Animals
All animal experiments were performed under the guidelines of the Tokyo Medical and Dental University Committee on Animal Research (A2023-020A, G2023-073A) and the Fundamental Guidelines for Proper Conduct of Animal Experiment and Related Activities in Academic Research Institutions under the jurisdiction of the Ministry of Education, Culture, Sports, Science and Technology of Japan. C57BL/6J wild-type mice were purchased from CLEA Japan, Inc., and Adipoq-CreERT2 (stock number: 025124) and Ppargc1a (Pgc1a) flox/flox (stock number: 009666) mice were purchased from The Jackson Laboratory. To generate tamoxifen-inducible adipocyte-specific PGC-1α knockout (KO) mice, Pgc1a flox/flox mice were crossed with Adipoq-CreERT2 mice. The animals were housed alone at 25°C with a 12-h light/dark cycle and allowed free access to water and a standard diet (CE-2; 343 kcal/100 g, CLEA Japan, Inc.). Eight-week-old male and female KO or Pgc1a flox/flox (Control) mice were injected intraperitoneally with 100 mg/kg tamoxifen (Sigma-Aldrich) for 5 consecutive days and analyzed at least 8 weeks after the last administration of tamoxifen. For the experiment of tamoxifen administration to wild-type mice according to the same protocol and analyzed after 2 weeks.
For cold exposure experiments, mice were maintained at thermoneutrality (30°C) in a temperature-controlled chamber (HC-100, Shin Factory, Japan) for one week before cold challenge and allowed free access to water and a standard diet. Food was removed 1 h before the start of cold exposure, and the animals were placed at 4°C. During cold exposure, the rectal temperatures (TD-300, NATSUME, Japan) and interscapular surface temperatures (E53, FLIR Systems Inc, USA) of mice were measured every 30–60 min. The method for measuring interscapular surface temperatures is described in detail in a previous report (1).
References
1. Oelkrug, R. & Mittag, J. An improved method for the precise unravelment of non-shivering brown fat thermokinetics. Sci Rep11, 4799 (2021). https://doi.org/10.1038/s41598-021-84200-1
NE-Induced oxygen consumption
Oxygen consumption was measured using a metabolic chamber (Shin Factory, JAPAN) coupled to a mass spectrometer (ARCO-2000; Arco system, Tokyo, JAPAN). Mice were anesthetized, and measurements were performed for 30 min at 33℃ to obtain basal values. Each mouse was then briefly removed from the chamber, treated with norepinephrine (1 mg norepinephrine/kgBW), and returned to the chamber, and oxygen consumption was measured for another 30–40 min.
Glucose tolerance test
The glucose tolerance test was performed via an intraperitoneal injection of glucose at 2.0 g/kg body weight, and blood glucose levels were measured before and 15, 30, 60, 90, and 120 min after the injection. Blood glucose was measured using a glucometer (Stat Strip Xpress; Nova biomedical, USA).
Western blotting
Protein lysates were extracted from Brown adipose tissue using RIPA buffer (nacalai) supplemented with a protease inhibitor cocktail (cOmpletetm, Sigma-Aldrich). Immunoblotting was performed with Anti-PGC-1α Mouse mAb (Sigma-Aldrich, ST1202, 1:1000) and total OXPHOS rodent WB antibody cocktail (Abcam, ab110413, 1:1000). α-tublin (Cell Signaling, #2144, 1:1000) was used as the loading control. Immunoblots were detected and analyzed using ECL Prime Western Blotting Detection Reagent and ImageQuant LAS 4000 mini (GE Healthcare).
HE staining
BAT was fixed with 4% paraformaldehyde and embedded in paraffin. Sections were stained with hematoxylin and eosin (HE).
Electron microscopy
The BAT were fixed in 4% PFA and 2.5% GA in 0.1M phosphate buffer (PB) for 2 h, washed with 0.1 M PB, post-fixed in 1% OsO4 buffered with 0.1 M PB for 2 h, dehydrated in a graded series of ethanol, and embedded in Epon 812. Ultrathin sections (70 nm) were collected on copper grids, double-stained with uranyl acetate and lead citrate, and then examined by transmission electron microscopy (JEM-1400Flash, JEOL, Japan). Quantification of mitochondrial size and content was performed using ImageJ software.
RNA isolation and quantitative RT-PCR
Total RNA was isolated using the RNeasy Plus Universal Mini Kit (Qiagen). cDNA was synthesized using Random Primer (Thermo Fisher Scientific Inc.) and ReverTra Ace (Toyobo Co., Ltd.). Quantitative PCR was performed using the QuantStudio 6 Flex Real-Time PCR System with Fast SYBR Green Master Mix Reagent. The primer sequences are presented in (Supplemental Table 1).
