Plant materials
The following cassava varieties: YTP-1, YTP-2, S. Jaya, S. Athulya, H-165, TME-419, UMUCAS-36, MVD-1, H-226 and white Thailand were grown at the organic orchard of Tamil Nadu Agricultural University Coimbatore, India. Freshly harvested 12 months old cassava storage root and leaf samples were used for the RNA isolation.
Reagents
All the reagents were prepared with 0.1% diethylpyrocarbonate (DEPC) treated water.
-
Extraction buffer.
-
DEPC-treated water.
-
Chloroform.
-
Isopropanol.
-
70% Ethanol.
The extraction buffer contains the following: Phenol solution (Equilibrated with10mM Tris HCL pH 6.7 ± 0.2 with 1mM EDTA) procured from HIMEDIA laboratories pvt LTD, India (#catalogue number MB082), Sodium acetate [NaOAc; 0.32 M (w/v)], Sodium dodecyl sulphate [SDS; 0.1% (w/v)] and ethylenediamine tetra acetic acid (EDTA; 0.01 M pH 8.0). For working concentration of the extraction buffer, in a 50ml falcon tube, add 10ml of phenol solution, 5ml of 0.32M NaOAc, 5ml of 1% SDS and 5ml 0.01M EDTA. Before commencing the isolation process, all plastic materials, spatulas, mortars and pestles were autoclaved.
RNA Isolation Protocol
Prior to standardizing the present protocol, two different commercial RNA isolation kits were explored in the isolation of RNA from cassava storage roots, and agglomerate formation was observed after adding the extraction buffer to the extracts (Fig. 1), which made us discontinue using the kits and proceeded with the protocol below:
100 mg of cassava leaf or storage root was ground to a fine powder in liquid nitrogen using a mortar and pestle. 3 ml of extraction buffer was added and ground well. (The extraction buffer freezes the plant tissue when added, therefore to make a fine powder of the frozen material, grind further to mix well).
900 µL of DEPC-treated water was added and mixed well with the pestle. The content was transferred to a 15 ml falcon tube and kept at room temperature for 5 min. Then, 300 µL of chloroform was added to the extract and vortexed for 5–8 seconds, and kept at room temperature for 10 min. The extract was centrifuged at 10,000 rpm for 10 min at 4°C and the upper phase was transferred to a new tube. 0.7 volumes of ice-cold isopropanol was added and vortexed for 5–8 seconds and kept for 10 min at 4 oC. The tube was centrifuged at 10,000 rpm for 10 min at 4°C and the supernatant was discarded. RNA pellet was washed with 70% ethanol, air dried and dissolved in 50–100 µL of DEPC-treated water.
Assessment Of RNA Quality
The concentration and purity of the RNA samples were assessed by determining the absorbance at 260 and 280 nm using a spectrophotometer (Genona Nano 69357, Cole-Parmer LTD, Uk).
Integrity of the RNA samples was evaluated by the 28S, 18S and 5S rRNA bands observed from 2 µL total RNA in the 1.2% agarose gel electrophoresis. The gels were stained with ethidium bromide and visualized under UV light. The photographs were taken using Vilber Bio-print (Vilberlourmat, India) gel documentation system.
Reverse Transcription-Polymerase Chain Reaction (RT-PCR)/ Real Time quantitative PCR analysis (RTqPCR) analyses.
The total RNA was treated with DNase 1-RNase-Free solution (Thermo Fischer Scientific, India), 4 µL of total RNA from the cassava tubers were reverse transcribed in a total of 20 µL reaction using Oligo dT primer (1 µM) and digested with RNase I following the instructions in PrimeScript™ 1st strand cDNA synthesis kit (Takara, India). Synthesis of first strand cDNA of the treated total RNA was carried out, then the cDNA was used as a template for amplification in the RT-PCR. Separate reactions containing no-RT and no-template were added as controls. PCR was carried out with Taq DNA polymerase (Thermo Fischer Scientific, India) using gene-specific primers. For PCR, the condition was as follows: initially, denaturation at 94°C for 2 mins, followed by annealing for 30 cycles of 30 secs at 94°C, 30 secs at 54°C, and 30 secs at 72°C. The final extension occurred at 72°C for 5 mins.
The quantitative Real-Time PCR analysis was carried out in a Mastercycler® nexus thermocycler (Eppendorf, India). The selected reference genes used were Ubiquitin conjugating enzyme E2- 10 (U10), Glyceraldehyde-3-phosphate dehydrogenase (G3pdh) and Ribosomal 18S, with the following pairs of primer sequences: forward: 5′- AAGCCAGTCACTGTTTTCGG − 3′, reverse: 5′- CGTACCTTCAAGTGAGCAGC − 3′, forward: 5′- AGTCACTATTCATTTCCCGCCCGA − 3′, reverse: 5′- TGTCCAGACAAATGCTTCCGTTGC − 3′ and forward: 5′- ATTGGAGGGCAAGTCTGGTG-3′, reverse: 5′- CTTCAAAGTAACAGCGCCGG − 3′ respectively (Table 1).
The reaction was carried out in a final volume of 20 µl using SYBR® Green Master Mix (India) following the manufacturer’s instructions. The qPCR condition was set as follows: denaturation at 94°C for 30 secs; 45 cycles of 94°C for 5 secs, 60°C for 15 secs and 72°C for 10 sec, including melting and cooling. Finally, the PCR products were analyzed on 1.2% agarose gel electrophoresis and visualized with Vilber Bio-print gel doc system.
Table 1
Primer sets of the selected reference genes used for RTqPCR
S/N
|
Gene name
|
Forward 5' → 3'
|
Tm
|
Length
|
Reverse 5' → 3'
|
Tm
|
Length
|
1.
|
Ubiquitin
conjugating
enzyme E2- 10 (U10)
|
AGTCACTATTCATTTCCCGCCCGA
|
59.9
|
24
|
TGTCCAGACAAATGCTTCCGTTGC
|
59.9
|
24
|
2.
|
Glyceraldehyde-3-phosphate dehydrogenase (G3pdh)
|
AAGCCAGTCACTGTTTTCGG
|
58.69
|
20
|
CGTACCTTCAAGTGAGCAGC
|
58.93
|
20
|
3.
|
Ribosomal 18S
|
ATTGGAGGGCAAGTCTGGTG
|
59.96
|
20
|
CTTCAAAGTAACAGCGCCGG
|
59.83
|
20
|