Animals
Adult male C57BL/6 mice (two month old) were purchased from Changzhou Cavens Laboratory Animal Co., Ltd. The mice were housed in groups of four to five per cage with ad libitum access to food and water, and were maintained under a 12-h light/dark cycle (lights on at 7:00 p.m., off at 7:00 a.m.) at a stable temperature (22 ± 2°C). In the present study, we have complied with all relevant ethical regulations for the animal testing and research. All procedures were approved by institutional guidelines and the Animal Care and Use Committee (Shenzhen University, Shenzhen, China) of the university’s animal core facility.
Behavioral tests
Open field test (OFT)
The OFT is used to measure the anxiety-like behavior in mice. The OFT apparatus is made of transparent plastic (50 cm × 50 cm× 40 cm, length × width × height) and the central zone area was defined as 50% of the open field arena. Each mouse was brought to the room and acclimated for at least 1 hour before the behavioral test. Individual mouse from each group was placed in the center area of the arena and permitted for free exploration. Their activity was videotaped from the top of the arenas for 10 min by a video camera. The time spent in the center area, the number of central area crossings, and center moving distance were recorded by video-tracking and behavioral analysis software (SMART v3.0 software).
Elevated plus maze (EPM)
EPM was performed to evaluate the anxiety-like behavior in mice. The EPM apparatus consists of two opposing open arms (66 cm × 6 cm) and two opposing closed arms (66 cm × 6 cm) intersecting at 90 degrees in the form of a plus, with a central area (6 cm × 6 cm). The EPM was elevated 50 cm above the floor in a dim and quiet room without any human disturbance during the test. Mouse from each group was placed in the center area and allowed to explore the EPM for 10 min freely. The time spent in open arms, the total number of entries into the open arm and total distance in open arms were recorded by video-tracking and behavioral analysis software (SMART v3.0 software). Between each trial, the maze was cleaned with 75% ethanol.
Cell culture
For primary mouse astrocyte culture, astrocytes were isolated from 12-24 hours neonatal C57BL/6 mice. The cortex was isolated and minced into ice‐cold Hank's buffered saline solution, and incubated in 0.25% trypsin at 37 °C for 15 min. Then the tissue was gently triturated eight to ten times to dissociate the cells and obtain a homogenous cell suspension. The density of cells was determined by a hemocytometer. Astrocytes were planted with the DMEM‐high glucose medium containing 10% FBS onto poly-D-lysine-precoated flasks. After 5-7 days, when the cell density reached 75%-90%, the astrocytes were sorted at shake cultivation rotating at 200-220 r/min overnight. Then the medium was discarded and the cells were incubated with DMEM containing 0.25% trypsin for 5 min, and centrifuged at 1000 g for 5 min after addition of the culture medium. After resuspension, cells were plated onto culture plate with 5×105 per well for western blotting and RT-qPCR analysis and 1×105 per well for cell imaging. The culture medium was changed every 3 days throughout the cultivation process.
HEK293 WT cells were cultured with 90% DMEM‐high glucose medium and 10% fetal bovine serum (FBS), 100 U/ml penicillin, 0.1 mg/ml streptomycin (all from Hyclone) at 37 °C in the presence of 5% CO2. Transfection was performed with Neofect (Neofect biological Technology, Beijing) when cells were cultured to 70%~80% confluence in six‐well plates. 48 hours after transfection, cells were collected and lysed for further research.
Western blotting and Co-immunoprecipitation
Mice hippocampal CA1 were carefully separated using a microtome in ice-cold PBS, then homogenized in RIPA buffer containing 1mM PMSF and 0.1% cocktail. Cultured cells were washed with ice-cold PBS twice and homogenized in RIPA buffer as described. After centrifugation at 10000 g for 15 min, the supernatant was extracted and protein concentration test was taken up, the loading buffer (50Mm Tris-HCL, 2% SDS, 10% glycerol, pH 7.6) was added in the homogenates and samples were boiled at 95 ℃ for 10 min. The protein samples were separated by SDS/PAGE and transferred onto nitrocellulose membranes (Whatman), then incubated with primary antibodies at 4 ℃ overnight. Secondary antibodies incubation was performed at room temperature for 1 h. Immunoreactive bands were visualized with an electroluminescence kit and scanned for densitometric analysis using an imaging system (Image Station 4000 M; Kodak).
For co-immunoprecipitation, cells after treatment were homogenized in RIPA buffer containing 1mm PMSF and 0.1% cocktail, then centrifuged at 12,000 g for 10 min. The supernatant was incubated with primary antibodies at 4 ℃ for 6 hours followed by a 2-hour incubation with protein A + G agarose. The resins were washed three times with PBS, resuspended with 2 × loading buffer and boiled at 95 ℃ for 10 min. Immuno-precipitates were analyzed by western blotting.
