Cell Culture
The rat pituitary adenoma cell line GH3 (Cat. No. CL-0340) was obtained from Procell (Wuhan, China). Cells were cultured in Ham’s F-12K medium (Gibco) containing 15% horse serum (Gibco) and 2.5% fetal bovine serum (Gibco) in an incubator at 37℃ under 5% CO2 conditions.
Microarray Data Analysis
The microarray gene data of GSE147786 were obtained from the Gene Expression Omnibus (GEO, https://www.ncbi.nlm.nih.gov/geo/) database.
The expression of RACGAP1 was analyzed in 10 GHPA samples and 8 normal pituitary tissues (including 2 technical replicas) with the GPL23126 platform. Wilcoxon rank sum tests were used to explore the association of RACGAP1 between tumor tissues and nontumor normal tissues.
Immunohistochemistry (IHC)
The formalin-fixed paraffin-embedded sections of 26 tissue samples from GHPA patients and 5 normal pituitary tissues were obtained from the pathology department of Huashan Hospital, Fudan University (Shanghai, China). Histological diagnoses were confirmed independently by 2 experienced pathologists. The clinical characteristics of the patients are displayed in Supplementary Table 1. For IHC, sections were dewaxed with xylene and rehydrated with gradient ethanol. Following microwave antigen retrieval, the tissue sections were incubated with 3% hydrogen peroxide for 15 minutes at room temperature to inhibit endogenous peroxidase activity. Subsequently, the sections were blocked with 5% goat serum for 20 minutes at room temperature and incubated with RACGAP1 antibodies (ab134972, Abcam) overnight at 4℃. After washing with PBS, the samples were further incubated with horseradish peroxidase-conjugated secondary antibodies for 60 minutes at room temperature. Finally, the slides were developed with DAB reagent for 3 minutes and counterstained with hematoxylin for 30 seconds. The immunohistochemistry-positive area and staining intensity were measured and quantified with ImageJ/Fiji.
RNA Interference
Gene silencing was achieved by transfecting small interfering RNA (siRNA) oligonucleotides into cells. The transfection was performed following the instructions of the Hiperfect Transfection Reagent (Qiagen). The siRNA sequences used were as follows: RACGAP1-1: 5’-CGGCUGGAGAUUAUCAAUGAATT-3’, RACGAP1-2: 5’-CGAGGGAAAUCAGGACCUUUATT-3’, RACGAP1-3: 5’-UCCUGAAUUCCAGCUUGUCAATT-3’.
Quantitative Reverse-Transcription Polymerase Chain Reaction (qRT-PCR)
Total RNA was isolated using Trizol reagent (Life Technologies) following the manufacturer’s protocol. To synthesize cDNA, reverse transcription was carried out using the iScript™ cDNA Synthesis Kit (Bio-Rad). In addition, quantitative PCR was performed using 2×SYBR qPCR Mix (Qiagen) in a QuantStudio 6 Flex (Applied Biosystems). The Ct value of GAPDH was used for normalization, and the relative mRNA expressions were calculated using the ΔΔCt method. The primer sequences were as follows. Racgap1 Forward: 5’-CTTCGAGGACTTCCGAAAGAA-3’, Reverse: 5’-CACATCCACTTGGTTACGGG-3’; Gapdh Forward: 5’-GTTGTGGATCTGACATGCCG-3’, Reverse: 5’-AGCCCAGGATGCCCTTTAGT-3’.
Western Blot
Western blot analysis was conducted as previously described [36]. Briefly, whole cell extracts were generated using RIPA buffer. After electrophoresis on SDS-polyacrylamide gels, proteins were electroeluted onto polyvinylidene difluoride (PVDF) membranes (Millipore). Next, the membranes were blocked with 5% skim milk and incubated overnight at 4℃ with the following primary antibodies: anti-RACGAP1 (66056-1-Ig, Proteintech), anti-p21 (28248-1-AP, Proteintech), anti-Cyclin A2 (18202-1-AP, Proteintech), anti-CDK1 (19532-1-AP, Proteintech), anti-CDK2 (10122-1-AP, Proteintech), and anti-GAPDH (60004-1-Ig, Proteintech). Membranes were then incubated with Horseradish peroxidase- (HRP-) conjugated secondary antibodies for 1 hour at room temperature. Finally, protein bands were detected using an enhanced chemiluminescence assay kit (Millipore).
