Embryo manipulation and bead implantation
All animal experimental procedures followed guidelines established by the Institutional Review Board for the Care and Use of Laboratory Animals and authorized by the Institute de Investigaciones Biomedicas, UNAM. The experiments were performed on embryos (ALPES, Puebla, Mexico) at stages HH 22 and HH 28 (35). Eggs were windowed to expose the limb for bead implantation in the interdigital tissue, and Affi-Gel beads (Cat. 1537301, Bio-Rad) were soaked in 25 µg/ml TGF-ß1 (Cat. 100 − 21, Peprotech) or 1X PBS for controls. Moreover, Ag1-X2 ionic exchange beads (Cat. 1401231, Sigma-Aldrich) were soaked in 250mM 5-Aza-C (Sigma, Cat. 320-67-2) diluted in 50% Dimethyl sulfoxide (DMSO) (Sigma) or 50% DMSO for controls. Following the implantation, the eggs were incubated at 38°C according to each experiment.
In situ hybridization in whole limbs
Antisense RNA probes were labeled with UTP-digoxigenin (Roche, Cat. 11209256910) following the method described by Merino et al., 1998 [36]. The samples were treated with 60 µg/ml proteinase K for 21 min at 25°C to detect Sox9. For Raldh2, samples were treated with 28 µg/mL proteinase K for 20 min at 20°C. Post-fixation was conducted with 4% PFA + 0.2% glutaraldehyde in PBT for 20 min, which were rinsed with PBT. The signal was developed with BMPurple reagent (Roche, Cat. 11442074001).
Micromass cultures
Micromass culture protocol was modified from the original by Ahrens et al. 1977 [37]. We also collected limb buds from chicken embryos at stage HH 22 in a cold sterile 1X PBS solution. The limb buds were sheared using surgical forceps and transferred to a microtube. Then, we disaggregated by enzymatic treatments using 0.2% porcine trypsin (Merck) and 10 mg/µl Collagenase IV (Gibco) for 10 and 8 min, respectively. Afterward, DMEM-HG (Sigma-Aldrich) supplemented with 10% fetal bovine serum (FBS; Gibco) was added to inactivate enzymes. We centrifuged cells and washed the resulting pellet once with 1X PBS. Finally, we resuspended the cells in DMEM-HG (Sigma-Aldrich) by pipetting and adjusted the concentration to 2.5x104 cells/µl. Microdrops of 10µl were seeded in the center of 48-well plates, and cells were incubated at 37 ºC and 5% CO2 for 2 h. Afterward, we added DMEM-HG (Sigma-Aldrich) supplemented with 1X GlutaMAX (Life Technologies), 1X non-essential amino acids (Life-Technologies), 100U/mL penicillin/streptomycin (Sigma-Aldrich), and 10% FBS to the cultures. Daily, the culture medium was changed as indicated in the experimental conditions. For the duration of each experiment, a final concentration of 40 µM of either 5-Aza-C (Sigma, CAS 320-67-2) or DMSO (Sigma) was added to the experimental conditions.
Alcian blue and eosin staining in micromass cultures and whole limbs
After four days of micromass cultures, the medium was removed, and cells were washed once with 1X PBS. Fixation was performed with Khale's fixative solution for 20 min. Next, 0.1% Alcian Blue 8GX (Sigma-Aldrich) in 1N HCl was added and incubated overnight. Then, cultures were rinsed thrice with 1N HCl for 5 min each. In the experiments, cells were stained with eosin solution (Sigma) for 10 min immediately after alcian blue staining.
For limb skeletal staining, limbs were dissected in 1X PBS and fixed overnight in 100% ethanol. After that, limbs were dehydrated in acetone for 24 h and stained at room temperature in 0.3% alcian blue in 70% ethanol with 5% acetic acid. Limbs were then rinsed in tap water before clearing in 1% Potassium Hydroxide Solution and 20% glycerol for 24 h and finally stored in glycerol.
