Pseudosuccinea columella (Say, 1817), an invasive snail species originating from the Americas, has successfully colonised many freshwater habitats in Africa [1]. In southern Africa, its dispersion is recorded in Namibia, South Africa and Zimbabwe [2, 3, 4, 5]. As P. columella is an alien intermediate host of liver fluke, its distribution is of medical and veterinary interest.
<please insert Fig. 1 near here>
Our unexpected encounter with P. columella arose from broader malacological surveys for intermediate snail hosts of schistosomiasis, as part of the “Hybridisation in UroGenital Schistosomiasis (HUGS)” project activities. Commencing in October 2021 then at quarterly intervals, HUGS has been inspecting 12 locations with standard freshwater snail collection protocols in Mangochi District (n=7), Chikwawa District (n=2) and Nsanje District (n=3), Fig. 1. The chosen locations are exemplars of high-risk water contact sites for human and animal schistosomiasis, being each inspected by a team of three, collecting snails by hand or by metal scoop.
Owing to its distinctive shell micro-sculpture (Brown, 1994), permitting quick in-field differentiation from Radix natalensis (Krauss, 1848), P. columella was first noticed during the March 2023 survey. Thereafter, a more purposeful search for living snails was made during July 2023 survey. In so doing, sufficient specimens (n=6) were obtained for an anatomical inspection, molecular snail taxonomy and molecular liver fluke xenomonitoring investigation, with additional specimens (n=29) checked for shedding liver fluke cercariae. Several specimens of R. natalensis were collected concurrently for later comparison.
<please insert Fig. 2 near here>
For anatomy, each snail was placed in water for 2 minutes at 80 oC. Soft tissues were then carefully removed from the shell with forceps. The empty shell was then viewed under a dissecting microscope and photographed, Fig. 2A/B & 2E/F, alongside more detailed inspection of the shell’s periostracum, Fig. 2C & 2G. To view the radula, head tissue was separated, incubated in lactic acid for three days, before mounting the radula onto a glass slide, with glass coverslip overlaid, then photographed under a light microscope (x1,000). Particular attention was given to morphology of the central and first lateral teeth, Fig. 2D & 2H.
For molecular taxonomy, snail genomic DNA was extracted using cetyltrimethylammonium bromide (CTAB) method, as adapted from [6]. Prior to tissue lysis, Phocine Herpes Virus (PhHV) was added to snail tissues as an internal extraction and later PCR amplification control for molecular xenomonitoring. Extracted genomic DNA was quantified using a NanoDrop Spectrophotometer (ThermoFisher Scientific, UK) then normalised to 10 ng/uL using ddH2O. For molecular taxonomy, a partial region of the mitochondrial ribosomal 16S gene was targeted and PCR amplified using the universal primers 16brm: 5’-CCGGTCTGAACTCTGATCAT-3’ and 16arm: 5’-CGCCTGTTTATCAAAAACAT-3’ following [7]. After amplification, agarose gel (2%) electrophoresis with SYBR™ Safe DNA Gel Stain (Invitrogen, Carlsbad, CA, United States) ascertained amplicon purity before Sanger Sequencing with forward and reverse primers at Source BioScience (Source BioScience, Cambridge, United Kingdom). Identical 16S sequences were obtained, allowing creation of a single consensus sequence using Mega11 [8]. Species were confirmed using a BLAST search [9]. Newly obtained sequences were then deposited in GenBank (accession number OR801605).
For molecular xenomonitoring of liver fluke infection, the assay of [10] was used implementing real-time PCR with TaqMan® probes. The following genus specific primers SSCPFaF: 5’-TTGGTACTCAGTTGTCAGTGTG-3’ and SSCPFaR: 5’-AGCATCAGACACATGACCAAG-3’, with species-specific TaqManÒ probes to detect Fasciola hepatica (Linnaeus, 1758) (ProFh: 5’-[6FAM]ACCAGGCACGTTCCGTCACTGTCACTTT[BHQ1]-3’) and Fasciola gigantica (Cobbold, 1856) (ProFg: 5’-[HEX]ACCAGGCACGTTCCGTTACTGTTACTTTGTC[BHQ1]-3’) were used. Real-time PCR reactions were performed using a MIC thermocycler (Bio Molecular Systems, Queensland, Australia) with positive control gDNA from adult worms of F. gigantica originating from Uganda.
