The tissue microarrays were stained with immunohistochemistry. The sections were deparaffinized in xylene and dehydrated through alcohol changes. The sections were stained with a PSMD6 rabbit polyclonal antibody (HUABIO). Antibodies were prediluted by the manufacturer, and staining was performed following the manufacturer’s protocols. Two pathologists independently reviewed the pathological specimens. Scoring was assessed according to a previous study description94.
ELISA
Plasma was collected from healthy volunteers or patients who were diagnosed with breast cancer or benign tumors and stored at -80°C°C. A standard curve of PSMD6 was established with standard samples in the kit (OmnimAbs). Fifty microliters of sample was added to the appropriate well of the antibody precoated microtiter plate and gently mixed. Incubate for 45 min at 37°C. The liquid was removed, the plate was dried by swing, and washing buffer was added to every well for 30 seconds; the buffer was then removed, and this process was repeated 4 times. Diluted biotinylated anti-IgG (50 µl) was added to the sample wells and incubated for 30 min at 37°C. The sample was washed and dried. Then, 50 µl of streptavidin-HRP was added to all wells and gently mixed. The sample was incubated for 30 min at 37°C. After washing three times, signals were detected using TMB solution and read at 450 nm.
Isolation of neutrophil plasma membrane proteins
Plasma membrane proteins were isolated from human peripheral blood-derived neutrophils with the MinuteTM Plasma Membrane Protein Isolation and Cell Fractionation Kit (Invent Biotechnologies, 89881) as previously described95 Briefly, cells were first sensitized by buffer A before passing through the proprietary filter in a zigzag manner when high-speed centrifugal force was applied, resulting in a cell lysate containing ruptured cell membranes and intact nuclei. As a result, nuclear contamination was virtually eliminated. The plasma membrane was further separated from the cell lysate (a mixture of crude membranes, intact nuclei, cytosolic proteins and organelles) by subsequent differential and density centrifugation with a regular tabletop microcentrifuge.
Tubule formation assay
A 96-well plate was coated with 50 µl of Matrigel per well, HUVECs were seeded in a Matrigel-coated 96-well plate at a density of 1.5 × 104 cells per well, and medium from neutrophils pretreated with cancer cell CM for 12 h (NCM) was added. After 6 h, pictures were taken with a light microscope (Olympus, Tokyo, Japan), and the Angiogenesis Analyzer plugin of ImageJ was used to count the number of branches and junctions.
Enzymatic activity assays
Enzyme activity assays were conducted as previously reported (Korkmaz et al., 2008). The PR3 enzymatic activity was quantified by detecting the rate of hydrolysis of the PR3-specific substrate (Abz)-VADnorVADRQ-(EDDnp) by cell suspension. To analyze membrane-bound PR3 activity, neutrophils were cultured in cancer cell CM or nonconditioned medium and treated with DMSO or sivelestat (10 mM) for 30–45 min at 37°C. Then, the cells were suspended in activity buffer (5×106 cells/ml, PBS, 4 mM EGTA, pH 7.4) with 20 mM PR3-specific substrate, and the kinetics of hydrolysis were determined by measuring the fluorescence at lex = 320 nm and lem = 420 nm.
GST-pull down
The GST pull-down procedure was conducted as previously reported (Nature methods.,2004). Fifty microliters of glutathione-magbeads were remixed with 300 µg GST-PSMD6 recombinant protein or GST protein for 2 hours. Then, the plasma member proteins of neutrophils were added and incubated for 16 hours at 4°C. Subsequently, the magnetic beads were washed with lysis buffer, and the proteins bound to the magnetic beads were analyzed by western blotting, MS and Coomassie electrophoresis staining.
