Materials
The whole plant of Portulaca oleracea L. used in the study was obtained from Daqing China Freibon Co., Ltd. The plant was authenticated by Dr. Sun Yue-Chun at Heilongjiang Bayi Agricultural University, where the herbarium voucher has been kept (ID: 334475). Type O FMD inactivated vaccine was provided by the Inner Mongolia Jinyu pharmaceutical factory (Mongolia, China). The vaccine contains an inactivated OHM/02 strain of FMD Type O virus, and the virus content before inactivation should be at least 107.0 LD 50/0.2 mL. Escherichia coli LPS and mitomycin C were purchased from Sigma Chemical Co.. Recombinant mouse GM-CSF, IL-4 and IL-2 were purchased from NOVUSBIO; Micro Beads and MS separation column was purchased from Miltenyi Biotec. Antibodies against CD11c, CD80, CD83 and CD86 were all obtained from Santa Cruz Biotechnology (Santa Cruz, CA). The ELISA kits of IL-12, IFN-γ, IL-1β, IL-8, TNF-α, IL-4 and IL-6 were purchased from Beyotime Biotechnology (Jiangsu, China). Antibodies against IL-12p35 and IL-12p40 were purchased from Cell Signaling (Beverly, MA USA). The ECL detection system was purchased from Santa Cruz Biotechnology (CA, USA).
Preparation and identification of POL-P
Dried Portulaca oleracea L. samples (100 g) were ground and refluxed with petroleum ether (1:5, v/v). The residue was extracted with 80% ethanol at 90℃ for 2 h. After drying at room temperature, the filtered residue was extracted with distilled water for reflux three times at 70℃. The filtrate was mixed, centrifuged at 5000 r/min for 10 min, and the resulting supernatants were concentrated. The concentrated extract was coagulated with anhydrous ethanol overnight at 4℃. The precipitates were washed twice with anhydrous ethanol, 95% ethanol and acetone respectively, and then dried in vacuum to obtain the crude polysaccharides. The protein was removed by trichloroacetic acid-n-butanol and the impurity was removed by dialysis. Deproteined polysaccharide samples (5 mg) were dissolved in 1 mL of 0.15 M NaCl aqueous solution and centrifuged at 10000 r/min for 5 min. Then, the supernatants were loaded on a gel chromatography column. The column was eluted with 0.15 M NaCl aqueous solution at a flow rate of 0.15 mL/min and collected by an automatic collector for 20 min/ tube. Next, the fractions were purified by Sephadex G-25, G-15, and G-10 columns to remove other impurities. Finally, the content of carbohydrate was determined by the phenol-sulfuric acid method and uronic acid was determined by m-Hydroxybiphenyl method. The protein content was determined by Bradford method.
The average molecular weight of POL-P was determined using gel permeation chromatography (GPC). POL-P was applied to a Sepharose CL-6B column (2.0 × 90 cm) and eluted with 0.15 M NaCl at the flow rate of 0.5 mL/min. The calibration curve was established using Dextran standards (known molecular weights: 2000,000; 200,000; 70,000; 40,000; Glc).
The organic functional groups of the POL-P were analyzed using infrared spectroscopy. The purified POL-P was combined with a certain amount of potassium bromide and ground into pressure film for infrared spectrum measurement.
