MicroRNA Let-7d-3p Contributes to Cardiac Protection via Targeting HMGA2
Abstract
:1. Introduction
2. Results
2.1. Protective Effect of Let-7d-3p in H9c2 and NRVM during Hypoxia Challenge
2.2. The Protective Effect of Let-7d-3p Is Mediated via Apoptosis but Not Autophagy
2.3. Let-7d-3p Target Gene Prediction and Validation
2.4. Let-7d-3p Inhibits Apoptosis through Targeting HMGA2 and YY1
3. Discussion
4. Materials and Methods
4.1. H9c2, NRVM Isolation and Culture
4.2. miRNA Transfection
4.3. Hypoxia Protocol
4.4. Assessment of Cell Injury and Viability
4.5. Assesment of Apoptosis and Autophagy
4.6. Luciferase Assay
4.7. Real-time Quantitative PCR (RT-qPCR) Analysis
4.8. Western Blot
4.9. Statistics
Author Contributions
Funding
Conflicts of Interest
References
- Adachi, T.; Nakanishi, M.; Otsuka, Y.; Nishimura, K.; Hirokawa, G.; Goto, Y.; Nonogi, H.; Iwai, N. Plasma microRNA 499 as a biomarker of acute myocardial infarction. Clin. Chem. 2010, 56, 1183–1185. [Google Scholar] [CrossRef]
- Liu, G.; Niu, X.; Meng, X.; Zhang, Z. Sensitive miRNA markers for the detection and management of NSTEMI acute myocardial infarction patients. J. Thorac. Dis. 2018, 10, 3206–3215. [Google Scholar] [CrossRef]
- Montgomery, R.L.; Hullinger, T.G.; Semus, H.M.; Dickinson, B.A.; Seto, A.G.; Lynch, J.M.; Stack, C.; Latimer, P.A.; Olson, E.N.; van Rooij, E. Therapeutic inhibition of miR-208a improves cardiac function and survival during heart failure. Circulation 2011, 124, 1537–1547. [Google Scholar] [CrossRef]
- Wang, J.X.; Jiao, J.Q.; Li, Q.; Long, B.; Wang, K.; Liu, J.P.; Li, Y.R.; Li, P.F. miR-499 regulates mitochondrial dynamics by targeting calcineurin and dynamin-related protein-1. Nat. Med. 2011, 17, 71–78. [Google Scholar] [CrossRef]
- Wong, L.L.; Zou, R.; Zhou, L.; Lim, J.Y.; Phua, D.C.Y.; Liu, C.; Chong, J.P.C.; Ng, J.Y.X.; Liew, O.W.; Chang, S.P.; et al. Combining circulating microRNA and NT-proBNP to detect and categorize heart failure subtype. J. Am. Coll. Cardiol. 2019, 73, 1300–1313. [Google Scholar] [CrossRef]
- Zhou, Y.; Deng, L.; Zhao, D.; Chen, L.; Yao, Z.; Guo, X.; Liu, X.; Lv, L.; Leng, B.; Xu, W.; et al. MicroRNA-503 promotes angiotensin II-induced cardiac fibrosis by targeting Apelin-13. J. Cell. Mol. Med. 2016, 20, 495–505. [Google Scholar] [CrossRef] [PubMed]
- He, F.; Lv, P.; Zhao, X.; Wang, X.; Ma, X.; Meng, W.; Meng, X.; Dong, S. Predictive value of circulating miR-328 and miR-134 for acute myocardial infarction. Mol. Cell. Biochem. 2014, 394, 137–144. [Google Scholar] [CrossRef]
- Wang, K.; An, T.; Zhou, L.Y.; Liu, C.Y.; Zhang, X.J.; Feng, C.; Li, P.F. E2F1-regulated miR-30b suppresses Cyclophilin D and protects heart from ischemia/reperfusion injury and necrotic cell death. Cell Death Differ. 2015, 22, 743–754. [Google Scholar] [CrossRef] [PubMed]
- Liang, H.; Pan, Z.; Zhao, X.; Liu, L.; Sun, J.; Su, X.; Xu, C.; Zhou, Y.; Zhao, D.; Xu, B.; et al. LncRNA PFL contributes to cardiac fibrosis by acting as a competing endogenous RNA of let-7d. Theranostics 2018, 8, 1180–1194. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Reinhart, B.J.; Slack, F.J.; Basson, M.; Pasquinelli, A.E.; Bettinger, J.C.; Rougvie, A.E.; Horvitz, H.R.; Ruvkun, G. The 21-nucleotide let-7 RNA regulates developmental timing in Caenorhabditis elegans. Nature 2000, 403, 901–906. [Google Scholar] [CrossRef]