Immunofluorescence (IF) staining
For murine tissue, tissues were perfused with 4% PFA for 24 h and washed once in 1×PBS for 30 mins, followed by 30–95% alcohol and n-butanol prior to being embedded in paraffin. Tissues were sectioned to 4 mm thickness, washed twice with PBS, permeabilized in 0.2% Triton X-100 for 15 min, and blocked in PBS containing 5% BSA for 45 min. CiH3 antibody (HUABIO, M1306-4) and MPO antibody (Proteintech Group, 22225-1-AP) were used for IF staining. For cancer cell IF staining, CLTA knockdown cells and control cells were seeded on coverslips coated with poly-L-lysine (WHB-24-CS-LC, WHB) in 24-well plates. After 24 h at 37 ℃, the cells were fixed with 4% PFA for 10 min at room temperature, washed three times with PBS and permeabilized in 0.1% Triton X-100 for 10 min. The cells were blocked in PBS containing 5% BSA for 30 min and then incubated with anti-CLTA (Proteintech Group, 10852-1-AP) and anti-PSMD6 (Santa Cruz, sc-393580) in blocking buffer overnight at 4°C. After three washes in PBS, the cells were incubated with fluorochrome-conjugated secondary antibodies (1:500, BIOESN) for 1 h and then counterstained with DAPI (ZSGB-BIO, ZLI-9557). Observation and photographing were performed with the confocal microscopy Cell Observer (Zeiss, Germany), and image processing and analysis were performed with Zen blue edition software (Zeiss, Germany). The Plugin-Colocalization Finder of ImageJ was used in the colocalization quantitative analysis. Pearson’s correlation coefficient and overlap coefficient according to Manders96 were used to quantitatively evaluate the colocalization results.
Mouse experiments
For the tail vein metastasis assay, 2 × 106 human breast cancer cells (MDA-MB-231 PSMD6 knockdown cells, mock cells, MDA-MB-231-LM2 PSMD6 overexpression cells, and normal control cells) were injected into the tail vein of 6-week-old nude mice (n = 4, 5 for each group). After 6 weeks, mice were killed by cervical dislocation, and the lungs were removed for fixation with 4% PFA. To observe neutrophil infiltration and NETs in vivo, 1×105 murine breast cancer cells (4T1-PSMD6 knockdown cells, mock cells, 4T1-PSMD6 overexpression cells, and normal control cells) were injected into the tail vein of 6-week-old BALB/c mice (n = 4, 5 for each group). After 1–2 weeks, the mice were killed by cervical dislocation, and lung or lung metastasis nodules were prepared as single-cell suspensions or fixed in 4% PFA.
RNAi and cell transfection
Lentivirus packaging was carried out by Shanghai Obio (China). For the knockdown of PSMD6 and CLTA, one validated hairpin (human PSMD6 target sequences: GAATGCCGTTACTCTGTTT, murine psmd6 target sequences: AGAGTTCTGTGTTTCTAAA), three validated hairpins (CLTA target sequences: GGAGCTAGAAGAATGGTAT, GAGCAGCTACAGAAAACAA, GAAGCAGAGTGGAAAGAAA) targeting the PSMD6 and CLTA transcripts were cloned and inserted into the pSLenti-U6-shRNA(PSMD6)-CMV-F2A-Puro-WPRE vector. For the overexpression of PSMD6, the full length of their transcripts was cloned and inserted into the CMV-MCS-3FLAG-SV40-puromycin vector.
RNA extraction and quantitative real-time polymerase chain reaction (qRT‒PCR)
Total RNA was isolated from breast cancer cell lines with an RNA easy fast cell kit (TIANGEN, Beijing). Reverse transcription (RT) of complementary DNA (cDNA) was carried out by using the TIANGEN mRNA qRT‒PCR starter kit (TIANGEN, KR116-01). SYBR Green PCR Master Mix was used to amplify cDNA aliquots. GAPDH served as an endogenous control. The sequences of the sense and antisense primers were as follows:
IL-6-F: CCTCTCTCTAATCAGCCCTCTG,
IL-6-R: GAGGACCTGGGAGTAGATGAG,
MMP9-R: GGCAGGGACAGTTGCTTCT,
MMP9-F: TGTACCGCTATGGTTACACTCG,
VEGF-R: AGGGTCTCGATTGGATGGCA,
VEGF-F: AGGGCAGAATCATCACGAAGT,
IL-8-F: TTTTGCCAAGGAGTGCTAAAGA,
IL-8-R: AACCCTCTGCACCCAGTTTTC.