RNA sequencing
RNA-seq experiments were performed by Novogene (Beijing, China) using RNA extracted from BAT. Sequencing libraries were built using the NEBNext UltraTM RNA Library Prep Kit (Illumina, USA). The library preparations were sequenced on an Illumina Novaseq 6000 platform, and 150-bp paired-end reads were generated. Differentially expressed genes were determined by fold change (>1.5), and gene ontology analysis was conducted using Metasape 3.5.
Metabolomics
BAT samples for metabolomics were obtained from mice 30 min after NE administration at 33°C to evaluate the metabolic dynamics of BAT exhibiting maximal oxygen consumption. Approximately 25–30 mg of frozen BAT tissue was placed in a homogenization tube along with zirconia beads (5mmφ and 3mmφ). Next, 1,500 µL of 50% acetonitrile/Milli-Q water containing internal standards (H3304-1002, Human Metabolome Technologies, Inc. (HMT), Tsuruoka, Yamagata, Japan) was added to the tube, after which the tissue was completely homogenized at 1,500 rpm, 4°C for 60 s using a bead shaker (Shake Master NEO, Bio Medical Science, Tokyo, Japan). The homogenate was then centrifuged at 2,300 × g, 4°C for 5 min. Subsequently, 800 µL of upper aqueous layer was centrifugally filtered through a Millipore 5-kDa cutoff filter (UltrafreeMC-PLHCC, HMT) at 9,100 ×g, 4°C for 180 min to remove macromolecules. The filtrate was evaporated to dryness under vacuum and reconstituted in 50 µL of Milli-Q water for metabolome analysis at HMT.
Metabolome analysis was conducted according to HMT’s C-SCOPE package, using capillary electrophoresis time-of-flight mass spectrometry (CE-TOFMS) for cation analysis and CE-tandem mass spectrometry (CE-MS/MS) for anion analysis based on the methods described previously (1, 2). Briefly, CE-TOFMS and CE-MS/MS analyses were performed using an Agilent CE capillary electrophoresis system equipped with an Agilent 6210 time-of-flight mass spectrometer (Agilent Technologies, Inc., Santa Clara, CA, USA) and Agilent 6460 Triple Quadrupole LC/MS (Agilent Technologies), respectively. The systems were controlled using Agilent G2201AA ChemStation software version B.03.01 for CE (Agilent Technologies) and connected by a fused silica capillary (50 μm i. d. × 80 cm total length) with commercial electrophoresis buffer (H3301-1001 and I3302-1023 for cation and anion analyses, respectively, HMT) as the electrolyte. The time-of-flight mass spectrometer was scanned from m/z 50 to 1,000 (1), and the triple quadrupole mass spectrometer was used to detect compounds in dynamic MRM mode. Peaks were extracted using MasterHands, automatic integration software (Keio University, Tsuruoka, Yamagata, Japan) (3) and MassHunter Quantitative Analysis B.04.00 (Agilent Technologies) to obtain peak information, including m/z, peak area, and migration time (MT). Signal peaks were annotated according to the HMT metabolite database based on their m/z values and MTs. The peak area of each metabolite was normalized to internal standards, and the metabolite concentration was evaluated by standard curves with three-point calibrations using each standard compound. Hierarchical cluster analysis and principal component analysis (PCA) (4) were performed using HMT’s proprietary MATLAB and R programs, respectively. Detected metabolites were plotted on metabolic pathway maps using the VANTED software (5).
References
1. Ohashi, Y. et al. Depiction of metabolome changes in histidine-starved Escherichia coli by CE-TOFMS. Mol. Biosyst. 4, 135–147, 2008.
2. Ooga, T. et al. Metabolomic anatomy of an animal model revealing homeostatic imbalances in dyslipidaemia. Mol. Biosyst. 7, 1217–1223 (2011).
3. Sugimoto, M., Wong, D. T., Hirayama, A., Soga, T. & Tomita, M. Capillary electrophoresis mass spectrometry-based saliva metabolomics identified oral, breast and pancreatic cancer–specific profiles. Metabolomics 6, 78–95 (2009).
4. Yamamoto, H., Fujimori, T., Sato, H., Ishikawa, G., Kami, K. & Ohashi, Y: Statistical hypothesis testing of factor loading in principal component analysis and its application to metabolite set enrichment analysis. BMC Bioinform. 15, 51 (2014).
5. Junker, B. H., Klukas, C. & Schreiber F. VANTED: a system for advanced data analysis and visualization in the context of biological networks. BMC Bioinform. 7, 109 (2006).
Partial least squares (PLS) discriminant analysis
Metabolomics data were normalized and analyzed by partial least squares (PLS) (1) using R programs (2) developed by Human Metabolome Technologies, Inc.
References
1. Yamamoto, H. PLS-ROG: partial least squares with rank order of groups. J. Chemom. 33, e2883 (2017).
2. R Core Team. R: a language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria. https://www.R-project.org/ (2021).
