Generation and maintenance ofCldn17−/−mice. All the mouse-related experiments were performed with the approval of Charlie Norwood Veterans Affairs Medical Center Institutional Animal Care and Use Committee (approval references #19-04-114 and #20-01-118) and were in accordance with the ARRIVE guidelines for reporting experiments involving mice. Ketamine and xylazine were administered intraperitoneally in combination for inducing anesthesia. Carbon dioxide asphyxiation followed by cervical dislocation was used for euthanizing undesired mice. To generate knockout mice (Horizon Discovery, Lafayette, LA), ten suitable sgRNAs for CRISPR/Cas9 knockout in C57BL/6 mice zygotes were performed, and the most potent sgRNA with minimal off-target potential was assembled into the ribonucleoprotein complex with Cas9 endonuclease (gRNA Binding/PAM Site 5’◊ 3‘: tcggtttggttgggacgattGGG; Forward Primer 5’◊ 3’: agaagaccaggcactcctct and Reverse Primer 5’◊ 3’: tcatgccgcagatgccaata for genotyping). These were delivered into zygotes from C57BL/6 mice followed by embryo transfer into pseudo-pregnant females. Genomic PCR and DNA sequencing analyzed viable progenies for the presence of the desired mutation. Each small guide RNA were validated by transfection into cultured cells, and assessed cutting efficiency by the Surveyor Cel 1 Mutation Detection assay. The two smaller cleavage bands added up to the size of the parental band. The ratio of the intensity of the cleavage bands relative to the parental band was used to assess cutting efficiency. Up to two selected transgenic founder mice were bred with C57BL/6 mice to produce F1 progeny heterozygous for the Cldn17−/−, as confirmed by the PCR mediated genotyping and DNA sequencing analysis. Off-target analysis and on-target sequence confirmation in F1 mice were also performed, which consisted of PCR and sequencing of the top 10 predicted off-target sites. Cldn17+/− mice were eventually bred to obtain homozygous Cldn17−/− mice used in the study. A detailed genotyping protocol is provided in (Supplementary Figure 8).
RNA isolation, cDNA preparation, and qRT-PCR. Mice lungs were collected, and RNA was extracted using an RNA isolation kit (RNeasy Plus, Qiagen, Valencia, CA), and RNA quality was confirmed using Nanodrop 2000 spectrophotometer (Thermo Scientific). Complementary DNA (cDNA) was synthesized from 700 ng of RNA using RT2 First Strand kit (Qiagen) using a StepOne Plus thermal cycler and detection software (Applied Biosystems, Foster City, CA), and quantitative real-time PCR (qRT-PCR) was performed using the RT2 SYBR Green ROX qPCR Mastermix (Qiagen) in real-time PCR equipment (Applied Biosystems). Sample cDNA was amplified and quantified over many shorter cycles under the following conditions: an initial 10 min 95°C period followed by 45 cycles of 95°C for 15 s, 60°C for 1 min and 72°C for 15 s. The threshold cycle (Ct) was determined using the exponential growth phase and the baseline signal from fluorescence vs. cycle number plots. The mouse primers used for the messenger RNA (mRNA) analysis of Cldn17 were 5’-tctccctccggtactgga ag-3' (forward) and 5’-gctcctccaagttctcgc tt-3' (reverse) and the primers for β-actin, used as a house-keeping control gene, were 5’-tttgagaccttcaacacccc -3' (forward) and 5’-atagctcttctccagggagg -3' (reverse).
Western blot analysis. It was performed as described in previously published studies51, 52. Western analysis was performed on the cell lysates prepared using 1X RIPA lysis buffer (Millipore, Temecula, CA) supplemented with protease and phosphatase inhibitor tablets (Roche Applied Science, Indianapolis, IN). The DC protein assay reagent was used for protein estimation in the lysates (Bio-Rad Laboratories, Hercules, CA). Approximately 30–40 µg of heat-denatured cell lysates prepared in Laemmli buffer were loaded onto the SDS-PAGE gels. Densitometry was performed using the NIH ImageJ software. Antibodies used include Cldn17 from Abcam (ab23333) and LSBio (LS-C3063), SOD1 (2770S, Cell Signaling Technology, and β-actin (A5441, Sigma).
Analysis of serum electrolytes, blood, and urine parameters. WT and Cldn17−/− mice were subjected to retro-orbital puncture to collect around 800 to 1000 µL of blood. A part of the collected volume was used for a complete blood count. The rest was processed for the analysis of serum electrolytes and proteins levels. While ion-specific electrode (ISE) method was used to assess serum sodium, potassium, and chloride levels, Siemens Advia 2120i hematology analyzer was utilized for complete blood count, which is a flow cytometry-based system that uses light scattering, differential WBC) lysis, and myeloperoxidase and oxazine 750 staining to provide a total blood cell count, a WBC differential, and a reticulocyte count. A cyanide-free method was used to measure hemoglobin calorimetrically. Urine was collected from WT and Cldn17−/− mice using metabolic cages to determine various parameters, including pH, EpCs, blood cells, and others.
