2.1 Mice
Male specific pathogen-free (SPF) C57BL/6 mice (6–8 weeks old, 18–20 g weight, n = 10/each group) were purchased from the Laboratory Center of Nanjing University (Jiangsu, China). All the mice were kept in the Nanjing Medical University Animal Care Facilities and were raised in clean cages under SPF environment with a 12 h light-dark cycle. The mice were given one-week period of adaptation prior to the experiment. All experimental procedures were approved by the Experimental Animal Ethics Committee of Nanjing Medical University (Ethics number: IACUC-1901005).
2.2 Culturing of DCs derived from bone marrow progenitors
As previously described (17), bone marrow DCs (BMDCs) were generated from the murine bone marrow (BM). Briefly, the BM cells were flushed with RPMI1640 medium (Gibco) and passed through a 40 µm nylon mesh to remove pieces of bone and debris as well as the erythrocytes. Further, the BM cells were cultured in RPMI 1640 medium containing 1% penicillin-streptomycin (NCM Biotech, C125C8) supplemented with 10% fetal bovine serum (FBS, Biological Industries, 04-001-0A), 20 ng/ml granulocyte-macrophage colony-stimulating factor (GM-CSF, 315-03), and 10 ng/ml murine recombinant c (IL-4, Peprotech, 214 − 14). The medium containing fresh cytokines was added to the cells every three days. On Day-6, the BMDCs were purified using magnetic anti-CD11c beads (Stem cell, 18780A). The purified DCs were treated with 100 nM FICZ or dimethyl sulfoxide (DMSO) (< 0.1%) as vehicle control for 12 h and then activated with 100 ng/ml lipopolysaccharide (LPS, Sigma-Aldrich) for another 24 h.
2.3 Scanning electron microscopy
The treated (with DMSO or FICZ) and untreated (control) DCs were fixed in 2.5% glutaraldehyde, dehydrated in ethanol, and critical point dried including fixation and dehydration, transferring from pure acetone to the intermediate solution isoamyl acetate, then replacing isoamyl acetate with liquid carbon dioxide for the samples. The samples were then mounted on aluminum stubs and coated with gold by a sputtering device (Emitech, Ashford, GB). The final cell specimens were observed using a JSM 6700F scanning electron microscope (Jeol, Peabody, MA) at 2.5 kV.
2.4 T cell proliferation experiment
The CD4+ T cells were isolated from the spleen of male C57BL/6 mice (6–8 weeks, 18–20 g) by using a T cell isolation kit (BD Biosciences, Catalog: 551539) and labeled with carboxyfluorescein diacetate succinimidyl ester (CFSE, 2.5 µM; Invitrogen, Catalog: C34570). The labeled CD4+ T cells were washed twice with RPMI 1640 complete medium and subsequently co-cultured with The treated (with DMSO or FICZ) and untreated (control) DCs. DCs and CD4+ T cells were co-cultured at a 1:10 ratio for 72 h (stimulator cells: responder cells = 1:10) by adding 2 µg/ml anti-CD3. The proliferation of CD4+ T cells was then analyzed by flow cytometry.
2.5 Flow cytometry
The DCs were stained with fluorescent-labeled antibodies against CD11c, CD80, CD83, CD86, MHC-II, or isotype-matched controls (BioLegend, San Diego, CA, USA). Briefly, the cells were incubated with the antibodies for 30 min at 4˚C and subsequently washed with PBS containing 1% FBS. The mature markers CD11c, CD80, CD83, CD86, MHC-II of DCs were analyzed. For Th17 cell analysis, the cells were stimulated with phorbol 12-myristate 13-acetate (PMA, 50 ng/mL, Sigma, P8139) and ionomycin (1 µM, Sigma, Catalog: I3909) in the presence of GolgiPlug (BD, 555029 ) for 4 h to detect IL-17A. For intracellular staining, the cell surface staining was performed by incubating the cells with FITC-conjugated anti-CD4 (Invitrogen, 11-0042-82) and APC-conjugated anti-CD25 (Invitrogen, 17-0251-81). Further, the cells were fixed, permeabilized, and stained with PE-conjugated anti-Foxp3 (Invitrogen, 12-5773-82) or PE-conjugated anti-IL-17A (Invitrogen, 12-7177-81) using a Transcription Factor Fixation/Permeabilization Kit (eBioscience, 00-5123). All data were analyzed using FlowJo software (Treestar, Ashland, OR, USA) (18).
2.6 T cell differentiation
CD4+ T cells were purified from the spleens and lymph nodes of male C57BL/c mice using a CD4+ T cell isolation kit (BD Biosciences, 551539) by positive selection according to the manufacturer’s instructions. The cells were then stimulated with 2 µg/mL anti-CD3 (eBioscience, 16-0031-85) and cocultured with 2ⅹ104 DCs for five days. To induce Treg polarization, IL-2 (100 U/ml) and TGF-β1(5 ng/ml) were added to the culture medium (19), and the cells cultured under the polarization conditions were harvested and analyzed by flow cytometry.