RT-qPCR
Mice brain tissues were dissected and immediately frozen in liquid nitrogen. Cultured cells were quickly collected and incubated with ice-cold TRIzol (No. 15596026, Invitrogen, USA) after the medium removal. Total RNA isolation from mice brains and cultured cells were performed following the manufacturer’s protocol. The RNA concentration and purity were measured using a NanoDrop 2000 spectrophotometer (Thermo Scientific, USA). The RNA-to-cDNA reverse transcription reaction was carried out using a Prime Script RT Kit (RR047A, Takara, Japan). Briefly, right before reverse transcription reaction, the genomic DNA removing reaction was performed at room temperature for 30 min, and then the reaction mixture was added to the RNA solution, and the RNA/reagent mixture was incubated at 37 °C for 15 min, further heated at 85 °C for 5 sec, and cooled to 4 °C. RT-qPCR was performed using SYBR Master Mix on a Bio-Rad Connect Real-Time PCR platform (Bio-Rad, USA). The reaction was carried out in a DNA thermal cycler under the following conditions: 95 °C for 30 s, 39 cycles of 95 °C for 5 s and 60 °C for 30 s, 72 °C for 30 s, and 95 °C for 15 s, 60 °C for 30 s, 95 °C for 5 s and 4 °C for 60 s. The resulting Cq values were calculated (using the 2-ΔΔCT method) and β-actin was used as a housekeeping gene. The RT-qPCR primer sequences are listed in Table 1.
Immunofluorescence
Cultured cells were fixed in 4% (vol/vol) paraformaldehyde for 15 min and permeabilized in phosphate buffer containing 0.5% triton X-100. Non-specific binding was blocked by PBST buffer containing 3% BSA for 1 h. Primary antibodies were incubated at 4 ℃ overnight. The secondary antibodies conjugated to Alexa-Fluor 488/546 were added to the coverslip for 1 h at 37 ℃, followed by Hoechst staining for 10 min. The coverslips were washed and mounted onto slides. All the images were observed with the LSM880 confocal microscope (Zeiss, Germany).
Viruses, Reagents and Antibodies
The IKKα-HA, IKKβ-HA, IKKγ-HA, IκBα-HA and EGFP-HDAC7 plasmids were constructed in the pcDNA3.1 vector. The HDAC7 overexpression lentivirus lenti-GfaABC1D-HDAC7-P2A-eGFP, HDAC7 knockdown lentivirus lenti-GfaABC1D-shHDAC7-eGFP(mir30), AAV-GfaABC1D-HDAC7-eGFP and corresponding controls were constructed and packaged by Obio Technology (Shanghai, China), and the target sequences of HDAC7 are TGCGCTACAAACCCAAGAAAT and CCATGTTTCTGCCAAATGTTT. Lentiviruses were used in primary astrocytes with Multiplicity of infection (MOI) of 10. AAV2/8 was used in mice experiments.
Lipopolysaccharide (LPS) from Escherichia coli, strain 055: B5 was purchased from Absin (Shanghai, China). TMP195 (a selective class IIa HDAC inhibitor) was purchased from Selleck (Shanghai, China). All other reagents were from Sigma-Aldrich (USA).
IKKα (1:500 for WB, 2682), IKKβ (1:500 for WB, 2678), IKKγ (1:500 for WB, 2695), IKBα (1:500 for WB, 4814), Iba1 (1:50 for IF, 36618), NF-κB (1:500 for WB, 1:100 for IF, 1:100 for IP, 8242), p-NF-κB-Ser468 (1:500 for WB, 3039), p-NF-κB-Ser536 (1:500 for WB, 3033), HA Tag (1:500 for WB, 1:100 for IP, 3724), Acetylated-Lysine (1:1000 for WB, 9441), IgG (1:100 for IP, 2729), GFAP (1:1000 for WB, 1:200 for IF, 36707), INOS (1:500 for WB, 1:100 for IF, 13120), Il1α (1:500 for WB, 50794), P38 (1:1000 for WB, 8690), p-P38 (1:1000 for WB, 4511), ERK1/2 (1:1000 for WB, 4695) and p-ERK1/2 (1:500 for WB, 4370) were from Cell Signaling. HDAC4 (1:1000 for WB, 07-1490), HDAC7 (1:1000 for WB, 1:100 for IF, 1:100 for IP, H2662) were from Thermo Scientific. HDAC5 (1:1000 for WB, ab55403), HDAC9 (1:1000 for WB, ab109446), NeuN (1:200 for IF, ab104224), LaminB1 (1:1000 for WB, ab16048), COX-2 (1:500 for WB, ab179800) and beta-actin (1:1000 for WB, ab6272) were from Abcam. Iba1 (1:200 for IF, 012-26723) was from Wako.
Statistical analysis
Data are expressed as mean ± SEM and analyzed using the GraphPad Prism 8 statistical software. The one-way or two-way ANOVA was used to determine the differences among four groups and the Student’s t test was used for two groups. The significance was assessed at p < 0.05.