The monosaccharide composition of POL-P was analysis. In short, 2 mg polysaccharide samples were added to 0.5 mL anhydrous methanol solution containing 1 M hydrochloric acid, and hydrolyzed at 80℃ for 16 hours. After drying under an air pump, 2 M trifluoroacetic acid was added, and hydrolyzed at 120℃ for 1 hour. Derivatization was performed using 0.5 mL 1-phenyl3-methyl-5-pyrazolone (PMP) in the sample obtained from complete acid hydrolysis. Subsequently, 1 mL trichloromethane was added, mixed, then the excess PMP reagent was extracted. The trichloromethane layerwas removed by centrifugation. The water layer was filtered by a 0.22 µm filtration membrane and diluted with distilled water. The monosaccharide composition of POL-P was determined using the HPLC with standard monosaccharides (xylose, galacturonic acid, glucose, arabinose, galactose, fucose, glucuronic acid, mannose, rhamnose.). The operation was performed using the Shimadzu HPLC System (LC-10ATVP Pump and SPD-10AVD Uv Detector) and DIKMA Inertsil ODS-3 column (4.6 × 150 mm). The mobile phase was PBS (0.1 M, pH 7.0) - acetonitrile 82:18 (V/V) at a rate of 1.0 mL/min, the injection volume was 20 µL, and the detection wavelength was 245 nm.
Administration and grouping
BALB/c mice were provided by the Experimental Animal Center of Changchun. All animal procedures were performed in accordance with the Guidelines for Care and Use of Laboratory Animals of the National Health and Family Planning Commission of the People’s Republic of China. The experiments were approved by the Animal Ethics Committee of the HeiLongJiang BaYi Agricultural University. The animals were randomly divided into four groups with 10 mice for each group, including control (normal saline), low dose of POL-P (2 µg/mL), medium dose of POL-P (10 µg/mL) and high dose of POL-P (50 µg/mL). All the experimental animals were orally administered with 0.2 mL/10 g body weight of a solution once daily for 4 days. Type O FMD vaccine (200 µL per mouse) was injected subcutaneously through the groin after the last administration for 24 h, and the same method was used again to strengthen immune on the 15 th day.
Isolation and purification of bone marrow-derived DCs
After the last immunization, all the mice were euthanized using ether anesthesia. Bone marrow was harvested from the femurs of experimental mice. The bone marrow cells were collected and the supernatant was discarded, then the precipitated cells were washed twice with PBS and resuspended with RPMI 1640 containing 20 ng/mL IL-4 and 50 ng/mL GM-CSF. The cell suspension was gently added to the fresh medium and non-adherent cells were removed on the third day. Thereafter the nutrient medium was altered every 3 days. On the seventh day, the morphologic and quantitative changes of DCs were observed under an inverted microscope. DCs were collected and the positive rate of CD11c was detected by flow cytometry. CD11c is a characteristic marker molecule on DCs surface, which represents the purity of DCs.
Phenotype analysis of DCs by Flow Cytometry
CD11c+ DCs were collected and seeded into 24-well flat bottom multiwell at a density of 1×105 cells per well for 24 h at 37℃. For surface molecules expression determination, DCs were stained with extra FITC-conjugated and PE-conjugated antibodies against CD80, CD83 and CD86, and analyzed using FACS Caliber multicolor flow cytometer.
Qualitative real-time PCR (qRT-PCR)
The mRNA expression levels of MHC-I and MHC-II were detected by qRT-PCR. RNA from DCs of experimental groups was extracted with Trizol® Reagent following the manufacturer’s instructions (Invitrogen). After RNA quantification and purity identification were performed, the product was identified by agarose gel electrophoresis. Then, RNA was reverse-transcribed with a SuperScript® IV first-strand synthesis system into cDNA. The expression levels of MHC-I and MHC-II were detected by qRT-PCR (SYBR Green method) with cDNA as template under specific primers, and the housekeeping gene GAPDH was used as control. Target gene mRNA was analyzed using a Bio-Rad CFX384 real-time PCR detection system (Bio-Rad), and relative gene expression was calculated via the 2−ΔΔCT method. The amplification primers are as following: MHC-I (For. 5' ATCGCTGTCGGCTATGTG 3'; Rev. 5' CCCTTGGCTTTCTGTGTCTC 3'), MHC-II (For. 5' GGAAACTCGGATACTAAATAGG 3'; Rev. 5' ACTGAGGCAGAATTAACAAG 3'), and GAPDH (For. 5' CTGCCCAGAACATCATCC 3'; Rev. 5' CTCAGATGCCTGCTTCAC 3').
