Expression profiles of tsRNAs in GC and database screening of tRF-24-6VR8K09LE9
In order to search for tsRNAs that are expressed in GC differentially, we first downloaded raw data from the tsRFun database (https://rna.sysu.edu.cn/tsRFun/index.php) and the TCGA STAD database, which includes 452 GC samples and 45 near-normal tissue samples. The information is subsequently displayed graphically as volcano and heat maps (Fig. 1A, B). Three tsRNAs with low expression in GC tissues were selected by tsRFun database under the conditions of Log2 (Fold Change) > 2 and P < 0.05, and then further analyzed by qRT-PCR. We validated qRT-PCR on 20 pairs of GC tissues and paracarcinoma tissues and showed that tRF-24-6VR8K09LE9 exhibited significant differences among the three tsRNAs (Fig. 1C), whereas tRF-17-884U1D2 and tRF-20-79MP9P9N showed non-significant differences (Fig. S1A, B). Therefore, we selected tRF-24-6VR8K09LE9 for further study. At the beginning of the study, sera were gathered from 20 untreated PC, hepatocellular carcinoma (HCC), CRC, GC, and normal individuals, respectively. To measure the levels of tRF-24-6VR8K09LE9, we employed qRT-PCR. Based to our results, the difference of tRF-24-6VR8K09LE9 was most significant in GC (Fig. 1D) but not in PC, HCC, or COAD (Fig. S1C-E).
tRF-24-6VR8K09LE9 is a type of 5’-tRF
Following the human genome build (GRCh37/hg19) from the UCSC Genome Browser database (http://genome-asia.ucsc.edu/biomarker.html), we found that tRF-24-6VR8K09LE9 was derived from chromosome 17q11.2 with coordinates 31,550,074 − 31,550,097 (Fig. S2A). Using MINTbase v2.0 (http://cm.jefferson.edu/MINTbase/), we were able to validate that tRF-24-6VR8K09LE9 is a 5′tRF based on length 24nt (GGCGCGGGTGGCCAAGTGGTAAGGC), which is produced from mature tRNA-Thr-CGT-2-1 or tRNA-Thr-CGT-4-1 (Fig. S2D), with the cleavage point located at the D- loop and Acceptor stem (Fig. S2C).
Prerequisites for clinical applicability of tRF-24-6VR8K09LE9
To assess the clinical applicability of tRF-24-6VR8K09LE9, first we we verified the accuracy of tRF-24-6VR8K09LE9 using mixed sera and found good intra-batch (1.67%) and inter-batch (2.70%) coefficients of variation for tRF-24-6VR8K09LE9 (Table 1). To ensure the stability and integrity of tRF-24-6VR8K09LE9, we analyzed the qRT-PCR product by agarose gel electrophoresis, which revealed a clear band around 80 bp, while Sanger sequencing suggested that the qRT-RCR product contained the complete sequence of tRF-24-6VR8K09LE9, which was in agreement with MINTbase v2.0 was consistent (Fig. 2C). Secondly, repeated freeze-thaw and gradient dilution assays also revealed promising linearity (Fig. 2A, B). In addition, the single peak specific cleavage curve showed the specificity of tRF-24-6VR8K09LE9 (Fig. S2B). The above experiments indicate that tRF-24-6VR8K09LE9 is a clinically usable molecule.
Table 1
The Intra-Assay CV and the Inter-Assay CV of tRF-24-6VR8K09LE9.
| tRF-24-6VR8K09LE9 | RNU6B |
Intra-assay CV, % | 1.67 | 1.11 |
Inter-assay CV, % | 2.70 | 3.73 |
CV, coefficient of variation. |
Expression of tRF-24-6VR8K09LE9 in GC serum and its diagnostic value
The diagnostic utility of tRF-24-6VR8K09LE9 in a clinical context was verified by collecting serum samples from 114 GC patients, 51 healthy volunteers, and 40 gastritis patients. Although there was no discernible difference between the two groups, the level of tRF-24-6VR8K09LE9 in GC patients was observed to be significantly lower than in both gastritis patients and healthy donors (Fig. 3A). Also, we separated the GC patients into groups on the basis of high and low expression. The association between the clinicopathological characteristics and the expression level of tRF-24-6VR8K09LE9 was assessed using the Chi-square test. The findings demonstrated a significant relationship between the expression level of tRF-24-6VR8K09LE9 and Differentiation grade (P = 0.029), T stage (P = 0.036), lymph node status (P = 0.036), TNM stage (P < 0.0001), and nerve/vascular invasion (P = 0.033). However, there was no significant correlation with tumor size, gender, age, Lauren classification, C-erbB-2, and MMR (Table 2). Interestingly, patients with stage I–II GC had significantly lower expression levels of tRF-24–6VR8K09LE9 than healthy donors did, with the difference being particularly noticeable in patients with stage III–IV GC (Fig. 3B). In addition, tRF-24-6VR8K09LE9 levels were higher in well-differentiated GC patients than in poorly differentiated patients (Fig. 3C). Remarkably, when compared to healthy donors, the expression levels of tRF-24-6VR8K09LE9 were significantly lower in both stage III-IV and stage I-II GC patients (Fig. 3D). We also observed lower expression levels of tRF-24-6VR8K09LE9 in GC patients with lymph node metastasis (Fig. 3E). The level of tRF-24-6VR8K09LE9 was remarkably lower in GC patients without neurological/vascular invasion than in those with neurological/vascular invasion (Fig. 3F). In order to evaluate the prognostic significance of tRF-24-6VR8K09LE9, we analyzed serum tRF-24-6VR8K09LE9 before and after surgery in 42 pairs of GC patients and ultimately discovered that there was no meaningful difference in the levels of tRF-24-6MR8K09le9 between postoperative GC patients compared to healthy donors (Fig. 3G). However, significant differences were found between preoperative GC patients and healthy donors (Fig. 3H). As a result, our findings imply that tRF-24-6VR8K09LE9 is not highly expressed in GC patients' serum and could be a useful clinical marker for dynamic analysis of GC prognosis and diagnosis.