Lipidomics
BAT samples for lipidomics were obtained from mice 30 minutes after NE administration at 33°C to evaluate the lipid profile of BAT exhibiting maximal oxygen consumption. Lipidome analysis was conducted according to lipidome lab Non-targeted lipidome Scan package (lipidome lab, Akita, Japan), using liquid chromatograph orbitrap mass spectrometry (LC-OrbitrapMS) based on the methods described previously1,2. Briefly, total lipids were extracted from 10 µL brown adipose tissue samples with the modified Bligh-Dyer method. An aliquot of the lower/organic phase was evaporated to dryness under N2, and the residue was dissolved in methanol for LC-MS/MS measurements.
Liquid chromatography (LC)-electrospray ionization-MS/MS analysis was performed by using Q-Exactive Plus mass spectrometer with an UltiMate 3000 LC system (Thermo Fisher Scientific). Samples were separated on L-column3 C18 metal-free column (2.0 µm, 2.0 mm × 100 mm i.d.) at 40°C using a gradient solvent system: mobile phase A (isopropanol/methanol/water (5/1/4 v/v/v) supplemented with 5 mM ammonium formate and 0.05% ammonium hydroxide (28% in water))/mobile phase B (isopropanol supplemented with 5 mM ammonium formate and 0.05% ammonium hydroxide (28% in water)) ratios of 60%/40% (0 min), 40%/60% (0–1 min), 20%/80% (1–9 min), 5%/95% (9–11 min), 5%/95% (11–22 min), 95%/5% (22–22.1 min), 95%/5% (22.1–25 min), 60%/40% (25–25.1 min) and 60%/40% (25.1–30 min). The injection volume was 10 µl and the flow rate was 0.1 mL/min. A heated electrospray ionization (HESI-II) source conditions were as follows: ionization mode, positive or negative; sheath gas, 60 arbitrary units; auxiliary gas, 10 arbitrary units; sweep gas, 0 arbitrary units; spray voltage, 3.2 kV in positive and −3.0 kV in negative mode; heater temperature, 325°C; ion transfer capillary temperature, 300°C in positive and −320°C in negative mode; and S-lens RF level, 50. The orbitrap mass analyzer was operated at a resolving power of 70,000 in full-scan mode (scan range 200–1,800 m/z in positive and 190–1,800 m/z in negative mode; automatic gain control (AGC) target 1e6 in positive and 3e6 in negative mode) and resolving power of 17,500 in positive and 35,000 in negative mode in the top 20 data-dependent MS2 mode (stepped normalized collision energy 20, 30 and 40; isolation window 4.0 m/z; AGC target 1e5) with dynamic exclusion setting of 10.0 s. Post-processing of the raw data files for diacylglycerol and ceramide were done using the lipid molecular identification software, Lipid Search 5.1 (Mitsui Knowledge Industries co., ltd., JAPAN) which is identifies individual intact lipid molecules on the basis of their molecular weight and fragmentation patterns from headgroup and fatty acid composition. In this method, biological matrix effects cannot be normalized in all detected peaks, because it is not possible to prepare appropriate internal standards corresponding to all the detected peaks. The relative values were calculated using the ratio of the chromatographic peak area of each analyte to that of the total analyte. The annotation method used in this study corresponds to equivalent to "Fatty Acyl/Alkyl Level or Hydroxyl Group Level" defined by the lipidomics Standard Initiative3.
References
1. Nishiumi, S. et al. Comparative evaluation of plasma metabolomic data from multiple laboratories. Metabolites 2, 135 (2022).
2. Takumi, H. et al. Comprehensive analysis of lipid composition in human foremilk and hindmilk. J Oleo Sci. 7, 947–957 (2022).
3. Lipidomics Standards Initiative Consortium. Lipidomics needs more standardization. Nat. Metab. 1, 745–747 (2019).
BAT-specific ChREBP knock down by AAV injection
AAV vectors expressing shRNA that targets Chrebp (Mlxipl, target sequence: GGACTGCTTCTTGTCCGATAT) and scrambled shRNA were obtained from VectorBuilder VB230122-1164ver and VB010000-0023jze, respectively). Wild-type female mice were anesthetized and the interscapular skin was incised to expose the BAT. 2.4*1010GC vectors were injected into the BAT using 10μL syringe (HAMILTON, 80330), the skin was sutured, and the anesthesia was antagonized. These mice were used for experiments of measurement of VO2, gene expression analyses and histological analyses after 1 week of injection.
Ovariectomy
12-week-old wild-type mice were bilaterally ovariectomized (OVX) or sham operated under a combination of medetomidine, midazolam, and butorphanol anesthesia (subcutaneously administered). They were sacrificed and analyzed one week after ovariectomy.
BAT ex vivo assay
BAT was collected, surface washed with PBS and kept in PBS at 37C. BAT explants were cut into 1–2 mm pieces with scissors in PBS at 37°C and transferred to serum and phenol red free high glucose DMEM supplemented with 100 nM 17β-Estradiol (Sigma) or vehicle (ethanol). After incubation in a CO2 incubator for 24 hours, BAT was collected and used for RNA extraction.