Cell Viability Assay
Cell viability was assessed by the Cell Counting Kit-8 assay (CCK-8, Dojindo). For siRNA-treated GH3 cells, cells were seeded into 96-well plates at a density of 3,000 cells/well after 24 hours of transfection. Cell viability was then evaluated at 24, 48, 72, and 96 hours. To validate the function of the 74 compounds enriched from the virtual screening, GH3 cells were seeded into 384-well plates at a concentration of 6,250 cells/well and treated with 50 µM of each compound or 10 µM of staurosporine (STSP) for 72 hours. Furthermore, GH3 cells were seeded into 96-well plates (3,000 cells/well) and incubated with dimethyl sulfoxide (DMSO) or a series of 2-fold-diluted concentrations of DB07268 for 72 hours to determine the IC50 value of DB07268. Subsequently, CCK-8 assays were performed according to the manufacturer's instructions to assess cell viability. Absorbance at 450 nm was quantified using the Multiskan Go spectrophotometer (Thermo Scientific), and GraphPad Prism 10.1 was used to calculate the IC50 values.
Plate Clone Formation Assay
After siRNA transfection, GH3 cells were seeded into a 6-well plate at 2000 cells/well. The procedures for each group were performed in triplicate and the medium was changed every 3 days. After 2 weeks, colonies were fixed with 4% paraformaldehyde, stained with 0.1% crystal violet, and counted with ImageJ/Fiji.
Cell Cycle and Apoptosis Assay
Flow cytometry was employed to conduct cell cycle and apoptosis analyses. In brief, siRNA-treated GH3 cells were collected after a 48-h incubation. For the cell cycle assay, cells were fixed with 70% ethanol overnight at 4℃ and stained with propidium iodide (PI, BD Biosciences) for 10 minutes at room temperature. For the apoptosis assay, cells were re-suspended in 1×binding buffer and then incubated with 7-AAD staining solution and Annexin V-PE (Vazyme) for 10 minutes. All samples were detected by a CytoFLEX S flow cytometer (Beckman Coulter) following the manufacturer’s protocol to analyze the cell cycle phase and apoptosis.
Generation of GH3 Cells with Doxycycline-Inducible shRNA of RACGAP1
The shRNA targeting RACGAP1 with restriction enzyme sites (EcoRI and XhoI; CTCGAGAAGGTATATTGCTGTTGACAGTGAGCGAACGGTTATTAAGCCTGAATCTTAGTGAAGCCACAGATGTAAGATTCAGGCTTAATAACCGTCTGCCTACTGCCTCGCAATTG) was synthesized and inserted into a Tet-On expression vector pGCTetS (Genechem, Shanghai, China) by replacing the original expressing open reading frames (ORFs). The lentiviral vector pGCTetS containing shRNA inserts or empty pGCTetS vector was co-transfected into 293T cells with pHelper 1.0 and pHelper 2.0 (purchased from Genechem). The infected GH3 cells were cultured with puromycin to select stably transduced cells and then treated with different concentrations of doxycycline (0, 0.5, 1, 2, 5, or 10 µg/mL) to induce shRNA expression. Western blot was performed to validate the inducible knockdown of RACGAP1 expression.
Xenograft Study
Male BALB/c nude mice aged 6–8 weeks were selected to establish the xenograft model. Each mouse received a subcutaneous injection of 1 × 106 GH3 cells infected with the virus expressing either pGCTetS-shRACGAP1 (shRACGAP1 group) or an empty vector (Vector group). After tumor formation (about 1 week later), each group of mice was further randomly divided into 2 groups, with 6 mice per group. One group was administered doxycycline (2 mg/mL) via oral gavage to induce the expression of RACGAP1 shRNA, and the other group was given normal water. Tumor volumes were then monitored by bidimensional measurement and calculated as width2 × length × 0.5 every 2–3 days. All the mice were sacrificed 19 days after inoculation, and the tumors were removed, weighed, and fixed. Blood samples were collected from the orbit and stored at − 80°C.