Table 2
Clinicopathological analysis of tRF-24-6VR8K09LE9.
Parameter | No. of patients | tRF-24-6VR8K09LE9 (low) | tRF-24-6VR8K09LE9(high) | P-value |
Sex | Male | 68 | 36 | 32 | 0.445 |
Female | 46 | 21 | 25 |
Age(year) | < 66 | 53 | 25 | 28 | 0.573 |
≥ 66 | 61 | 32 | 29 |
Tumor size | < 5 | 81 | 40 | 41 | 0.836 |
≥ 5 | 33 | 17 | 16 |
Differentiation grade | Well-moderate | 75 | 32 | 43 | 0.029* |
Poor-undifferentiation | 39 | 25 | 14 |
T stage | T1-T2 | 67 | 28 | 39 | 0.036* |
T3-T4 | 47 | 29 | 18 |
Lymph node status | Positive | 43 | 16 | 27 | 0.033* |
Negative | 71 | 41 | 30 |
TNM stage | I-II | 71 | 25 | 46 | < 0.0001**** |
III-IV | 43 | 32 | 11 |
Nerve/vascular invasion | Positive | 67 | 39 | 28 | 0.036* |
Negative | 47 | 18 | 29 |
Lauren classification | Intestinal type | 32 | 14 | 18 | 0.323 |
Diffuse type | 28 | 12 | 16 |
Mixed type | 54 | 31 | 23 |
C-erbB-2 | Positive | 3 | 2 | 1 | 0.558 |
Negative | 111 | 55 | 56 |
MMR | dMMR | 24 | 11 | 13 | 0.645 |
pMMR | 90 | 46 | 44 |
Note: MLH1, PMS2, MSH2, and MSH6 were all positive for pMMR (normal expression), and one or more negative for dMMR (deletion). Abbreviations: dMMR, mismatch repair deficiency; MMR, mismatch repair; pMMR, mismatch repair proficiency; TNM, tumor node metastasis (*P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001). |
Diagnostic value of tRF-24-6VR8K09LE9
We compared tRF-24-6VR8K09LE9 with the traditional molecular markers CEA, CA199 and CA724 in order to assess its efficacy in clinical diagnosis. We performed ROC curve modeling of tRF-24-6VR8K09LE9 and CEA, CA199 and CA724 expression levels in the sera of 114 GC patients and 51 healthy donors, and analyzed the AUC. The AUC of tRF-24-6VR8K09LE9 was 0.799 (95% confidence interval (CI): 0.733–0.865), which was higher than that of CEA (0.672 (95% CI: 0.590–0.754)), CA199 (0.609 (95% CI: 0.520–0.698)) and CA724 0.662 (95% CI: 0.574–0.749) (Fig. 4A). Notably, when the cut-off point was 1.47350836 and Youden's index was 0.552, the SEN and SPE of tRF-24-6VR8K09LE9 in distinguishing between GC patients and healthy donors were 65%, and 82%, respectively. the SEN of CEA, CA199, and CA724 were 56%, 25%, and 48%, respectively; and the SPE was 69%, 92%, and 69%, respectively (Table 3). Thus, tRF-24-6VR8K09LE9 exhibits better diagnostic efficacy than other conventional markers when diagnosed alone. We then combined tRF-24-6VR8K09LE9 with either or both of CEA, CA199, and CA724 and found that the combination of two or three biomarkers diagnosed AUC higher than any single biomarker (Fig. 4B, C), and when tRF-24-6VR8K09LE9 was diagnosed in combination with four of CEA, CA199 and CA724, respectively AUC reached the highest (0.879) (Fig. 4C). Also, we compared serum from 114 patients with GC and AUC from 40 patients with gastritis and found a similar trend (Fig. S3A-C) (Table S1). To further assess whether tRF-24-6VR8K09LE9 has a diagnostic value in early GC, we performed ROC curve analysis of 71 patients with early GC and 51 healthy donors serum and found that the AUC of tRF-24-6VR8K09LE9 was 0.799 to 0.779 (95% CI 0.698–0.860) higher than that of CEA of 0.675 (95% CI 0.581–0.769), 0.604 (95% CI 0.504–0.704) for CA199, and 0.680 (95% CI 0.586–0.774) for CA724 (Fig. S3D-F) (Table S2). These results support the notion that tRF-24-6VR8K09LE9 has a strong chance of becoming a clinical serological marker, and that when evaluated in conjunction with other established markers, its diagnostic utility only grows. In addition, in early GC, tRF-24-6VR8K09LE9 contributes to improving the detection rate of GC when combined with other markers.
