Cells lines and reagents
SYBR Green Real-Time PCR Master Mix (Xavier Biotechnology Co., LTD.) bone alkaline phosphatase (BALP), type I collagen carboxyl terminal propeptide (CICP) and GAPDH antibodies were purchased from Xavier Biotechnology Co., LTD. Experimental cell lines MG63 (ATCC) and U2OS (ATCC). Culture conditions: Gas phase: air, 95%; Carbon dioxide, 5%. Temperature: 37 ℃. Incubator humidity, 70%-80%.
Scratch test
All sterilizable instruments should be sterilized. Ruler and marker should be irradiated by UV for 30min before operation (in ultra-clean table). First, use marker evenly draw horizontal lines with ruler behind 6-hole plate, about every 0.5 ~ 1cm, across the hole. At least 5 wires must pass through each hole. Add about 5X105 cells to the hole, the exact number varies from cell to cell, and it should be fully covered overnight. The next day, compare the ruler with the spear head, try to hang as far as the back of the horizontal line scratches, the spear head should be vertical, not tilt. The cells were washed 3 times with PBS, the floating cells were removed, and serum-free medium was added. Put it into a 37 ° C 5%CO2 incubator for cultivation. Take samples at 0, 24 and 48 hours.
Trasnswell experiment
On the day before the experiment, a tube of Matrigel matrix glue which had been divided was put in the refrigerator at 4℃ overnight from − 20℃ in advance, and the Matrigel glue melted from solid state to liquid state. Matrigel matrix glue was diluted at 1:8 and coated on the upper compartment surface of the bottom membrane of the Transwell chamber. Extract the residual liquid from the culture plate and add 50µL 10g/LBSA serum-free medium to each well at 37 ℃ for 30min. The cells were digested by conventional trypsin and washed 1–2 times with PBS to remove the effect of serum. The cells were re-suspended in serum-free medium, and the cell density was adjusted to 5×105 cells /mL. Add 200µL cell suspension to the upper chamber of Transwell chamber, and add 600µL medium containing 10% FBS to the lower chamber of 24-well culture plate. The culture plate was placed in a CO2 incubator at 37℃ for 24 hours. The cells were taken out, washed twice with PBS, and the cells in the upper layer of the microporous membrane of the cells were carefully wiped with cotton swabs. The cells were fixed with 4% paraformaldehyde in the 24-well plate for 20 min, and stained with crystal violet solution for 15 min. Photographs were taken under an inverted microscope, 10 fields were counted randomly for each sample, and the average value was taken for statistical analysis.
CCK8 experiment
Inoculate cell suspension in 96-well plate (100µL/ well). The culture plate was placed in an incubator for pre-culture for a period of time (37℃,5% CO2). Add 10 µL CCK8 solution to each well. Incubate the culture plate in the incubator for 2 hours. The absorbance at 450nm was measured with a microplate reader.
Western blotting
Protein (40µg) was extracted, separated by 10% SDS-PAGE and transferred to polyvinylidene difluoride membranes. The membranes were blocked with 5% skimmed milk, followed by incubation with primary antibodies at 4°C overnight. The membranes were incubated with horseradish peroxidase-conjugated secondary antibodies for 2 h. Blots were developed using the ECL system. The antibodies used in our study included anti-BALP antibody and anti-CICP antibody. All experiments were repeated at least three times.
Real-time quantitative reverse transcription
Total RNA was extracted using the TRIzol method, and cDNA was synthesized with the RevertAid™ first strand cDNA synthesis kit. Real-time polymerase chain reaction (PCR) was performed using the ABI PRISM 7900HT sequence detection system. The expression of osteogenesis-related genes was normalized to GAPDH using the 2−ΔΔCT method. The primer sequences are listed in Table 1.
Table 1
Primer sequences used in quantitative PCR assay
Gene | Sequence(5’-3’) |
BALP | Forward primer: CAGAAGTGCGAGGAGGAGGT |
Reverse primer: GAAATCGTGCGGGGTCAT |
CICP | Forward primer: GGTGCAGACCTAGCAGACACCA |
Reverse primer: AGGTAGCGCCGGAGTCTATTCA |
GAPDH | Forward primer: GGCACAGTCAAGGCTGAGAATG |
Reverse primer: ATGGTGGTGAAGACGCCAGTA |
Statistical analysis
Image processing was performed by Image J. Statistical analyses were performed with SPSS for Windows 10. All data values were expressed as means ± SD. Comparisons of means among multiple groups were performed with one-way ANOVA followed by post pairwise comparisons using Tukey’s tests. A two-tailed p,0.05 was considered statistically significant in this study.