Production of xylitol and bio-detoxification of cocoa pod husk hemicellulose hydrolysate by Candida boidinii XM02G

Nivio Batista Santana; João Carlos Teixeira Dias; Rachel Passos Rezende; Marcelo Franco; Larissa Karen Silva Oliveira; Lucas Oliveira Souza

doi:10.1371/journal.pone.0195206

Abstract

The use of cocoa pod husk hemicellulose hydrolysate (CPHHH) was evaluated for the production of xylitol by Candida boidinii XM02G yeast isolated from soil of cocoa-growing areas and decaying bark, as an alternative means of reusing this type of waste. Xylitol was obtained in concentrations of 11.34 g.L^-1, corresponding to a yield (Y_p/s) of 0.52 g.g^-1 with a fermentation efficiency (ε) of 56.6%. The yeast was tolerant to inhibitor compounds present in CPHHH without detoxification in different concentration factors, and was able to tolerate phenolic compounds at approximately 6 g.L^-1. The yeast was also able to metabolize more than 99% (p/v) of furfural and hydroxymethylfurfural present in the non-detoxified CPHHH without extension of the cell-growth lag phase, showing the potential of this microorganism for the production of xylitol. The fermentation of cocoa pod husk hydrolysates appears to provide an alternative use which may reduce the impact generated by incorrect disposal of this waste.

Citation: Santana NB, Dias JCT, Rezende RP, Franco M, Oliveira LKS, Souza LO (2018) Production of xylitol and bio-detoxification of cocoa pod husk hemicellulose hydrolysate by Candida boidinii XM02G. PLoS ONE 13(4): e0195206. https://doi.org/10.1371/journal.pone.0195206

Editor: Pankaj Kumar Arora, Babasaheb Bhimrao Ambedkar University, INDIA

Received: November 2, 2017; Accepted: March 19, 2018; Published: April 11, 2018

Copyright: © 2018 Santana et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Data Availability: All relevant data are within the paper and its Supporting Information files.

Funding: The authors received no specific funding for this work. However, the authors thank the (UESB) and the State University of Santa Cruz (Uesc) and the Coordination for the Improvement of Higher Education Personnel (CAPES).

Competing interests: The authors have declared that no competing interests exist.

Introduction

Xylitol is used as a sweetener in the food, pharmaceutical and personal care industries, and its commercial production is currently limited to chemical synthesis by catalytic hydrogenation of xylose extracted from vegetable fibers [1,2]. Benefits of xylitol in terms of human health make it a product of great value and interest in various lines of research. Its organic synthesis by microorganisms has been studied with the aim of reducing the disadvantages presented by chemically reducing the xylose purification steps and removing waste from the catalyst. Various types of agro-industrial waste have been studied as a potential source of substrate for fermentation and generation of this compound [3–6].

However, the biotransformation of xylose into xylitol using yeast requires the production of hydrolysates from the residues, which are rich in sugars, and it is thus required to reduce their toxicity, which occurs due to the presence of phenolic compounds derived from the breakdown of lignin, the presence of furans and organic acids, which in turn reduce the fermentability of the medium to inhibit the microbial metabolism [7,8]. Purification processes have been proposed and evaluated to enable the use of hydrolysates, but these processes can reduce the concentration of available sugars and raise the cost of the operation due to the chemicals that are required for the removal of unwanted molecules. An alternative to the chemical process is the use of microorganisms which are able to metabolize these inhibitor compounds, transforming the substrates present without the need for purification. Microorganisms with high tolerance to inhibitory compounds are of great interest because they can reduce costs and eliminate certain steps in the process [9–13].

Cocoa is the main crop grown in southern Bahia; it has singular importance in the local economy, as well as in the national and global production of chocolate. Nevertheless, the extraction of the beans which are destined for the production of chocolate generates large amounts of waste, consisting mainly of husk, which in turn represents approximately 80% of the fruit by weight [14].

World cocoa beans production in the 2015–2016 harvest was 4,013 million tons [15], generating around 16 million tons of cocoa pod husks. Discarded lignocellulosic material can be used to generate energy and to produce chemicals for various industrial sectors [7], however, cocoa pod husks are rarely reused. Alternatives to this material have been proposed primarily in the field of animal nutrition, agriculture and chemistry [15–26]. Notwithstanding, studies on its use in fermentation processes remain scarce [18].