Cytokine release detection
The obtained DCs were seeded into culture plates, and the negative control was set at the same time. After 48 hours of continuous culture, the cells were centrifuged, and the supernatants were collected. The cytokines levels of IL-12, IFN-γ, IL-1β, IL-8, TNF-α and IL-6 were detected by ELISA kit. The operation was conducted in strict accordance with the instructions. According to the standard curve, the contents of each index in the samples were calculated respectively.
Western blotting
The extracted protein was separated by SDS-PAGE and then transferred to PVDF membrane. After the membrane was blocked with 5% skim milk for 1 h at 37℃, IL-12p35 and IL-12p40 primary antibodies were incubated at 4℃ overnight. Subsequently, membranes were washed with TBST and incubated with the HRP-conjugated secondary antibody (Santa Cruz Biotechnology, Santa Cruz, CA). Protein signals were visualized by using an ECL detection system (SantaCruz, CA, USA).
Immunohistochemistry
The expressions of TLR2 and TLR4 receptors and the downstream molecules of MyD88 and NF-κB were identified by immunohistochemistry. DCs were routinely prepared and stained according to the instructions of SABC immunohistochemical kit. Five visual fields were randomly selected for each slide. Image analysis using Olympus image analyzer, and the expression intensity of TLR2, TLR4, MyD88 and NF-κB was represented by average optical density (OD).
Chromatin immunoprecipitation assay (ChIP assay)
DCs were incubated at 37℃ for 6 h, and then cells were collected. ChIP assays were operated according to the kit instructions. Briefly, DCs were treated with medium added 1% formaldehyde for 10 min at 37℃. After DCs were incubated with glycine for 5 min, the medium was discarded and the cells were washed twice with cold PBS. Chromatin was sonicated to an average size of 250 bp. Immune complexes were collected using protein-A magnetic beads (SantaCruz, CA, USA) and washed with ChIP dilution buffer, high salt buffer, LiCl buffer, and TE buffer, respectively. The samples were decrosslinked, and then DNA was purified using the Qiagen PCR purification kit (Qiagen, Mississauga, Ca). The PCR assay was performed with primers of the IL-12p35 and IL12-p40 promoter. In this experiment, positive and negative controls were set. The extracted DNA was used as a template, and the target genes were detected using the primer PCR showed in the table below.
Primer | Sequence | Size (bp) |
p IL-12p35 F | 5' ATCTGTATCCCAGCCTCCAC 3' | 733 |
p IL-12p35 R | 5' GCCAAGCCAATAAGAAGGAC 3' |
p IL-12p40 F | 5' CAAGAAAACATGGGGAAAGG 3' | 542 |
p IL-12p40 R | 5' TTAGCGACAGGGAAGAGGAG 3' |
Transmission electron microscope (TEM) analysis
Ultrastructure of DCs was observed by TEM. The cultured DCs were fixed with 2% osmium acid for 1 h. After washing, dehydration, displacement, impregnation, embedding polymerization and slicing sequentially, the cells were stained finally with uranium acetate for 1 h. The samples were dried at room temperature, sealed, and the ultrastructure of DCs were observed under TEM.
Hematoxylin-hosin staining
For histopathological observation of liver, kidney and small intestine in mice treated with different doses of POL-P, the tissues were fixed in PBS buffer containing 10% formalin (pH 7.4) for over 24 h and then embedded in paraffin. Thin sections (5 µm) were prepared using a microtome (RM2235, Leica) and stained with hematoxylin and eosin. The sections were examined for morphology under a light microscope (Olympus, Tokyo, Japan).
Statistical analysis
All experiments were performed at least in triplicate. SPSS/13.0 software was applied to analyze all data, which were expressed as mean ± SD. Statistical analysis was performed by one-way analysis of variance (ANOVA). Significant differences were considered at P-values of less than 0.05 (p < 0.05).