- Pasquinelli, A.E.; Reinhart, B.J.; Slack, F.; Martindale, M.Q.; Kuroda, M.I.; Maller, B.; Hayward, D.C.; Ball, E.E.; Degnan, B.; Muller, P.; et al. Conservation of the sequence and temporal expression of let-7 heterochronic regulatory RNA. Nature 2000, 408, 86–89. [Google Scholar] [CrossRef] [PubMed]
- Roush, S.; Slack, F.J. The let-7 family of microRNAs. Trends Cell Biol. 2008, 18, 505–516. [Google Scholar] [CrossRef] [PubMed]
- Bao, M.H.; Feng, X.; Zhang, Y.W.; Lou, X.Y.; Cheng, Y.; Zhou, H.H. Let-7 in cardiovascular diseases, heart development and cardiovascular differentiation from stem cells. Int. J. Mol. Sci. 2013, 14, 23086–23102. [Google Scholar] [CrossRef] [PubMed]
- Tolonen, A.M.; Magga, J.; Szabo, Z.; Viitala, P.; Gao, E.; Moilanen, A.M.; Ohukainen, P.; Vainio, L.; Koch, W.J.; Kerkela, R.; et al. Inhibition of Let-7 microRNA attenuates myocardial remodeling and improves cardiac function postinfarction in mice. Pharmacol. Res. Perspect. 2014, 2, e00056. [Google Scholar] [CrossRef] [PubMed]
- Joshi, S.; Wei, J.; Bishopric, N.H. A cardiac myocyte-restricted Lin28/let-7 regulatory axis promotes hypoxia-mediated apoptosis by inducing the AKT signaling suppressor PIK3IP1. Biochim. Biophys. Acta 2016, 1862, 240–251. [Google Scholar] [CrossRef]
- Brennan, E.; Wang, B.; McClelland, A.; Mohan, M.; Marai, M.; Beuscart, O.; Derouiche, S.; Gray, S.; Pickering, R.; Tikellis, C.; et al. Protective Effect of let-7 miRNA Family in Regulating Inflammation in Diabetes-Associated Atherosclerosis. Diabetes 2017, 66, 2266–2277. [Google Scholar] [CrossRef]
- Krijnen, P.A.; Nijmeijer, R.; Meijer, C.J.; Visser, C.A.; Hack, C.E.; Niessen, H.W. Apoptosis in myocardial ischaemia and infarction. J. Clin. Pathol. 2002, 55, 801–811. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Teringova, E.; Tousek, P. Apoptosis in ischemic heart disease. J. Transl. Med. 2017, 15, 87. [Google Scholar] [CrossRef] [PubMed]
- Saito, T.; Nah, J.; Oka, S.I.; Mukai, R.; Monden, Y.; Maejima, Y.; Ikeda, Y.; Sciarretta, S.; Liu, T.; Li, H.; et al. An alternative mitophagy pathway mediated by Rab9 protects the heart against ischemia. J. Clin. Investig. 2019, 129, 802–819. [Google Scholar] [CrossRef] [PubMed]
- Matsui, Y.; Takagi, H.; Qu, X.; Abdellatif, M.; Sakoda, H.; Asano, T.; Levine, B.; Sadoshima, J. Distinct roles of autophagy in the heart during ischemia and reperfusion: Roles of AMP-activated protein kinase and Beclin 1 in mediating autophagy. Circ. Res. 2007, 100, 914–922. [Google Scholar] [CrossRef]
- Hickson-Bick, D.L.; Jones, C.; Buja, L.M. Stimulation of mitochondrial biogenesis and autophagy by lipopolysaccharide in the neonatal rat cardiomyocyte protects against programmed cell death. J. Mol. Cell. Cardiol. 2008, 44, 411–418. [Google Scholar] [CrossRef] [PubMed]
- Gustafsson, A.B.; Gottlieb, R.A. Recycle or die: The role of autophagy in cardioprotection. J. Mol. Cell. Cardiol. 2008, 44, 654–661. [Google Scholar] [CrossRef]
