg W. Rouse. 2023. "Phylogeny of Serpulidae (Annelida, Polychaeta) Inferred from Morphology and DNA Sequences, with a New Classification" Diversity 15, no. 3: 398. https://doi.org/10.3390/d15030398

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop