Outer Membrane Vesicles of Avian PathogenicEscherichia coli Mediate the Horizontal Transmission of blaCTX-M-55
Abstract
:1. Introduction
2. Results
2.1. Identification of an IncI2 Plasmid Bearing the blaCTX-M-55
2.2. Extraction and Characteristic Analysis of OMVs
2.3. Detection and Quantitation of blaCTX-M-55 in OMVs
2.4. OMVs from E. coli SCAO22 Can Mediate the Transfer of blaCTX-M-55 to E. coli C600
3. Discussion
4. Materials and Methods
4.1. Strain Isolation and Antibiotic Susceptibility Testing
4.2. Whole-Genome Sequencing and Sequence Analyses
4.3. OMVs Purification
4.4. Transmission Electron Microscopy
4.5. OMVs Size and Quantity Characterization by Flow Nanoanalyzer (nFCM)
4.6. Detection of Outer Membrane Protein A
4.7. β-NADH Oxidase Activity
4.8. Detection of blaCTX-M-55
4.9. OMVs-Mediated Transfer Experiment of blaCTX-M-55
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Conflicts of Interest
References
- Johnson, T.J.; Wannemuehler, Y.; Doetkott, C.; Johnson, S.J.; Rosenberger, S.C.; Nolan, L.K. Identification of minimal predictors of Avian pathogenic Escherichia coli virulence for use as a rapid diagnostic tool. J. Clin. Microbiol. 2008, 46, 3987–3996. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ewers, C.; Li, G.; Wilking, H.; Kiessling, S.; Alt, K.; Antao, E.M.; Laturnus, C.; Diehl, I.; Glodde, S.; Homeier, T.; et al. Avian pathogenic, uropathogenic, and newborn meningitis-causing Escherichia coli: How closely related are they? Int. J. Med. Microbiol. 2007, 297, 163–176. [Google Scholar] [CrossRef] [PubMed]
- Rossolini, G.M.; D’Andrea, M.M.; Mugnaioli, C. The spread of CTX-M-type extended-spectrum beta-lactamases. Clin. Microbiol. Infect. 2008, 14 (Suppl. S1), 33–41. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Benlabidi, S.; Raddaoui, A.; Achour, W.; Hassen, B.; Torres, C.; Abbassi, M.S.; Ghrairi, T. Genetic characterization of ESBL/pAmpC-producing Escherichia coli isolated from forest, urban park and cereal culture soils. FEMS Microbiol. Ecol. 2021, 97, fiab146. [Google Scholar] [CrossRef]
- Bonnet, R. Growing group of extended-spectrum beta-lactamases: The CTX-M enzymes. Antimicrob. Agents Chemother. 2004, 48, 1–14. [Google Scholar] [CrossRef] [Green Version]
- Chotinantakul, K.; Woottisin, S.; Okada, S. The emergence of CTX-M-55 in ESBL-producing Escherichia coli from vegetables sold in local markets of northern Thailand. Jpn J. Infect. Dis. 2021, 139. [Google Scholar] [CrossRef]
- Birgy, A.; Madhi, F.; Hogan, J.; Doit, C.; Gaschignard, J.; Caseris, M.; Bidet, P.; Cohen, R.; Bonacorsi, S. CTX-M-55-, MCR-1-, and FosA-Producing Multidrug-Resistant Escherichia coli Infection in a Child in France. Antimicrob. Agents Chemother. 2018, 62, e00127-18. [Google Scholar] [CrossRef] [Green Version]
- Chenouf, N.S.; Carvalho, I.; Messai, C.R.; Ruiz-Ripa, L.; Mama, O.M.; Titouche, Y.; Zitouni, A.; Hakem, A.; Torres, C. Extended Spectrum beta-Lactamase-Producing Escherichia coli and Klebsiella pneumoniae from Broiler Liver in the Center of Algeria, with Detection of CTX-M-55 and B2/ST131-CTX-M-15 in Escherichia coli. Microb. Drug Resist. 2021, 27, 268–276. [Google Scholar] [CrossRef]
- Kiratisin, P.; Apisarnthanarak, A.; Saifon, P.; Laesripa, C.; Kitphati, R.; Mundy, L.M. The emergence of a novel ceftazidime-resistant CTX-M extended-spectrum beta-lactamase, CTX-M-55, in both community-onset and hospital-acquired infections in Thailand. Diagn. Microbiol. Infect. Dis. 2007, 58, 349–355. [Google Scholar] [CrossRef]
- Zeng, S.; Luo, J.; Li, X.; Zhuo, C.; Wu, A.; Chen, X.; Huang, L. Molecular Epidemiology and Characteristics of CTX-M-55 Extended-Spectrum beta-Lactamase-Producing Escherichia coli From Guangzhou, China. Front. Microbiol. 2021, 12, 730012. [Google Scholar] [CrossRef]