Table 3
The diagnostic performance of tRF-24-6VR8K09LE9, CEA, CA199, and CA724 in differentiating GC patients from healthy donors.
| SEN, % | SPE, % | ACCU, % | PPV, % | NPV, % |
tRF-24-6VR8K09LE9 | 0.65(74/114) | 0.82(42/51) | 0.70(116/165) | 0.89(74/83) | 0.51(42/82) |
CEA | 0.56(64/114) | 0.69(35/51) | 0.60(99/165) | 0.80(64/80) | 0.41(35/85) |
CA199 | 0.25(29/114) | 0.92(47/51) | 0.46(76/165) | 0.88(29/33) | 0.36(47/132) |
CA724 | 0.48(55/114) | 0.69(35/51) | 0.55(90/165) | 0.77(55/71) | 0.37(35/94) |
tRF-24-6VR8K09LE9 + CEA | 0.78(89/114) | 0.61(31/51) | 0.73(120/165) | 0.82(89/109) | 0.55(31/56) |
tRF-24-6VR8K09LE9 + CA199 | 0.75(86/114) | 0.75(38/51) | 0.75(124/165) | 0.87(86/99) | 0.58(38/66) |
tRF-24-6VR8K09LE9 + CA724 | 0.85(94/114) | 0.57(29/51) | 0.75123/165) | 0.81(94/116) | 0.59(29/49) |
CEA + CA199 + CA724 | 0.82(94/114) | 0.45(23/51) | 0.71(117/165) | 0.77(94/122) | 0.53(23/43) |
tRF-24-6VR8K09LE9 + CEA + CA199 | 0.85(97/114) | 0.55(28/51) | 0.76(125/165) | 0.81(97/120) | 0.62(28/45) |
tRF-24-6VR8K09LE9 + CEA + CA724 | 0.89(102/114) | 0.43(22/51) | 0.75(124/165) | 0.78(102/131) | 0.65(22/34) |
tRF-24-6VR8K09LE9 + CA199 + CA724 | 0.76(87/114) | 0.33(17/51) | 0.63(104/165) | 0.72(87/121) | 0.39(17/44) |
tRF-24-6VR8K09LE9 + CEA + CA199 + CA724 | 0.91(104/114) | 0.41(21/51) | 0.75(124/165) | 0.77(104/135) | 0.67(20/30) |
Abbreviations: SEN, sensitivity; SPE, specificity; ACCU, overall accuracy; PPV, positive predictive value; NPV, negative predictive value. |
tRF-24-6VR8K09LE9 inhibits the proliferation and migration of GC cells
For the study of whether tRF-24-6VR8K09LE9 exerts an inhibitory effect in GC, we up-regulated SGC-7901 and BGC-823 cell lines using tRF-24-6VR8K09LE9 mimics and down-regulated AGS cell line using tRF-24-6VR8K09LE9 inhibitor. The effectiveness of tRF-24-6VR8K09LE9 up- and down-regulation was confirmed by qRT-PCR results (Fig. S4A). Colony formation experiments and the CCK-8 assay demonstrate that tRF-24-6VR8K09LE9 mimic-transfected SGC-7901 and BGC-823 cells were unable to proliferate (Fig. 5A, B), while proliferation was increased in AGS cells after transfection with the tRF-24-6VR8K09LE9 (Fig. S4B, C). In addition, transfection with tRF-24-6VR8K09LE9 mimics decreased cell migration and invasion ability (Fig. 5D, E), while transfection with the inhibitor increased cell migration and invasion (Fig. S4D).
tRF-24-6VR8K09LE9 downstream forecast
Aiming at further exploring the mechanism of action of tRF-24-6VR8K09LE9, its potential target genes were predicted by bioinformatics databases (miranda, targetScan, pita, and RNAhybrid), and the results indicate that the 415 molecules intersected by the four databases are most probably the downstream target genes of tRF-24–6VR8K09LE9 (Fig. 6A). Furthermore, putative target genes are enriched in the regulation of cell growth, regulation of nervous system development, and regionalization, according to Gene Ontology (GO) functional enrichment analysis (Fig. 6B). KEGG biological pathway showed high levels of enrichment in PI3K-Akt signaling pathway, P53 signaling pathway, and insulin signaling pathway (Fig. 6C), which may regulate the onset and progression of GC, but further validation is needed.