2.1 Editorial Policies and Ethical Considerations
Informed consent was obtained from all participants of both families according to the study protocol approved by the Ethics Committee of Wuhan University People's Hospital, and the study complied with the principles of the Declaration of Helsinki.
2.2 Patient recruitment and sample collection
Two independent family pedigrees were recruited for this study, and the two affected individuals and their parents underwent genetic sequencing. Both patients underwent a thorough ophthalmologic examination by a professional ophthalmologist, which included detailed visual acuity examination, lens fissure examination, vitreous, fundus, electroretinogram (ERG), and visual evoked potential (VEP) examination. Peripheral blood samples were collected from the two affected individuals and their parents, and the FRMD7 gene (GenBank ID: NM_194277.3) was amplified and sequenced for each subject.
2.3 DNA sequencing and mutation analysis
We employed the Blood DNA Mini kit(from Simgen Biotech in Hangzhou, China)to extract genomic DNA from peripheral blood samples. The genomic sequences were analyzed using whole exome sequencing(WES) to detect any mutations present. To construct a specific target gene acquisition library, polymerase chain reaction (PCR) was utilized, and the resulting products were subsequently purified and quantified. Sequencing was performed using the Illumina NextSeq 500 sequencer, which allowed for the crude data to be detached and then converted into identifiable base sequences using the CASAVA (1.8.2) software. Following this, a thorough bioinformatic analysis was carried out to review the mutations and select mutation sites based on clinical symptoms. Finally, familial Sanger sequencing was conducted to confirm the mutations detected by WES.
2.4 Plasmid vectors construction of mutant genes
The wild-type FRMD7 gene fragment was obtained from genomic DNA using nested PCR as the template. Two sets of primers were designed to introduce two types of mutations using overlapping extension PCR (Table1).
Table 1: PCR primer sequences
Primer
|
Base sequence
|
FRMD7-mut1-F
|
ccccaggtcttttttttatgtggacaagccac
|
FRMD7-mut1-R
|
gtggcttgtccacataaaaaaaagacctgggg
|
FRMD7-mut2-F
|
gcccaaggaatatcaaatgaagagctttca
|
FRMD7-mut2-R
|
tgaaagctcttcatttgatattccttgggc
|
pEGFP-C1-FRMD7-HindⅢ-F
|
GCTCAAGCTTGGatgctacatttaaaagtgca
|
pEGFP-C1-FRMD7-KpnI-R
|
CCGCGGTACCttaagctaaaaagtaattac
|
phage-FRMD7-SalI-F
|
TGACGTCGACtatgctacatttaaaagtgca
|
phage-FRMD7-NotI-R
|
CGACGCGGCCGCtagctaaaaagtaattacatg
|
The PCR products were digested using restriction endonucleases KpnI and HindIII, SAII and NotI, respectively. The target gene fragment was then ligated to the vector pEGFP using T4 DNA ligase. Plasmid was introduced into the bacteria by thermal excitation. After transformation, the bacteria were cultured on antibiotic medium(AMP, KANA), and successfully transformed bacteria were screened and cultured as monoclonal. The vector primers were combined with fragment primers for PCR bacteriological examination after which the positive bacterial solution was sent for testing. The plasmid was then extracted using the Rapid Plasmid DNA Small Volume Kit (Hangzhou Xinjing Bioreagent Development Co., Ltd.).
2.5 Cellular transient
Cells were purchased from China Center for Type Culture Collection (CCTCC). HEK293T cell line in good condition was used for transfection. Cells were inoculated into 6-well plates in accordance with the conventional culture after resuscitation, and the complete medium was added and incubated overnight at 37℃ in a CO2 incubator. The plasmid and Lipofectamine transfection reagent were diluted separately with serum-free medium OPTI-MEM, mixed and added to the wells of the plate, and incubated in the incubator.
2.6 qPCR
The total RNA extracted above was reverse transcribed into cDNA using the PrimeScriptTM RT kit according to the instructions. qPCR was performed using SYBR Green Mix. primers for the FRMD7 gene and vector were designed to detect the expression of FRMD7-wt/ mut1/mut2 (Table2).
Table 2: qPCR primer sequences
Primer
|
Base sequence
|
GFP-FRMD7-QPCR-F
|
GTCCTGCTGGAGTTCGTGA
|
GFP-FRMD7-QPCR-R
|
agatggctgcaactcaggtt
|
phage-FRMD7-QPCR-F
|
GCCTGACGTCGACtatgcta
|
phage-FRMD7-QPCR-R
|
agatggctgcaactcaggtt
|
2.7 Western Blot
HEK293T cells were transfected with pEGFP-C1-FRMD7-wt/mut1/mut2 plasmids and cultured under standard cell culture conditions. After 48 hours of culture, total protein was extracted from the cells. The BCA Protein Quantification Kit (purchased from Shanghai Yisheng Biotechnology Co., Ltd.) was used to quantify the protein under the guidance of the instructions. The protein samples were denatured, centrifuged, and subjected to protein gel electrophoresis. The separated proteins were then transferred to nitrocellulose membranes and blocked with 5% skimmed milk for 90 minutes. Anti-clonal primary antibodies were incubated overnight, followed by incubation with secondary antibodies for 1.5 hours before development.
2.8 Analysis of degradation pathways
HEK293T cells were transfected with pEGFP-C1-FRMD7-wt/mut1/mut2 plasmids and cultured under standard cell culture conditions. Upon reaching appropriate density, the cells were treated with MG-132 (a proteasome inhibitor) and CQ (a lysosome inhibitor) for 4 hours, respectively, while a negative control NC group was also included. GAPDH was used as an internal reference. Following completion of the incubation, cells were collected, and lysis buffer was added to extract intracellular proteins. Cell debris was removed by centrifugation, and the supernatant was collected. Protein concentration was determined using the Bradford assay. Western blot analysis was performed to assess the level of protein degradation.