2.1 Ethics statement
Animal experiments have been reviewed and approved by the animal ethics committee of The Affiliated Huaian No.1 People's Hospital of Nanjing Medical University.
2.2 Cell culture
Human normal esophageal epithelial cells (THEECs) and EC cell lines TE-1 and KYSE-150 (ATCC, VA, USA) were kept in Roswell Park Memorial Institute (RPMI)-1640 (10% fetal bovine serum [FBS], 100 unit/mL penicillin and 100 mg/mL streptomycin). The medium were all provided by Gibco (NY, USA).
2.3 Induction of radioresistance in EC cells
Radioresistant EC cell lines (TE-1R and KYSE-150R) were induced through multiple fractionated irradiation [17]. TE-1 and KYSE-150 cells (1.5 × 106 cells) in a culture flask (25 cm2) were irradiated with 1 Gy X-ray and immediately transferred into a fresh medium. When cells reached 90% confluence, they were cultured in a new culture flask and treated with a second irradiation at 50% confluence. Totally, cells were irradiated at 1 Gy three times, 2 Gy three times, and 4 Gy three times.
2.4 Colony formation assay
Colony formation assay was utilized to assess the radioresistance of parental and resistant EC cells. Parental and resistant EC cells in the log phase were trypsinized and seeded into 100-mm petri dishes. Upon cell adherence, cells were irradiated with 0, 2, 4, 6, 8 and 10 Gy X-ray, respectively and continuously cultured for 12 days to observe cell colonies.
2.5 Cell transfection
Cells in the log phase were cultured on a 6-well plate containing RPMI-1640 (2 × 105 cells/well). Cells at 90% confluence were transfected with EphA2-negative control (CTRL), siRNA-EphA2 or overexpression (OE)-EphA2 (GenePharma, Shanghai, China) via Lipofection™ (InivoGene, CA, USA). Three replicate wells were set.
2.6 Anlotinib treatment
Cells were treated with Anlotinib (CTTQ, Jiangsu, China) at 2, 4 and 8 µmol/L, respectively for 48 h. A control was established with cells treated with saline [18].
2.7 3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) assay
Cells were placed in a 96-well plate at 3 × 103 cells/well. After 48 h, cells were combined with MTT solution at 20 µL/well (Beyotime, Shanghai, China) for 4 h, and with Dimethyl Sulfoxide at 100 µL/well. D value at 490 nm was recorded on an automatic microplate reader (Tecan M200, TECAN, Switzerland).
2.8 Tube formation assay
Cells were cultured in a serum-free medium for 24 h and then in a medium containing 10% FBS. Then, the supernatant was centrifuged at 1000 r/min and filtered through a filter (0.22 µm) to obtain the conditioned medium (CM), which was preserved at 4℃. A mixture (40 µL) made by the CM and Matrigel (1:1) was spread on a 96-well plate overnight and incubated with human umbilical vein endothelial cell suspension (1 × 105 cells/mL) at 200 µL/well. The formed tubes were observed and counted in 4 fields of view by a microscope (Olympus, Tokyo, Japan) [18].
2.9 Transwell assay
Cells were prepared into a single cell suspension with serum-free Dulbecco’s Modified Eagle Medium (DMEM). The cell suspension (100 µL, 3 × 105 cells/mL) was added to the upper chamber of Transwell (Corning, N.Y., USA). Matrigel (BD Company, NJ, USA) was used for invasion assay but not for migration assay. The bottom chamber was supplemented with 10% FBS-DMEM (600 µL). After 24 h, cells were fixed with 95% ethanol, stained with crystal violet and counted under a microscope.
2.10 Tumor xenografts in nude mice
Male and female BALB/c(nu/nu) nude mice (4–6 weeks old; 15–18 g) were provided by Beijing Vital River Laboratory Animal Technology Co., Ltd. (Beijing, China). Mice were housed in specific pathogen-free-level animal barrier (18–23 ℃, humidity 50–60%, 12 h day/night alternate, disinfected food and water). A week later, the skin of the left back of mice was sterilized with ethanol, and mice were subcutaneously injected with 100 µL of cell suspension (1 × 106 cells/mL) into the back. In the following 2 weeks, general condition of the mice and local condition of injection site were observed. Mice were divided into three groups: KYSE-150R group, KYSE-150R + X-ray group, and KYSE-150R + Anlotinib + X-ray group. Mice in the KYSE-150R + Anlotinib + X-ray group were given 1.5 mg/kg Anlotinib by intragastric administration for 2 weeks. Mice in the KYSE-150R + X-ray group and KYSE-150R + Anlotinib + X-ray group were irradiated with 6 Gy X-ray every week. At 4 weeks post injection, mice were euthanized, the excised tumors were weighed, and tumor volume was measured [18].
2.11 Reverse transcription quantitative polymerase chain reaction (RT-qPCR)
After extraction of total RNA in tissues and cells by Trizol (Invitrogen, CA, USA), RNA concentration was determined with Nanodrop 2000 (Thermo Fisher Scientific, MA, USA) and reverse transcribed to cDNA using PrimeScript RT kit (Takara, Kyoto, Japan). Using SYBR Premix Ex Taq kit (Tli RNaseH Plus) kit (Takara), real-time PCR was performed on an ABI7500 (Thermo Fisher Scientific). EphA2 expression was calculated by 2−△△Ct method and normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The primers (GenePharma) were shown in Table 1.
Table 1
Genes | Primers (5’→3’) |
EphA2 | F: ACTGCCAGTGTCAGCATCAACC |
| R: GTGACCTCGTACTTCCACACTC |
GAPDH | F: GCTCTCTGCTCCTCCTGTTC |
| R: ACGACCAAATCCGTTGACTC |
Note: EphA2, Ephrin type-A receptor 2; GAPDH, glyceraldehyde-3-phosphate dehydrogenase |
2.12 Western blot assay
After extraction of protein in tissues and cells, protein concentration was measured by bicinchoninic acid method. The protein was mixed with loading buffer at 2:1 and denatured. After separation by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, protein was transferred to a polyvinylidene fluoride membrane and combined with primary antibodies EphA2 (1:2000, Thermo Fisher Scientific), VEGF (1:2000, Abcam), basic fibroblast growth factor (bFGF; 1:1000, Abcam), and GAPDH (1:1000, Millipore, MA, USA). Afterwards, HRP-labeled secondary antibody (1:5,000, Abcam) was reacted with the membrane which was then developed by enhanced chemiluminescence. GAPDH referred to an internal control. Target protein expression was calculated by gray analysis software.
2.13 Statistical analysis
Data were assessed with SPSS 21.0 (IBM, NY, USA) and measurement data were expressed as mean ± standard deviation. Measurement data in normal distribution were compared by t test between two groups, one-way analysis of variance (ANOVA) among multiple groups and Tukey's multiple comparisons test after ANOVA analysis. At P < 0.05, statistical significance was established.