Bone analysis using micro-computed tomography (µCT). Three-dimensional analyses of femurs and tibiae were performed using a µCT scanner (Skyscan 1272, Skyscan, Kontich, Belgium). The X-ray tube was set to a voltage of 80 kV, and a 1 mm aluminum filter was used to reduce beam hardening artifacts. Samples were scanned in 70% ethanol. For each sample, 265 section images were reconstructed with NRecon software (version 1.7.3.1, Skyscan). Three-dimensional modeling and analysis of BV (Bone Volume)/TV (Total Volume) ratio (percentage of bone tissue), trabecular number and thickness, and Bone marrow density were obtained with the CTAn (version 1.17.7.2, Skyscan) and CTVol (Realistic 3D visualization version 2.3.2.0, Skyscan) software. The Dataviewer (version 1.5.6.2, Skyscan) software was used to generate 3D cross-sectional imaging of bones. The dissected bones were then processed for histological and histomorphometry analysis.
Mile’s assay. Vascular permeability in vivo was assessed using the Miles assay as described previously53. WT and Cldn17−/− mice were injected with Evan's blue dye at a concentration of 1% intravenously or 2% intraperitoneally followed by a 30 minute or three-hour interval, respectively, before the mice were euthanized using CO2. The mice were then perfused with 1X PBS to wash out the excess dye, and finally, the organs (lung, liver, kidney, ear, eye, and brain) were collected and stored in formamide for the next 24 hours at 42℃. The absorbance of formamide was then assessed at a wavelength of 610 nm using a calorimetric device which was normalized to the weight of the organ used to determine the vascular leakage.
Matrigel plug assay. Matrigel plug assay was performed in accordance with a procedure described in a previous study28. On day 7, mice were euthanized to collect Matrigel plugs which were then digested using 5 ml Drabkin's reagent (Sigma D5941) and quantified for neo-vessel formation using a hemoglobin assay according to the manufacturer's protocol.
Organ injury and wet/dry ratio analysis. Age- and gender-matched WT and Cldn17−/− mice were euthanized to collect their organs, then processed for histological examination and determination of tissue edema. One of the liver lobes, the right superior lobe of the lung, and one of the kidneys were fixed in 4% paraformaldehyde, and 10 µm thick sections were processed for H&E staining. Histological assessment of these slides was performed by examination of tissue fields by blinded reviewers based on scoring from 1 to 5, with one being the best and five being the worst (severe most injury), and averages of these scores were considered for statistical analysis. While interstitial congestion, inflammatory cell infiltration, and consolidation were considered for lung analysis, mineralization, vacuolar degeneration, and Bowman's capsule spacing were taken into consideration for kidney scoring. The left lobe of the lung, one of the kidneys, and fecal pellets was weighed when fresh, followed by incubation in an oven for 72 hours on sterile papers at 80°C to remove all moisture content. The dry weights were then recorded to calculate the wet/dry ratios, which determine edema or fluid content.
RNA-Seq and bioinformatics analysis. Kidneys were isolated from WT and Cldn17−/− mice and stored in Trizol® before freeze-drying. Samples were then subjected to RNA isolation, and total RNA purity and concentration were evaluated by spectrophotometry using NanoDrop ND-1000 (ThermoFisher). Total RNA quality was assessed by the Agilent 2100 bioanalyzer (Agilent Technologies) and assured of an RNA Integrity Number (RIN) greater than 5. Total RNA samples were processed for cDNA library preparations using TruSeq Stranded Total RNA kit (Illumina), which depletes cytoplasmic ribosomal RNA. Briefly, 800 ng of total RNA was treated with rRNA Removal Mix to deplete rRNA. Following purification, the RNA was fragmented into small segments, 200-300 bp in size, and converted to cDNA fragments. These cDNA fragments then had the addition of a single 'A' base and subsequent ligation of the adapter. The products were purified and enriched with PCR to create the final cDNA library. The prepared library was examined by bioanalyzer and Qubit (Thermofisher) to test library quality and quantity, respectively. The libraries were pooled and ran on the NextSeq500 sequencing system using a 75-cycle paired-end protocol. BCL files generated by the NextSeq500 were converted to FASTQ files for the downstream analysis. Reads passed the quality control were aligned to the reference genome, starting with the STAR aligner. The generated BAM files in a comparative setup were imported to the following Cufflinks and Cuffdiff tools from Tuxedo Suite for outputting differentially expressed genes with log2 fold changes and q values having replicates. Genes with p-values of less than 0.05 were taken into consideration for bioinformatics analysis which was performed using gene set enrichment analysis (GSEA) and gene ontology (GO). R programming was utilized to generate graphs, including the volcano plot for the modulated genes, and the Panther database was used to identify signaling pathways based on significantly altered genes.
