Ethics statement
Animal experiments were followed by the Animal ethic committee of Beijing Anzhen Hospital, Capital Medical University.
Experimental animals
Male Sprague-Dawley rats (6–7 weeks old, 230 ± 20 g) were provided by the Department of Cardiology, Beijing Anzhen Hospital, Capital Medical University. All rats were housed under controlled conditions (60% humidity, 22°C and 12-h light/dark alternate) and supplied with enough foodstuff.
Rat modeling and treatments
After anesthesia by intraperitoneal injection with pentobarbital sodium (30 mg/kg), rats were subjected to ligation of left anterior descending coronary artery (LAD). The chest was opened in the fourth left intercostal space, and the LAD was sutured with 6 − 0 silk suture 1 mm below the tip of the left atrial appendage. The success of the ligation was confirmed by the color change of the myocardium. After 28 d, the rats were euthanized, and the myocardial tissue and blood samples were stored at -80°C.
Forty-eight hours before surgery, the adeno-associated virus 9 (AAV9) carrying miR-322-5p agomir/antagomir, overexpression (oe)-BTG2, or the corresponding negative control (Hanbio, Shanghai, China) was injected into rats (n = 10 per treatment) through the tail vein at 2 × 1011 vg. Sham-operated rats were not treated with ligation of LAD [15, 16].
Echocardiography
Rats were given intraperitoneal injection with ketamine at 100 mg/kg for anesthesia. Ejection fraction (EF) was impaired, left ventricular end diastolic diameter(LVIDd) and left ventricular end systolic diameter (LVIDs) were tested using an Acuson Sequoia 256c ultrasound system equipped with a 13MHz linear transducer from Vevo 2100 echocardiography (VisualSonics, Canada) [17, 18].
Enzyme-linked immunosorbent assay (ELISA)
With the ELISA kit (E-EL-R0015c, E-EL-R0012c and E-EL-R2856c; Elabscience Biotechnology, Wuhan, China), the levels of inflammatory factors interleukin (IL)-6, IL-1β and tumor necrosis factor-α (TNF-α) in myocardial tissues were measured. The absorbance at 450 nm on a Labserv K3 Touch microplate reader (Thermo Fisher Scientific, MA, USA) was recorded [15, 19].
Detection of myocardial injury markers
Myocardial tissues were homogenized with lysis buffer containing protease inhibitor, centrifuged at 14,000 × g, and the supernatant was amassed to test creatine kinase-MB (CK-MB), lactate dehydrogenase (LDH) and cardiac troponin I (cTnI) by ELISA kits (E-EL-H1434c, E-EL-R0338c and E-EL-R1253c; Elabscience Biotechnology) [15].
Hematoxylin-eosin (H&E) staining
Myocardial tissues were fixed in 4% formaldehyde overnight, followed by dehydration, permeabilization and paraffin embedding. Then, the tissue samples (5 µm) were deparaffinized in xylene, rehydrated in gradient ethanol, and stained with hematoxylin and eosin. The histopathological changes were observed under an optical microscope [19, 20].
Masson staining
Paraffin-embedded myocardial tissues were stained using the Masson Tricolor Staining Kit (BA4079B, Baso, China). The samples were viewed under a M205 stereo microscope (Leica, Germany) and analyzed the image-Pro Plus 6.0 software. The fibrotic area was dyed blue, and the normal area was dyed red [21].
Transferase-mediated deoxyuridine triphosphate-biotin nick end labeling (TUNEL) staining
Myocardial tissues were deparaffinized and exposed to 3% H2O2. After that, the sample was digested with pepsin and combined with TUNEL reaction mixture. Subsequently, the sample was oxidized with hematoxylin, and the number of apoptotic cells (TUNEL-positive cells) was evaluated by an optical microscope [16].
Reverse transcription quantitative polymerase chain reaction (RT-qPCR)
After the total RNA in myocardial tissues was obtained through Trizol reagent (Invitrogen, CA, USA), for miRNA, cDNA was synthesized using Taqman MicroRNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA) and amplified using TaqMan Micro Assay Mix; for BTG2, cDNA was collected using a reverse transcription kit (Invitrogen) and processed by Sybr Premix EX TAQ II (Takara, Dalian, China). Gene levels were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) or U6, and calculated by the 2−ΔΔCt method. Table 1 shows the primer sequences [18].
Table 1
Genes | Primer sequences (5’-3’) |
miR-322-5p | F: AAACGGCTACCACATCCAAG |
| R: CCTCCAATGGATCCTCGTTA |
BTG2 | F: GCGCGGGCTCTTCCTCTTTG |
| R: AAGGAAGGCTGGAAGAGTGC |
GAPDH | F: CGGAGTCAACGGATTTGGTCGTAT |
| R: AGCCTTCTCCATGGTGGTGAAGAC |
U6 | F: CTCGCTTCGGCAGCACA |
| R: AACGCTTCACGAATTTGCGT |
Note: F, forward; R, reverse; miR-322-5p, microRNA-322-5p; BTG2, B-cell translocation gene 2; GAPDH, glyceraldehyde-3-phosphate dehydrogenase. |
Western blot assay
Protein samples were extracted from myocardial tissues using radio-immunoprecipitation assay lysis buffer (Beyotime, Shangha, China) containing 0.1 mmol/L phenylmethylsulfonyl fluoride. Then, the sample was isolated by 10% sodium lauryl sulfate polyacrylamide gel electrophoresis, electro-blotted on polyvinylidene fluoride membrane (Millipore, MA, USA) and sealed with 5% skim milk in Tris-HCl buffered saline. The membrane was supplemented with primary antibodies BTG2 (1:800, Abcam, MA, USA), IkappaB kinase α (IKKα), p-IKKα, IkappaB kinase β (IKKβ), p-IKKβ and GAPDH (1:1000, Abcam) for incubation overnight, and with the corresponding secondary antibody (1:5000, Abcam) for 120 min. After development, the protein bands were observed [21].
Dual luciferase reporter gene assay
On the bioinformatics website (http://www.targetscan.org), the binding site of miR-322-5p and BTG2 was estimated. Dual luciferase reporter gene experiment was carried out. The corresponding sequence was inserted into the luciferase reporter vector pGL3 (Promega, WI, USA) to construct BTG2-wld type (WT) and BTG2-mutant (MUT). The constructed vector was co-transfected with miR-322-5p agomir or miR-322-5p NC into HEK293T cells for 48 h. The dual luciferase assay system (Promega) was used for detection of luciferase activity [18].
RNA immunoprecipitation (RIP) assay
RIP assay was performed using Magna RIP™ kit (Millipore). HEK293T cells were lysed with RIP buffer, and then incubated with RIP buffer containing Ago2 (1:1000, ab5072, Abcam) and IgG (1:200, sc-2025, Santa Cruz Biotechnology, CA, USA) conjugated magnetic beads. After interacting with proteinase K, the immunoprecipitated RNA was analyzed by RT-qPCR [22].
Statistical analysis
SPSS 21.0 (IBM, NY, USA) was adopted to statistical analysis. Measurement data were expressed as mean ± standard deviation and followed a normal distribution. Two sets of data were evaluated by independent samples t test, multi-sets of data by one-way analysis of variance (ANOVA) and Tukey's post-hoc test. Repeated measures ANOVA evaluated data comparison at different time points, followed by Bonferroni post-hoc test. At P < 0.05, statistically significance was established.