2.7 Enzyme-linked immunosorbent assay (ELISA)
Cytokines (IL-1β, IL-12, IL-23, IL-22, TGF-β, and IL-10) in culture medium were determined by enzyme-linked immunosorbent assay (ELISA) using specific kits according according to the manufacturer's instructions. All the ELISA kits were purchase from Neobioscience Technology Co., Ltd., China.
2.8 Western blotting
The cells were washed twice with PBS and then lysed in RIPA Lysis Buffer (Beyotime, China) supplemented with a protease inhibitor cocktail (Medchem Express, Nanjing, China). The protein concentrations were determined using an Enhanced BCA Protein Assay Kit (Beyotime, China). Quantitative protein samples (30 µg/lane) were separated on 10% sodium dodecyl sulfate-polyacrylamide gels and transferred to PVDF membranes. After blocking with 5% nonfat milk, the membranes were incubated overnight with anti-CYP1A1 antibody (Proteintech Group, Inc., 1:1000, 13241-1-AP), anti-FOXP3 antibody (Abcam,1:1000, ab54501), and anti-GAPDH antibody (Bioworld Technology, Inc., 1:10000, AP0063) at 4˚C. Following incubation with horseradish peroxidase-conjugated goat anti‑rabbit antibodies (Bioworld Technology, Inc., 1:10000, BS13278), protein blotting was visualized using an Enhanced Chemiluminescence (Life Technologies, Carlsbad, USA). Data ware analyzed using Image-Lab 6.0.1 software (Bio-Rad).
2.9 Real-time quantitative polymerase chain reaction (RT-qPCR)
RNA was isolated using TRIzol® reagent (Life Technology) and purified using a gDNA wiper kit. cDNA was synthesized by reverse transcription from 1 µg RNA using a HiScript® II Q RT SuperMix, and RT-qPCR was performed on an ABI 7300 Real-Time PCR System (Thermo Scientific) via ChamQ Universal SYBR qPCR Master Mix. All reagents were obtained from Vazyme Biotech Co., Ltd. The primers for the related genes were designed and synthesized by Qingke Biotechnology Co., Ltd. In the present study, the following primers were used (mouse): IL-1β forward 5-AAGGGGACATTAGGCAGCAC-3 and reverse 5-ATGAAAGACCTCAGTGCGGG-3; IL-12 forward 5- GGGACCAGGCCCTATTATGC − 3 and reverse 5- TTGCATCCATTTGTGTGGCG − 3; IL-23 forward 5-AAATAATGTGCCCCGTATCCAG-3 and reverse 5-GAAGATGTCAGAGTCAAGCAGGTG-3; IL-22 forward 5-ATGAGTTTTTCCCTTATGGGGAC-3 and reverse 5- GCTGGAAGTTGGACACCTCAA-3; TGF-β forward 5- CAATTCCTGGCGTTACCTTG-3 and reverse 5-AGCCCTGTATTCCGTCTCCT-3; IL-10 forward 5-GCTCTTACTGACTGGCATGAG-3′ and reverse 5-CGCAGCTCTAGGAGCATGTG-3; GAPDH forward: 5-AGGTCGGTGTGAACGGATTTG-3 and reverse 5-TGTAGACCATGTAGTTGAGGTCA-3′. The relative gene expression was determined using 2−△△CT, and the housekeeping gene GAPDH was used as a reference control.
2.10 Induction of experimental colitis by TNBS
Experimental colitis was induced using TNBS according to a previously described protocol (20, 21). Briefly, C57BL/c mice were fasted, with free access to 5% glucose water, for 24 h before administering the enema, and were then randomly assigned to five groups (n = 8/per group). Mice were lightly anesthetized by inhalation of low-dose ether. TNBS was diluted to 50% with an equal volume of 100% ethanol. In the TNBS group, each mouse was treated with 100 µl 50% TNBS by slighting inserting a catheter to colon about 4 cm from the anus and was maintained to a head-down position for about 1 min to prevent drug solution from flowing out. In the vehicle-treated group, each mouse was infused with an equal volume of 50% ethanol. The disease activity index (DAI) was used to evaluate colonic damage including weight loss, stool consistency, and bloody stool, as described previously (22). Histological scores of colon HE staining were calculated using a method described in previous studies (23, 24).
2.11 Adoptive transfer experiment
The BMDCs were pretreated with 100 nM FICZ and then subsequently activated by LPS to induce tolDCs in vitro as mentioned above. Then, the tolDCs were collected and washed three times with sterile PBS to remove any remaining FICZ. To assess the effect and mechanism of tolDCs on colitis, 1ⅹ106 tolDCs or control DCs were injected intraperitoneally to colitis mice. The vehicle mouse was injected intraperitoneally with an equal volume of sterile PBS.
2.12 Statistical analysis
All data are expressed as mean ± standard deviation (SD) and analyzed using SPSS 25.0 software (IBM Company, Armonk, NY). The differences among groups were analyzed using one-way analysis of variance (ANOVA) and Bonferroni correction. All graphs were drawn using Graphpad software 8.0 (GraphPad Inc., San Diego, CA). A P-value lower than 0.05 was considered statistically significant.