- Sciarretta, S.; Hariharan, N.; Monden, Y.; Zablocki, D.; Sadoshima, J. Is autophagy in response to ischemia and reperfusion protective or detrimental for the heart? Pediatric Cardiol. 2011, 32, 275–281. [Google Scholar] [CrossRef]
- Sun, T.; Li, M.Y.; Li, P.F.; Cao, J.M. MicroRNAs in Cardiac Autophagy: Small Molecules and Big Role. Cells 2018, 7, 104. [Google Scholar] [CrossRef] [PubMed]
- Chen, Q.; Zhou, Y.; Richards, A.M.; Wang, P. Up-regulation of miRNA-221 inhibits hypoxia/reoxygenation-induced autophagy through the DDIT4/mTORC1 and Tp53inp1/p62 pathways. Biochem. Biophys. Res. Commun. 2016, 474, 168–174. [Google Scholar] [CrossRef]
- Gao, Y.H.; Qian, J.Y.; Chen, Z.W.; Fu, M.Q.; Xu, J.F.; Xia, Y.; Ding, X.F.; Yang, X.D.; Cao, Y.Y.; Zou, Y.Z.; et al. Suppression of Bim by microRNA-19a may protect cardiomyocytes against hypoxia-induced cell death via autophagy activation. Toxicol. Lett. 2016, 257, 72–83. [Google Scholar] [CrossRef]
- Monzen, K.; Ito, Y.; Naito, A.T.; Kasai, H.; Hiroi, Y.; Hayashi, D.; Shiojima, I.; Yamazaki, T.; Miyazono, K.; Asashima, M.; et al. A crucial role of a high mobility group protein HMGA2 in cardiogenesis. Nat. Cell Boil. 2008, 10, 567–574. [Google Scholar] [CrossRef] [PubMed]
- Shi, X.; Tian, B.; Ma, W.; Zhang, N.; Qiao, Y.; Li, X.; Zhang, Y.; Huang, B.; Lu, J. A novel anti-proliferative role of HMGA2 in induction of apoptosis through caspase 2 in primary human fibroblast cells. Biosci. Rep. 2015, 35, e00169. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Y.; Chen, Q.; Lew, K.S.; Richards, A.M.; Wang, P. Discovery of Potential Therapeutic miRNA Targets in Cardiac Ischemia-Reperfusion Injury. J. Cardiovasc. Pharmacol. Ther. 2016, 21, 296–309. [Google Scholar] [CrossRef]
- Zhang, Z.; Li, H.; Chen, S.; Li, Y.; Cui, Z.; Ma, J. Knockdown of MicroRNA-122 Protects H9c2 Cardiomyocytes from Hypoxia-Induced Apoptosis and Promotes Autophagy. Med. Sci. Monit 2017, 23, 4284–4290. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhou, Y.; Shiok, T.C.; Richards, A.M.; Wang, P. MicroRNA-101a suppresses fibrotic programming in isolated cardiac fibroblasts and in vivo fibrosis following trans-aortic constriction. J. Mol. Cell. Cardiol. 2018, 121, 266–276. [Google Scholar] [CrossRef] [PubMed]
- Garcia-Vazquez, R.; Gallardo Rincon, D.; Ruiz-Garcia, E.; Meneses Garcia, A.; Hernandez De La Cruz, O.N.; Astudillo-De La Vega, H.; Isla-Ortiz, D.; Marchat, L.A.; Salinas-Vera, Y.M.; Carlos-Reyes, A.; et al. Let-7d-3p is associated with apoptosis and response to neoadjuvant chemotherapy in ovarian cancer. Oncol. Rep. 2018, 39, 3086–3094. [Google Scholar] [PubMed]
- Jiao, Y.; Bishop, C.E.; Lu, B. Mex3c regulates insulin-like growth factor 1 (IGF1) expression and promotes postnatal growth. Mol. Biol. Cell 2012, 23, 1404–1413. [Google Scholar] [CrossRef] [Green Version]
- Jiao, Y.; George, S.K.; Zhao, Q.; Hulver, M.W.; Hutson, S.M.; Bishop, C.E.; Lu, B. Mex3c mutation reduces adiposity and increases energy expenditure. Mol. Cell. Boil. 2012, 32, 4350–4362. [Google Scholar] [CrossRef] [PubMed]