Quantification of the total area of the nodules in micromass cultures
The photograph scale was set at 206 pixels per millimeter using a millimetric ruler to calculate the area occupied by the nodules in the micromass cultures. Images were converted to 8-bit format; the threshold was set automatically, and the whole area of each stained nodule was measured. The total area was calculated by adding all areas of nodules. The Fiji image processing package was used (ImageJ2 v 2.9.0/1.53t).
In situ hybridization of micromass cultures
The micromass in situ hybridization protocol was performed as outlined in Chimal-Monroy et al. 2002 [38]. Once the micromass culture had been ongoing for 1, 2, or 4 days, the medium was removed, and cells were rinsed with a sterile 1X PBS solution. Subsequently, cells were fixed in 4% PFA for 4 h at 4°C. In the case of Sox9 and Scx probes, proteinase K was used at a concentration of 10µg/ml for 5 min at 20°C for 4-day micromass cultures, while 5 µg/ml of proteinase K was used for one day and 2-day micromass cultures. Post-fixation was conducted using 4% PFA + 0.2% glutaraldehyde in PBT for 20 min, followed by PBT rinses. Then, the signal was developed using BM-Purple alkaline phosphatase substrate (Roche Applied Science).
RT-qPCR of micromass cultures
We collected micromass cultures immediately after 6 h of 5-AzaC or DMSO treatments. Cells were detached through pipetting and collected in 1X PBS solution. Afterward, cells were centrifuged at 2500 RPM for 5 min at 4°C and removed the PBS. Samples were frozen at -70 ºC until RNA extraction. We performed RNA extraction with the NucleoSpin RNA kit (Macherey-Nagel) according to the manufacturer's protocol. RNA was quantified using a NanoDrop One spectrophotometer (Thermo Fisher). Then, we used 200 ng to perform the cDNA synthesis using the M-MLV reverse transcriptase enzyme (Promega), following the manufacturer's protocol.
RT-qPCR reaction was performed using SYBR Green Master mix (Thermo Fisher) on 1µl of cDNA adjusted to 0.5 µg/µl. The reaction mix was divided into two technical duplicates, and the amplification was conducted using a Rotor-Gene Q thermocycler (Qiagen). The amplification consisted of 40 cycles with different temperatures of 94°C for 5 min, 60°C for 30 sec, and 72°C for 45 sec, followed by a final extension of 10 min at 72°C. The Rpl-13 gene was used as a housekeeping and a melting curve to analyze the specificity of each oligonucleotide. The expression levels were assessed relative to the housekeeping using the 2−(ΔΔCt) equation. The mean ± SD of three independent experiments was calculated for each value. A paired Student's t-test was conducted for statistical analysis, and significance was set at p < 0.05. Table 1 presents the sequences of primers used in this study.
Table 1
Oligonucleotide sequences employed for qRT-PCR
Gene
|
Forward (5’-3’)
|
Reverse (5’-3’)
|
Bigh3
|
Cttctgacctcaacagcttgc
|
gatcctgttcagcatctctcg
|
Cyp26
|
Gccgtctcttcgaggtctac
|
cactgaagggcagatccaca
|
Dnmt3a
|
Gcaggatagccaagttcagc
|
cacaggatgtcttccttctcg
|
Dnmt3b
|
caagaggctgaagagcaacc
|
cgctgttgttcgtaacttcg
|
Ncam
|
Gagttcgatgagcctgaagc
|
gagtgccattctccttcacc
|
p21
|
Cgtagaccacgagcagatcc
|
cgtctcggtctcgaagttg
|
Raldh2
|
Gagacagggcagttcttgct
|
tgcccaaccagcgtaatacc
|
Rhoc
|
Caggaagaagctggtgatcg
|
aacacagttggcacgtagacc
|
Sox9
|
ctgaagaaggagagcgagga
|
gtccagtcgtagcccttcag
|
Tnc
|
Ggagcatacggtgaatgagg
|
agcaggtccttgatgtctgg
|
Image acquisition and processing
All images were acquired and analyzed using an AxioZoom V.16 stereoscopic microscope (Carl Zeiss, Oberkochen, Germany) and Zen lite software (Carl Zeiss, Oberkochen, Germany).