- Park, H.; Kim, J.; Ryu, S.; Jeon, B. Predominance of blaCTX-M-65 and blaCTX-M-55 in extended-spectrum beta-lactamase-producing Escherichia coli from raw retail chicken in South Korea. J. Glob. Antimicrob. Resist. 2019, 17, 216–220. [Google Scholar] [CrossRef]
- Poirel, L.; Lartigue, M.F.; Decousser, J.W.; Nordmann, P. ISEcp1B-mediated transposition of blaCTX-M in Escherichia coli. Antimicrob. Agents Chemother. 2005, 49, 447–450. [Google Scholar] [CrossRef] [Green Version]
- Cormier, A.; Zhang, P.L.C.; Chalmers, G.; Weese, J.S.; Deckert, A.; Mulvey, M.; McAllister, T.; Boerlin, P. Diversity of CTX-M-positive Escherichia coli recovered from animals in Canada. Vet. Microbiol. 2019, 231, 71–75. [Google Scholar] [CrossRef]
- Wang, J.; Zeng, Z.L.; Huang, X.Y.; Ma, Z.B.; Guo, Z.W.; Lv, L.C.; Xia, Y.B.; Zeng, L.; Song, Q.H.; Liu, J.H. Evolution and Comparative Genomics of F33:A-:B- Plasmids Carrying blaCTX-M-55 or blaCTX-M-65 in Escherichia coli and Klebsiella pneumoniae Isolated from Animals, Food Products, and Humans in China. mSphere 2018, 3, e00137-18. [Google Scholar] [CrossRef] [Green Version]
- Zhang, J.; Zheng, B.; Zhao, L.; Wei, Z.; Ji, J.; Li, L.; Xiao, Y. Nationwide high prevalence of CTX-M and an increase of CTX-M-55 in Escherichia coli isolated from patients with community-onset infections in Chinese county hospitals. BMC Infect. Dis. 2014, 14, 659. [Google Scholar] [CrossRef]
- Toyofuku, M.; Nomura, N.; Eberl, L. Types and origins of bacterial membrane vesicles. Nat. Rev. Microbiol. 2019, 17, 13–24. [Google Scholar] [CrossRef]
- Cao, Y.; Lin, H. Characterization and function of membrane vesicles in Gram-positive bacteria. Appl. Microbiol. Biotechnol. 2021, 105, 1795–1801. [Google Scholar] [CrossRef]
- Li, C.; Zhu, L.; Wang, D.; Wei, Z.; Hao, X.; Wang, Z.; Li, T.; Zhang, L.; Lu, Z.; Long, M.; et al. T6SS secretes an LPS-binding effector to recruit OMVs for exploitative competition and horizontal gene transfer. ISME J. 2022, 16, 500–510. [Google Scholar] [CrossRef]
- Faddetta, T.; Renzone, G.; Vassallo, A.; Rimini, E.; Nasillo, G.; Buscarino, G.; Agnello, S.; Licciardi, M.; Botta, L.; Scaloni, A.; et al. Streptomyces coelicolor Vesicles: Many Molecules To Be Delivered. Appl. Environ. Microbiol 2022, 88, e0188121. [Google Scholar] [CrossRef]
- Turnbull, L.; Toyofuku, M.; Hynen, A.L.; Kurosawa, M.; Pessi, G.; Petty, N.K.; Osvath, S.R.; Carcamo-Oyarce, G.; Gloag, E.S.; Shimoni, R.; et al. Explosive cell lysis as a mechanism for the biogenesis of bacterial membrane vesicles and biofilms. Nat. Commun. 2016, 7, 11220. [Google Scholar] [CrossRef] [Green Version]
- Fulsundar, S.; Harms, K.; Flaten, G.E.; Johnsen, P.J.; Chopade, B.A.; Nielsen, K.M. Gene transfer potential of outer membrane vesicles of Acinetobacter baylyi and effects of stress on vesiculation. Appl. Environ. Microbiol. 2014, 80, 3469–3483. [Google Scholar] [CrossRef] [Green Version]
- Dell’annunziata, F.; Dell’aversana, C.; Doti, N.; Donadio, G.; Dalpiaz, F.; Izzo, V.; Defilippis, A.; Galdiero, M.; Altucci, L.; Boccia, G.; et al. Outer Membrane Vesicles Derived from Klebsiella pneumoniae Are a Driving Force for Horizontal Gene Transfer. Int. J. Mol. Sci. 2021, 22, 8732. [Google Scholar] [CrossRef]
- Bielaszewska, M.; Daniel, O.; Karch, H.; Mellmann, A. Dissemination of the blaCTX-M-15 gene among Enterobacteriaceae via outer membrane vesicles. J. Antimicrob. Chemother. 2020, 75, 2442–2451. [Google Scholar] [CrossRef]
- Guerrero-mandujano, A.; Hernandez-cortez, C.; Ibarra, J.A.; Castro-escarpulli, G. The outer membrane vesicles: Secretion system type zero. Traffic 2017, 18, 425–432. [Google Scholar] [CrossRef] [Green Version]
- Haurat, M.F.; Elhenawy, W.; Feldman, M.F. Prokaryotic membrane vesicles: New insights on biogenesis and biological roles. Biol. Chem. 2015, 396, 95–109. [Google Scholar] [CrossRef]