Enzyme-Linked Immunosorbent Assay (ELISA)
The blood of xenograft mice was collected and ELISA was performed to detect the GH levels. After thawing the serum samples at room temperature, the serum GH levels were measured by the specific ELISA kit (Cusabio) according to the manufacturer's instructions. Moreover, the OD value of each sample at 450 nm wavelength was measured with a Multiskan Go spectrophotometer (Thermo Scientific).
RNA Sequencing (RNA-seq)
After siRNA transfection, GH3 cells were collected and total RNA was extracted. The cDNA library was constructed with NEBNext® UltraTM
RNA Library Prep Kit for Illumina® (NEB, USA) and then subjected to sequencing on an Illumina Novaseq platform. Subsequently, the DESeq2 R package was utilized to analyze differential gene expression. The resulting P-values were adjusted using Benjamini and Hochberg’s approach to control the false discovery rate. Genes with an adjusted P-value < 0.05 were considered differentially expressed. Gene-annotation enrichment analysis was implemented using the Kyoto Encyclopedia of Genes and Genomes (KEGG) database and Gene Ontology (GO) enrichment analysis.
Virtual Screening of Inhibitors Targeting RACGAP1
The compounds database used for virtual screening was graciously provided by TargetMol (http://targetmol.com/), which included over 50,000 compounds with information on their chemical structures and biological activities. The crystal structure of the Rho-GAP domain of the RACGAP1 protein was identified and obtained from RCSB PDB (PDB code: 2OVJ). The phosphorylation events of RACGAP1 are crucial in regulating its functions during mitosis [37]. A previous study reported that Aurora B (AURKB) phosphorylates RACGAP1 at Ser387 in the Rho-GAP domain and converts RACGAP1 to an active GTPase-activating protein (GAP), which is critical in mediating cytokinesis[38]. Furthermore, Ser387 was found to be structurally located in the binding region of RACGAP1 and CDC42 (Fig. 6A and B). Therefore, Ser387 was determined as the center of the docking area. For virtual screening, the compounds database was subjected to a drug-likeness pre-screening study using the Lipinski rule of five. Molecular docking was performed using high throughput virtual screening (HTVS) and standard precision (SP) modes in Glide to improve the efficiency and accuracy of the virtual screening. Finally, 97 molecules (ΔG < − 5 kcal/mol) were screened, of which 74 compounds available for purchase were selected for further study.
Surface Plasmon Resonance (SPR) Analysis
The SPR experiments were conducted in a BIAcore T200 device (GE Healthcare) using CM5 sensor chips (Cytiva) according to the manufacturer’s protocol. Briefly, recombinant RACGAP1 protein (purchased from TargetMol) was immobilized onto a CM5 chip. Subsequently, a series of analytes (DB07268, Kaempferol, Tubercidin, NSC228155, Ancitabine hydrochloride, and 5-Fluoroorotic acid) were prepared at different concentrations using the RACGAP1 antibody (ab134972, Abcam) as positive control and were injected at a flow rate of 30 µL/min for 150 seconds. After each flow, the chip was regenerated by injecting 10 mM glycine-HCl (pH 2.0) at 10 µL/min for 5 minutes. Data were collected for a 60-second association followed by a 120-second dissociation. All procedures were conducted with 5% DMSO-PBS as a running buffer. The kinetic analyses were performed with the BIAcore T200 Evaluation software (v.2.0, GE Healthcare) using a 1:1 Langmuir binding model.
Statistical Analysis
All analyses were performed using GraphPad Prism 10.1 software. The results of this study were presented as the mean ± standard deviation (SD). At least 3 independent experiments were performed. The two-tailed Student t-test was used for comparison between 2 groups. In this study, P < 0.05 was considered statistically significant.