Considering the above, the present study investigates the use of cocoa pod husks as a source of xylose for the production of xylitol using the Candida boidinii XM02G yeast, which has a high tolerance to inhibitor compounds, isolated from soils in the cocoa cultivation area and from the decaying husks.

Materials and methods

Characterization of waste

The residues were donated by small traders of cocoa-based products in the southern area of Bahia. The residues were washed with potable water, dried in an oven at 70°C until 3% humidity was achieved, ground and sieved (30 mesh). The content of fiber, protein, ether extract and dry residue matter were determined in accordance with the methodology of the Association of Official Analytical Chemists [27].

Microorganism and medium preparation

C. boidinii was isolated from the soil and decomposing cocoa pod husks in cocoa cultivation areas of the campus of the State University of Santa Cruz (14° 47' 55.50" S 39° 10' 20.03" W), in the city of Ilhéus, state of Bahia. No permissions were required for collections in the campus area. This study did not involve endangered species. DNA extraction was done according to Silva-Filho et al [28]. Amplification of the D1 / D2 divergent domains of the 26S rDNA subunit was done using the primers NL1-(5`GCCATATCAATAAGCGGAGG 3`) and NL4-(5`GGTCCGTGTTTCAAGACGG 3`). The sequence obtained (TCAAGACGGGCGGTATTAGACCATTACGCCAGCATCCTAGGCAAAGCCGCAGACCTCAGTCTAGATAGGCAGTATCAACTGAAGCTATAACACTCCGAAGAGCCACGTTCAACAGTTCTTATCCTGCCACCTAAACTGATGCTGGCCCAATAAAAAGCTAGAGCACCATCCACAAGGAACAGTGTTAACTGAATATCAGTCTGATCAAATACCCTTCCCTTTCAACAATTTCACGTACTTTTTCACTCTCTTTTCAAAGTTCTTTTCATCTTTCCATCACTGACTTGTTCGCTATCGGTCTCTCGCCAATATTTAGCTTTAGATGGAATTTACCACCCACTTAGAGCTGCATTCCCAAACAACTCGACTCGTCRAAAGTATCTTACATAGAATGGGCACCCCATCGCACGGGATTCTCACCCTCTGTGACGTCCTGTTCCAAGGAACATAGACAAGGGCCAACTCCAAGATTACTTTCTTCAAATTACAACTCGGATACTGAAAGTACCAGATTTCAAATTTGAGCTCTTGCCGCTTCACTCGCCGCTACTAAGGCAATCCCTGTTGGTTTCTTTTCCTCCGCTTATTGATATGC) was compared with the sequences available in Genbank (Accession No. KY106341), showing to be 99% similarity with C. boidinii XM02G. The microorganism was kept in Sabouraud agar slants covered with mineral oil, in refrigerated conditions. YPX medium composed of yeast extract (5 g.L^-1), peptone (5 g.L^-1), xylose (20 g.L^-1) [12] was used for the reactivation of the culture. Cell growth was determined by spectrophotometry at a wavelength of 600 nm and correlated to the dry weight of the cells (g.L^-1) using standard curve [27].

Experimental design and statistical analysis on obtaining the hemicellulose hydrolysate

Optimization of the process for obtaining CPHHH was evaluated by means of a Central Composite Rotational Design (CCRD) 2² experimental design, with 4 different experiments, 4 axial points and 3 central points. The corresponding matrix is shown in Table 1. The analyzed independent variables (factors) and their ranges were sulfuric acid concentration and time of pretreatment; the analyzed dependent variable (response) was the concentration of xylose. All experiments were conducted at 120°C and 1.0 atm. The proportion between husk mass and the volume of acid solution was 1/8 (p/v). The hydrolysates were centrifuged at 2000 g for 10 mins to remove the non-hydrolyzed fraction. The supernatant was filtered using a 0.22 μm PES filter with 13mm diameter and was retained for subsequent analysis. The CPHHH was evaporated at 70°C in a vacuum oven until the concentrations that were 2-, 3- and 4 (2×, 3× and 4×) times the original concentration of the hydrolysates. The data obtained were analyzed with the aid of STATISTICA® software v.10.0 (Statsoft, USA).