- Wang, G.Z.; Goff, S.P. Regulation of Yin Yang 1 by Tyrosine Phosphorylation. J. Boil. Chem. 2015, 290, 21890–21900. [Google Scholar] [CrossRef]
- Stauffer, B.L.; Dockstader, K.; Russell, G.; Hijmans, J.; Walker, L.; Cecil, M.; Demos-Davies, K.; Medway, A.; McKinsey, T.A.; Sucharov, C.C. Transgenic over-expression of YY1 induces pathologic cardiac hypertrophy in a sex-specific manner. Biochem. Biophys. Res. Commun. 2015, 462, 131–137. [Google Scholar] [CrossRef] [Green Version]
- Gordon, S.; Akopyan, G.; Garban, H.; Bonavida, B. Transcription factor YY1: Structure, function, and therapeutic implications in cancer biology. Oncogene 2006, 25, 1125–1142. [Google Scholar] [CrossRef]
- Gronroos, E.; Terentiev, A.A.; Punga, T.; Ericsson, J. YY1 inhibits the activation of the p53 tumor suppressor in response to genotoxic stress. Proc. Natl. Acad. Sci. USA 2004, 101, 12165–12170. [Google Scholar] [CrossRef] [Green Version]
- Wu, S.; Kasim, V.; Kano, M.R.; Tanaka, S.; Ohba, S.; Miura, Y.; Miyata, K.; Liu, X.; Matsuhashi, A.; Chung, U.I.; et al. Transcription factor YY1 contributes to tumor growth by stabilizing hypoxia factor HIF-1alpha in a p53-independent manner. Cancer Res. 2013, 73, 1787–1799. [Google Scholar] [CrossRef]
- Young, A.R.; Narita, M. Oncogenic HMGA2: Short or small? Genes Dev. 2007, 21, 1005–1009. [Google Scholar] [CrossRef] [PubMed]
- Moore, J.K.; Haber, J.E. Cell cycle and genetic requirements of two pathways of nonhomologous end-joining repair of double-strand breaks in Saccharomyces cerevisiae. Mol. Cell. Biol. 1996, 16, 2164–2173. [Google Scholar] [CrossRef] [PubMed]
- Li, A.Y.; Boo, L.M.; Wang, S.Y.; Lin, H.H.; Wang, C.C.; Yen, Y.; Chen, B.P.; Chen, D.J.; Ann, D.K. Suppression of nonhomologous end joining repair by overexpression of HMGA2. Cancer Res. 2009, 69, 5699–5706. [Google Scholar] [CrossRef] [PubMed]
- Mayr, C.; Hemann, M.T.; Bartel, D.P. Disrupting the pairing between let-7 and Hmga2 enhances oncogenic transformation. Science 2007, 315, 1576–1579. [Google Scholar] [CrossRef] [PubMed]
Name | Human Sequence | Rat Sequence |
---|---|---|
Let-7d-3p | CUAUACGACCUGCUGCCUUUCU | CUAUACGACCUGCUGCCUUUCU |
miR-503-5p | UAGCAGCGGGAACAGUUCUGCAG | UAGCAGCGGGAACAGUACUGCAG |
miR-134-5p | UGUGACUGGUUGACCAGAGGGG | UGUGACUGGUUGACCAGAGGGG |
miR-374b-5p | AUAUAAUACAACCUGCUAAGUG | AUAUAAUACAACCUGCUAAGUG |
miR-30b-5p | UGUAAACAUCCUACACUCAGCU | UGUAAACAUCCUACACUCAGCU |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wong, L.L.; Saw, E.L.; Lim, J.Y.; Zhou, Y.; Richards, A.M.; Wang, P. MicroRNA Let-7d-3p Contributes to Cardiac Protection via Targeting HMGA2. Int. J. Mol. Sci. 2019, 20, 1522. https://doi.org/10.3390/ijms20071522
Wong LL, Saw EL, Lim JY, Zhou Y, Richards AM, Wang P. MicroRNA Let-7d-3p Contributes to Cardiac Protection via Targeting HMGA2. International Journal of Molecular Sciences. 2019; 20(7):1522. https://doi.org/10.3390/ijms20071522
Chicago/Turabian StyleWong, Lee Lee, Eng Leng Saw, Jia Yuen Lim, Yue Zhou, Arthur Mark Richards, and Peipei Wang. 2019. "MicroRNA Let-7d-3p Contributes to Cardiac Protection via Targeting HMGA2" International Journal of Molecular Sciences 20, no. 7: 1522. https://doi.org/10.3390/ijms20071522