Flow cytometry analysis. Blood was collected through retro-orbital technique in EDTA-treated collection tubes. Around 100 µL of blood was mixed with 1 mL of ACK lysing buffer and allowed to incubate at room temperature for 3 to 5 minutes for red cells lysis. White blood cells were then collected as a pellet after centrifugation at 300g for 5 minutes at room temperature and aspiration of supernatant. Pellet was washed with 0.5 mL ice-cold PBS followed by centrifugation at 300g for 5 minutes at 2-8°C before resuspending the cells in PBS for flow cytometry. Forward vs. side scatter plotting was performed on these samples for a cell count of 10,000 in Cytoflex LX from Beckman Coulter.
Generation of stable CLDN17 deficient cell lines. Telomerase-immortalized HMECs (CRL-4025; ATCC, Manassas, VA, USA) were maintained in Endothelial Cell Basal Medium-2 with a Growth Medium-2 Bullet Kit (Lonza; Walkersville, MD, USA), and human lung EpCs (H441; HTB-174; ATCC) were maintained in RPMI-1640 medium (ATCC 30-2001). All cultures were maintained in a humidified 5% CO2 incubator at 37°C and routinely passaged when 80–90% confluent. Stable shControl and shCLDN17 HMECs were generated using 2.5 µL/ml lentivirus particles (Dharmacon™, Lafayette, CO). The 3 validated lentiviral shRNA sequences include tgctgccaacaaaagctga (Sequence 1; Cat # V3SH7591-225585343), ggatggctgggttgtagaa (Sequence 2; Cat # V3SH7591-225642336), and gcactggacctgcttcatg (Sequence 2; Cat # V3SH7591-225656194). Whereas all three ShRNAs reduced CLDN17 expression in ECs and EpCs, the best results were obtained with sequence 2, which was used in all the in vitro studies. Cells were treated with 2 µL/ml polybrene (10mg/ml, American bioanalytical, Natick, MA) followed by transfection with the lentiviral particles. Three days later, transfection efficiency was examined through Turbo-GFP expression and subjected to 2 µg/ml puromycin (Life Technologies, Grand Island, NY) selection until all cells expressed GFP.
Measurement of EC and EpC monolayer barrier resistance in vitro. Endothelial and epithelial cell monolayer-barrier integrity (measured as electrical resistance of the endothelial monolayer) was determined using electric cell-substrate impedance sensing (ECIS) equipment (Applied Biophysics, Troy, NY, USA) as described previously54. Cell monolayer-barrier resistance was measured at multiple frequency modes, but the final analysis was performed using a frequency of 4000 Hz.
In vivo mouse tumor xenograft model. Murine RM1 metastatic prostate cancer cells were grown to confluency in 75-ml flasks, resuspended in PBS, and counted. An equal number of cells (1×106) was injected subcutaneously in 7- to 8-week-old WT and Cldn17−/− mice as described in a previous study29. Mice were euthanized on day 12, and tumors were isolated, weighed, and fixed in 4% PFA for immunohistochemistry analysis.
Determination of vascular length density. Tumors isolated from mice were sectioned and stained with laminin to determine the vascular length density using Image J software.
Ingenuity pathway analysis (IPA). IPA database (Qiagen Bioinformatics) transforms a list of genes into a set of relevant networks associated with pathology based on extensive records maintained in the Ingenuity Pathways Knowledge Base55. Highly interconnected networks are predicted to represent a significant biological function. Only those genes that were directly affected by the pathway of interest and Cldn17 are shown.
ROS analysis. Production of ROS was estimated in WT and Cldn17−/− mice with Dihydroethidium (DHE) staining on kidney sections frozen using optimal cutting temperature compound as described in a previous study56. Stained images were then captured on confocal microscopy and subjected to fluorescence quantification using ImageJ software.
Analysis of growth hormone expression. Growth hormone level was determined in the WT and Cldn17−/− mice using an ELISA kit from Novus Biologicals (NBP3-08143) according to the instructions provided by the manufacturer. Liver samples in PBS were used for the detection of growth hormone from pups and adult mice.
Statistical analysis. Data are presented as mean ± s.d. or mean ± s.e.m. The 'n' value for each figure implies the number of samples in each group which was determined by power analysis. All the data were analyzed by parametric testing using the student's unpaired t-test or one-way ANOVA using the GraphPad Prism 6.01 software. The Chi-square test was also used wherever applicable. Data with p<0.05 were considered significant.