- Kulp, A.; Kuehn, M.J. Biological functions and biogenesis of secreted bacterial outer membrane vesicles. Annu. Rev. Microbiol. 2010, 64, 163–184. [Google Scholar] [CrossRef] [Green Version]
- Aktar, S.; Okamoto, Y.; Ueno, S.; Tahara, Y.O.; Imaizumi, M.; Shintani, M.; Miyata, M.; Futamata, H.; Nojiri, H.; Tashiro, Y. Incorporation of Plasmid DNA Into Bacterial Membrane Vesicles by Peptidoglycan Defects in Escherichia coli. Front. Microbiol. 2021, 12, 747606. [Google Scholar] [CrossRef]
- Andreoni, F.; Toyofuku, M.; Menzi, C.; Kalawong, R.; Mairpady Shambat, S.; Francois, P.; Zinkernagel, A.S.; Eberl, L. Antibiotics Stimulate Formation of Vesicles in Staphylococcus aureus in both Phage-Dependent and -Independent Fashions and via Different Routes. Antimicrob. Agents Chemother. 2019, 63, e01439-18. [Google Scholar] [CrossRef] [Green Version]
- Gupta, C.L.; Blum, S.E.; Kattusamy, K.; Daniel, T.; Druyan, S.; Shapira, R.; Krifucks, O.; Zhu, Y.G.; Zhou, X.Y.; Su, J.Q.; et al. Longitudinal study on the effects of growth-promoting and therapeutic antibiotics on the dynamics of chicken cloacal and litter microbiomes and resistomes. Microbiome 2021, 9, 178. [Google Scholar] [CrossRef]
- Bortolaia, V.; Kaas, R.S.; Ruppe, E.; Roberts, M.C.; Schwarz, S.; Cattoir, V.; Philippon, A.; Allesoe, R.L.; Rebelo, A.R.; Florensa, A.F.; et al. ResFinder 4.0 for predictions of phenotypes from genotypes. J. Antimicrob. Chemother. 2020, 75, 3491–3500. [Google Scholar] [CrossRef]
- Camacho, C.; Coulouris, G.; Avagyan, V.; Ma, N.; Papadopoulos, J.; Bealer, K.; Madden, T.L. BLAST+: Architecture and applications. BMC Bioinform. 2009, 10, 421. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Carattoli, A.; Zankari, E.; Garcia-Fernandez, A.; Voldby Larsen, M.; Lund, O.; Villa, L.; Moller Aarestrup, F.; Hasman, H. In silico detection and typing of plasmids using PlasmidFinder and plasmid multilocus sequence typing. Antimicrob. Agents Chemother. 2014, 58, 3895–3903. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Arab, T.; Mallick, E.R.; Huang, Y.; Dong, L.; Liao, Z.; Zhao, Z.; Gololobova, O.; Smith, B.; Haughey, N.J.; Pienta, K.J.; et al. Characterization of extracellular vesicles and synthetic nanoparticles with four orthogonal single-particle analysis platforms. J. Extracell. Vesicles 2021, 10, e12079. [Google Scholar] [CrossRef] [PubMed]
- Tian, Y.; Gong, M.; Hu, Y.; Liu, H.; Zhang, W.; Zhang, M.; Hu, X.; Aubert, D.; Zhu, S.; Wu, L.; et al. Quality and efficiency assessment of six extracellular vesicle isolation methods by nano-flow cytometry. J. Extracell. Vesicles 2020, 9, 1697028. [Google Scholar] [CrossRef]
Primer | Sequence (5′-3′) | Size (bp) |
---|---|---|
ctx-m-55f | ATGGTTAAAAAATCACTGCGCCAGT | 25 |
ctx-m-55r | TTACAAACCGTCGGTGACGAT | 21 |
Qblactx-m-55F | AACCGTCACGCTGTTGTTAGGAAG | 24 |
Qblactx-m-55R | AATCAATGCCACACCCAGTCTGC | 23 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, C.; Wen, R.; Mu, R.; Chen, X.; Ma, P.; Gu, K.; Huang, Z.; Ju, Z.; Lei, C.; Tang, Y.; et al. Outer Membrane Vesicles of Avian PathogenicEscherichia coli Mediate the Horizontal Transmission of blaCTX-M-55. Pathogens 2022, 11, 481. https://doi.org/10.3390/pathogens11040481
Li C, Wen R, Mu R, Chen X, Ma P, Gu K, Huang Z, Ju Z, Lei C, Tang Y, et al. Outer Membrane Vesicles of Avian PathogenicEscherichia coli Mediate the Horizontal Transmission of blaCTX-M-55. Pathogens. 2022; 11(4):481. https://doi.org/10.3390/pathogens11040481
Chicago/Turabian StyleLi, Chao, Renqiao Wen, Rongrong Mu, Xuan Chen, Peng Ma, Kui Gu, Zheren Huang, Zijing Ju, Changwei Lei, Yizhi Tang, and et al. 2022. "Outer Membrane Vesicles of Avian PathogenicEscherichia coli Mediate the Horizontal Transmission of blaCTX-M-55" Pathogens 11, no. 4: 481. https://doi.org/10.3390/pathogens11040481