Download:

Table 1. Experimental design for the optimization experiment of cocoa pod husks hydrolysis.

https://doi.org/10.1371/journal.pone.0195206.t001

Hydrolysate detoxification

pH adjustment and adsorption with activated charcoal.

Calcium hydroxide [Ca(OH)₂] was added to the CPHHH until a pH 10 was achieved. After remaining at that pH for 1 h, the hydrolysate was centrifuged at 2000 g for 10 min, acidified to pH 5.5 with H₃PO₄ and centrifuged once more after 1 h. Activated charcoal was added to the hydrolysate at a rate of 2% (w/v) at 30°C, stirred at 200rpm for 1 h and then centrifuged 2000 g [5].

Use of ion-exchange resins.

The pH of the hydrolysate was previously adjusted to 5 using Ca(OH)₂ and centrifuged at 2000gto remove the precipitate. The ion-exchange resins, Amberlit IRA 120 and Amberlit IRA 410, were hydrated in distilled water for 24 h. The CPHHH was treated with Amberlit IRA 410 and stirred at 200 rpm for 30 min at 30°C. After this process, the hydrolysate was drained and treated with Arberlit IRA 120 and stirred at 200 rpm for 30 min at 30°C. The ratio of hydrolysate volume to resin mass was 2:1 [28].

Fermentation of the CPHHH

Fermentation of the CPHHH without detoxification by C. boidinii.

The inoculum for cultivation in liquid medium was produced in hydrolysate enriched with yeast extract (5 g.L^-1), peptone (5 g.L^-1), ammonium sulphate (2 g.L^-1), dibasic potassium phosphate (2 g.L^-1) and hydrated hepta magnesium sulphate (1 g.L^-1). Cells adapted in petri dishes were removed and transferred to the liquid medium at the original concentration. After 96 h, 5 ml aliquots were removed and re-inoculated into the more concentrated medium (2×). This procedure was repeated until the highest concentrations of hydrolyzate (3× and 4×). The initial cell concentration in fermentations was 0.05 g.L^-1.

Fermentation of the physicochemically-detoxified CPHHH.

The CPHHH detoxified by pH adjustment and activated charcoal was concentrated until it reached four times the original concentration. The inoculum was prepared based on a 48-h culture in YPX medium. Next, the adaptation of the inoculum was carried out in the CPHHH at the original concentration for 48 h and then transferred to the CPHHH with doubled concentration (2×) and to CPHHH (4×) for 48 h each. The medium was centrifuged at 5000 g and the cells pellet was then resuspended at 4 g.L^-1 in the CPHHH enriched with yeast extract (5 g.L^-1), peptone (5 g.L^-1), ammonium sulphate (2 g.L^-1), dibasic potassium phosphate (2 g.L^-1) and magnesium sulfate heptahydrated (1 g.L^-1). Fermentation was carried out in 125-mL Erlenmeyer flasks containing 50 mL of hydrolysate and stirred at 110 rpm.

Analytical methods

The content of sugars and xylitol were determined by high performance liquid chromatography (HPLC), using a Shimadzu system equipped with refractive index detector, Shimpack CLC-NH₂ column and acetonitrile/water (80/20) as the mobile phase at 1.0 mL.min^-1(30°C). Furfural and hydroxymethylfurfural (HMF) were quantified by high performance liquid chromatography (HPLC) using a Shimadzu system equipped with CLC-ODS column, kept at 40°C and with detector diode arrangement at a wavelength of 280 nm. The mobile phase was initially composed of water/methanol (95/5 p/v), andreached 100% of methanol after 13 min at a flow rate of 0.8 mL.min^-1.

Total phenolic compound content was determined using the Folin Ciocalteau reagent and expressed as g.L^-1 of ferulic acid [29].