The BLAST search of the 402 bp consensus sequence matched with 100% similarity, P. columella isolate LS3 mitochondrion genome (assession number NC_042905.1) from North America. Twenty additional identical 16S matches were noted, inclusive of P. columella from Brazil [11] and South Africa [12] . While we did not observe any snails shedding fluke cercariae, we did note, from molecular xenomonitoring, very weak amplification DNA signatures, with cycle threshold (Ct) values of 35. We consider these to most likely arise from spurious amplification of other trematode larvae [13]. In Africa, human and animal fascioliasis is typically transmitted by freshwater snails of the genus Galba or Radix [14], giving rise to an often allopatric transmission of F. hepatica and F. gigantica respectively [15]. Given the ability of P. columella to transmit both species of liver fluke, this alien intermediate host snail potentially adds a new dimension to this snail-parasite relationship in Malawi, although we presently conclude that there was no evidence for active liver fluke infection within our sampled snails.
To provide an insight into the ecology of P. columella, we review, in brief, the aquatic habitats where it was found. As shown in Fig. 1, sampling site Mangochi 1 is predominantly a stream habitat, immediately marginal and directly connected to Lake Malawi itself. Since Lake Malawi is well-known internationally as a global hotspot of biological diversity, the addition of P. columella to its species list is non-trivial. Indeed, its presence likely adds to the expanding list of ecological change within the lake and is pertinent to other snail-borne disease locally [16, 17]. This stream’s natural water supply is augmented by a pisciculture facility some 2-3 km inland, at -14.32813o, 35.128351o. Here, water is directly taken from the lake, pumped underground, returning overground following this stream’s natural path. Before pisciculture, this stream was seasonal but is now a conducive habitat throughout the year and reasonable to speculate that the presence of P. columella here was fully or partially attributable to local development(s) in pisciculture along the Lake Malawi shoreline. Another contributing factor would be the introduction and subsequent dispersion of invasive aquatic plants such as water hyacinth (Pontederia crassipes), now common across all collecting sites, on which P. columella was often found.
Following the Upper then Lower Shire River some 200 km southward, P. columella was found at Chikwawa 1, a natural and permanent oxbow lake of the Lower Shire River, Fig. 1. Upon more extreme seasonal flooding, this oxbow is directly connected to the river, which recently occurred in March 2023 by cyclone Freddy. Moving a further 100 km southward, both Nsanje 4 and Nansje 5 are seasonal flooded areas for informal pisciculture and small holder rice farming. Each are temporarily connected to the Lower Shire Valley upon natural inundation(s) and by managed sluice gates, Fig. 1.
Water chemistry data was collected for each snail sampling site at each visit, this data included temperature (°C), pH, conductivity (µS) and total dissolved solids (TDS) (ppm). Average data for Mangochi 1 was temp: 27.8 °C; pH: 8.1; conductivity: 517.6 µS and TDS: 264.6 ppm. Data for Chikwawa 1 was temp: 32.7 °C; pH: 8.4; conductivity: 627.2 µS and TDS: 308.7 ppm. For Nsanje 4 water chemistry was temp: 32.5 °C; pH: 8.3; conductivity: 443 µS and TDS: 221.8 ppm. Finally, for Nsanje 5 the data was temp: 30.1 °C; pH: 8.0; conductivity: 436.3 µS and TDS: 202.7 ppm. Across all 12 sites surveyed across all time points the average water chemistry data was temp: 29.3 °C; pH: 8.2; conductivity: 487.9 µS and TDS: 244.9.
Our report of P. columella considerably expands the known geographic range of this alien intermediate host snail species across southern Africa. We add to the malacological list of alien freshwater snails in Lake Malawi and Lower Shire River, contributing to a growing body of evidence for wider ecological change with new pressing need for further and more thorough surveillance of fascioliasis.