Neutrophil isolation
To isolate neutrophils from murine lung metastasis nodules, lung metastasis nodules from 8-week-old BALB/C mice were harvested. Preparation of single-cell suspensions from lung metastasis tissues was performed with a gentleMACS Dissociator, followed by neutrophil isolation with a mouse tumor infiltrating tissue neutrophil isolation kit (P2430, Solarbio). Human neutrophils were isolated from the peripheral blood of healthy female volunteers with a human peripheral blood neutrophil isolation kit (P9040, Solarbio). Neutrophils were cultured in RPMI 1640 medium containing 0.2% BSA.
NET analysis
To analyze NET formation, neutrophils (1×105 cells) were seeded on coverslips coated with poly-L-lysine (WHB-24-CS-LC, WHB) in 24-well plates for 30 min before adding 50% cancer cell CM. After 6 h at 37°C, neutrophils were subjected to IF staining. Anti-histone H3 (1:200, M1306-4, HUABIAO) and anti-MPO (1:200, ET1703-21, HUABIAO) were used to stain the sections. NET area quantification was performed using a previously published method (Cardiovascular Research (2022) 118, 2179–2195). Briefly, NET-positive area (%) = (the colocalized area of MPO fl and CitH3 fl/the area of the tissue in each microscopic field using the 20x objective) *100%.
Two-chamber migration assays
The two-chamber migration assay procedure was previously described (Zhang et al. Molecular Cancer (2018) 17:146). Briefly, 1×105 MDA-MB-231 cells in DMEM were added to the upper chamber (11965092, Gibco), and a 1:1 mixture of DMEM and cancer cell CM, or medium from neutrophils cultured in cancer cell CM, was added to the lower chamber as the chemoattractant. The migrated cells in the lower chamber were counted after 12 h.
Western blotting
Western blotting was performed as described previously. In summary, total proteins were extracted from cells via RIPA buffer supplemented with protease and phosphatase inhibitors (Beyotime, Beijing), and aliquots of these proteins were separated by SDS/PAGE and visualized with Millipore Immobilon Western HRP substrate. The antibodies used in this assay included anti-PSMD6 (HUABIO, ER64500), anti-CLTA (Proteintech Group, 10852-1-AP), anti-a-tubulin (SAB,21581), anti-CD177 (SAB, 41689), anti-PRTN3 (Proteintech Group, 67030-1), anti-GPR78 (Elabscience, 40588), anti-Na+/K+ ATPase (HUABIO, ET1609-76), and anti-GAPDH (Proteintech Group, 60004-1).
Detection of circulating NETs
dHL-60 cells were induced from HL-60 by 1 µM ATRA for 5 days. dHL-60 cells were cultured in culture medium from PSMD6-overexpressing cells or PSMD6-knockdown cells for 6 hours. The culture medium of dHL-60 cells was detected by Quant-iT™ PicoGreen™ dsDNA (Thermo).
Statistical analyses
Data analyses were performed using GraphPad Prism 9.0 (GraphPad Software, La Jolla, USA). The data presentation and statistical analyses are described in the figure legends. P values < 0.05 were considered statistically significant. The in vitro experiments were repeated independently multiple times with similar results, as indicated in the figure legends.
Quantification and statistical analysis
Quantification methods and statistical analysis methods for plasma proteomic analyses were described or referenced in the respective Methods Details subsections.
Additionally, standard statistical tests were used to analyze the data, including but not limited to Student’s t test, rank sums test, ANOVA test, Kruskal‒Wallis test, Fisher’s exact test, and chi-square test. Statistical significance was considered when the p value < 0.05. All analyses of plasma proteomic data were performed in R, Python, and GraphPad Prism.