Study population and breast tissue specimens
A total of 51 invasive ductal carcinoma samples from BC patients were selected. Fresh cancerous and their adjacent noncancerous tissue (ANCT) samples were taken from patients in Faghihie hospital. ANCT was the normal breast tissue diagnosed by the pathologists through H.E. staining. None of the patients had received chemotherapy or radiotherapy before surgery. Clinical and pathological data of patients were collected. The BC tissues were excised and then snap frozen in liquid nitrogen, and stored at - 80°C until RNA experimental analyses. Written informed consent was obtained from each individual, and the local Ethics Committee of Shiraz University of Medical Sciences approved the study protocol.
Estrogen receptor (ER), progesterone receptor (PR), and Her2/neu status of the tumor samples
In this study, the different markers of BC, including ER, PR, Her2/neu were determined according to the patients’ histopathological data, which were carried out through immunohistochemistry (IHC) assay. The ER and PR were considered positive if more than 1% of tumor cells revealed positive reaction. For Her2/neu a test result of 3+ was regarded as positive.
BC cancer cell lines
In addition, we used BC cancer cell lines to reveal more details about the link of expression patterns of the lncRNAs LOC100288637 and RP11-48B3 with the BC malignancy such as metastasis hallmark. In this case, human BC cell lines MDA-MB-231 and MCF-7 BC were used. Of note, the MCF-7 is a widely used BC cell line to study estrogen signaling [15, 16]. Besides, the key features of the MDA-MB-231 cell line are highly aggressive, invasive and poorly differentiated triple-negative breast cancer (TNBC) for ER and PR expression as well as HER2 amplification [17]. In the present study, these cell lines were maintained form cell bank of Pasteur Institute of Iran ,and cultured in RPMI-1640 medium (Sigma 42 Aldrich, St. Louis, MO, USA) supplemented with %10 fetal bovine serum (Gibco, Carlsbad, CA, USA), 100 U/ml penicillin, and 100 μg/ml streptomycin. The cells were incubated in %5 CO2/% 95 humidity at 37°C. Expression analyzes of target lncRNAs were then performed on them.
Total RNA extraction and complementary DNA (cDNA) synthesis
Total RNA was extracted from tissues samples as well as BC cell lines using the TRIzol reagent (Life Technologies, Carlsbad, CA). The purity and concentration of the extracted RNA were determined by Thermo Scientific Nano Drop 1000 Spectrophotometer (Thermo Scientific, Germany) and the RNA integrity was confirmed by gel electrophoresis. For removal of the DNA contamination, the total RNA was treated with DNase (Takara Bio Inc, Ostu, Japan) according to the manufacturer’s instruction. 1 mg RNA was then used for cDNA synthesis, using random hexamers as primers and Prime Script-RT kit (Takara, Japan).
Quantitative gene expression determining through quantitative real-time PCR (qPCR)
Real-time qPCR was carried out using lncRNA-specific primers and SYBR Premix Ex Taq II kit (Takara, Japan) according to the manufacturer’s instruction. QuantStudio™ 3 system ((Applied Biosystems, USA by Thermo Fisher Scientific) was used for amplification. The thermal cycling condition was set as follows: an initial hold at 95°C for 30 s, followed by 40 cycles of 95°C for 05 s and 60°C for 30s. No template controls (NTCs) were included in each run. To verify the reaction efficiency for each primer set, standard curves were prepared using data from serially diluted samples. Melting curve analyses was performed for each primer set. In addition, PCR products were electrophoresed on 2% agarose gel to verify the product sizes. B2M gene was used as a normalizer. The relative expression was calculated as fold changes by the comparative Ct (ΔΔCt) method. The sequence of primers was as follows ;(RP11-48B3- forward: CAAGCCCTGATCAACTAGGAATA; RP11-48B3.4-revers: GGAAAGTTGGTTGCTGTGTAAG), (LOC100288637-forward: CTAAGCCCTGCTTCTGGTATG; LOC100288637-revers: GGAGGCAGATCCAGTTCATTAG). B2M- forward: AGATGAGTATGCCTGCCGTG, B2M- revers: GCGGCATCTTCAAACCTCCA
Bioinformatic analysis
In current study, we also conducted different bioinformatic analysis, mainly by using data of TCGA, (https://www.cancer.gov/about-nci/organization/ccg/research/structural-genomics/tcga) to get more information about RP11-48B3.4 and LOC100288637. In this regard, we investigated the expression correlation between these two lncRNAs and mRNAs in TCGA-BRCA dataset through using TANRIC webserver (https://bioinformatics.mdanderson.org/public-software/tanric/). Subsequent, we used the possible correlated mRNAs for any possible interactions between these mRNAs and lncRNA using LncRRIsearch webserver (http://bioinfo.life.hust.edu.cn/lncRNASNP#!/lncrna_info?lncrna=NONHSAT127417.2.).
Statistical analysis of the data
The data are presented as mean and standard deviation. qPCR data were analyzed using unpaired t-test and Mann-Whitney tests. The comparison of gene expression among the subgroups was done using t-test or ANOVA. Then, the expression level of lncRNAs was compared between the subgroups through nonparametric tests using Mann-Whitney and Kruskal-Wallis. The correlation assessment between the expression level and variables in our study was performed through the spearman correlation coefficient. All statistical analyses were performed using SPSS version 20.0 software (IBM, Carlsbad, CA, USA). P value <.05 values were considered to be statistically significant.