Experimental design:
From the animal house of Kafer El-Sheikh University, albino Wistar rats (40 rats with average weight = 200 g) were assigned. The temperature of the housing room was kept at 25° C. Animals were allocated into four groups (n = 10). It was ensured that chow and water were provided in a sufficient supply. ARRIVE guidelines were implemented during the design of the current study protocol (7).
As shown in (Fig. 1), intraperitoneal (I.p.) injections were used in the control group (C-group) to administer a single dose of citrate buffer (CB) (1 ml/kg b.w.). The hesperidin group (HSD-group) received CB, after 3 days rats received HSD (Laboratory Scientific Supplies FZC, UAE) [50 mg/kg b.w./day] (8) mixed with carboxy methyl cellulose (0.1%) (Laboratory Scientific Supplies FZC, UAE). HSD was administered by oral gavage for 28 days.
The streptozotocin group (STZ-group) was treated with a single dose of STZ (50 mg/kg b.w., I.p. injection) (9). After 3 days, blood glucose (BG) level was estimated. If the value was less than 200 mg/dl, the rat was excluded. Hesperidin + Streptozotocin group (HSD + STZ group) received STZ, and blood was checked for blood glucose to ensure the accomplishment of the diabetic model then received HSD/day for 28 days.
Blood samples were obtained at the end of the experiment from rats’ tail veins. Blood was centrifuged. For further biochemical analysis, serum was stored (-20°C). After blood samples collection completed, passive avoidance (PA) and Morris water maze (MWM) tests were done with documentation of the results. Sodium pentobarbital (60 mg/kg b.w., I.p.) was used in the process of rats’ euthanization. Hippocampi were collected. The left one was homogenized for further biochemical examinations. The right one was preserved in 10% formalin.
Cognitive functions examination:
As described by Beheshti et al. (10), in order to assess spatial learning and memory abilities, MWM test was performed. Rats swam in a circular pool of water (25° C) with a platform in the middle. Rats search for the platform for five days in an estimated time and results were documented. At the 6th day, spatial probe test was performed. The same protocol [Beheshti et. al. (10)] was followed to assess the latency of the rat to enter the dark place by performing the passive avoidance test.
Histopathological examination:
As described by LI et al. (11), histological examinations of the right hippocampi were done. Three histopathologists (Blinded to our study), performed the examinations and the scoring. The scoring criteria are enlisted in Table 1.
Table 1
Histopathological scoring according to the severity of the lesions.
Score | Severity |
0 | No lesion |
1 | Mild lesion |
2 | Moderate lesion |
3 | Sever lesion |
Terminal deoxynucleotidyl transferase biotin-dUTP nick end labeling (TUNEL) assay:
As described by Watanabe et al. (12), TUNEL assay was performed. Examinations were done by expert pathologists blinded to our research.
Biochemical analysis of hippocampus homogenate:
Hippocampus homogenates were centrifuged (3X1000 rpm, 15 min.) to separate supernatants. ELISA kits (# ab100771) (Abcam, USA), (# RAB0278) (Roche, Switzerland), (# 100764) (Abcam, USA), and (# RAB0480) (Roche, Switzerland) were used to estimate the levels of interleukins 4, 6 and 10 (IL-4, IL-6, IL-10) in addition to tumor necrosis factor-α (TNF-α) respectively (Following the manufacturer protocol). Beheshti et al. (10) protocol was followed to assess malondialdehyde (MDA) content. As per Aebi et al. (13), superoxide dismutase (SOD) and catalase (CAT) were determined. In addition, total reactive oxygen species (ROS) content was estimated.
Real-time quantitative PCR analysis:
In order to quantify of the regulating genes of IL and TNF-α (14), real-time polymerase chain reaction (PCR) was used with the following conditions [Forty cycles of 96°C (Twenty sec.), 63°C (Thirty sec.), and 72°C (Thirty sec.)]. The primers sequences were enlisted in Table 2.
Table 2
List of primers sequences used for the analysis of gene expression.
| Gene | Forward primer sequence | Reverse primer sequence |
Inflammation | IL-6 | CACACGTCGGGAGAGG-AGAC | ACAGTGGATCATCGCTCTTC |
TNF-α | GAGAGACCGGCTGCTGGAAC | TGGAGATTATGATGACCGTA |
IL-4 | CTCAGGACGGTAAGGTTCAATG | GTTTACCCGCCGATGTTGTCG |
IL-10 | CCCTTCCATACTCCACGTTGG | TAATAGCCCTGGCACCTCGGC |
Control | Actin, beta | GGGCACAGTGTGGGTGAC | CTGGCACCACACCTTCTAC |
Statistical analysis:
For the statistical analysis, statistical package for social sciences (SPSS) software, 23.0 V. was used. The statistical significance of differences was validated using one-way analysis of variance (ANOVA). Post hoc Tukey-Kramer test was used for groups comparison. Data were expressed in mean ± standard deviation and probability value was considered significant if < 0.05.