Results and discussion

Optimization of the acid hydrolysis of cocoa residue

The Pareto chart (Fig 1A) shows the significance of the variables tested at the level of probability of p<0.05. It was observed that the effect of heating time on the results was not significant, while the concentration of the acid had a considerable influence on hydrolysis. Long hydrolysis times favored the conversion of sugars into products such as furfural and HMF, thus reducing the concentration of substrate available for fermentation. Nevertheless, depending on the type of acid used in the hydrolysis and the pressure applied during heating, formation of furans can also occur [30,31]. This may explain why the time factor was found not to be meaningful. The model containing the linear and quadratic factors of the acid concentration is shown below, displaying the regression coefficient (R²) of 0.93216 and a non-significant lack of adjustment (p = 0.56): (1) Where X₁ represents the encoded variable corresponding to the concentration of the acid.

Download:

Fig 1.

Pareto chart of the data analysis (p<0.05); (A) surface response generated by the model adjusted for the extraction of hemicellulose from cocoa pod husks in three-dimensional (B) and two-dimensional (C) shape.

https://doi.org/10.1371/journal.pone.0195206.g001

Fig 1B and 1C show the response surface generated from the model obtained from the data analysis. It is possible to observe that two experimental points are within the highest-concentration range obtained for xylose. The critical point was 0.19 for time (X₁) and 0.65 for the acid (X₂), with a predicted maximum value of 11.03 g.L^-1 of xylose for the response variable “concentration of xylose”. Therefore, the authors have selected the combination +1/-1 for the encoded variables as the most suitable for the available work conditions. These include 3.49% acid concentration and 21.6 min length of stay under heating. The concentration of xylose obtained in these coordinates was 11 g.L^-1. There are published reports of xylose concentrations of 15.7 g.L^-1 for sugarcane bagasse, 45.6 g.L^-1 for barley and bran, and 19.21 g.L^-1 for eucalyptus, among other raw materials [32].

Table 2 shows the composition of the cocoa pods used in the experiment before and after the hemicellulose extraction process. The acid hydrolysis process removed 95.7% of the hemicellulose present in the husk. Consequently, the remaining residues increased proportionally in their concentrated fractions after the hydrolysis. Other authors have reported similar composition for cellulose, lignin and protein in the cocoa pod husks. However, the values reported for hemicellulose by other authors are less than those observed in the present study [14, 24, 25]. According to these authors, the predominant component of the husks included lignocellulosic material (32 to 45%) and pectin, with low levels of crude protein (6 to 9%) and total sugars (3%) expressed as a percentage of dry matter. In the present study, no soluble sugars were observed in the chromatographic determination of the water extract of the husks.

Download:

Table 2. Composition of cocoa pod husks residue before and after extraction of hemicelluloses.

https://doi.org/10.1371/journal.pone.0195206.t002

Characterization of the hydrolysate

Xylose (7.24 g.L^-1), glucose (4.55 g.L^-1) and arabinose (2.64 g.L^-1) were produced during the hydrolysis process (NAT treatment). According to Table 3, it is possible to observe that, in addition to xylose, glucose was produced in large proportion and arabinose in smaller proportions. The composition of sugars in the biomass hydrolysates depends on the composition of the raw material and the intensity of the treatment [7]. Generally, hemicellulose hydrolysates obtained from soft hydrothermal treatments have a higher proportion of xylose compared to glucose [10–12]. The lower concentrations of acid investigated in this study did not produce satisfactory xylose extraction results (Fig 1B). The relatively high acid concentration in the chosen treatment may partly explain the high concentration of glucose, which was caused by hydrolysis of the cellulose in the cocoa pods. The high glucose concentration may also be related to the large amount of mucilage present in the inner part of the husk, which is rich in sugars such as glucose and fructose, in addition to pectin which was found in considerable quantities and which may have contributed to the generation of glucose and other sugars. Salgado et al. obtained concentrations of 10.7 g.L^-1for glucose, 14.7 g.L^-1for xylose and 1.6 g.L^-1for arabinose from vineyard residues [33]. Rocha et al. reported a glucose concentration of 17.8 g.L^-1 and a xilarabina concentration of 34.0 g.L^-1 in cashew residue hydrolysates [34]. With respect to the concentration of total phenolics, furfural and HMF, the values obtained for the original hydrolysate (NAT) are similar to those obtained in other sources of biomass [12], which shows that there was no excessive degradation of sugars and lignin caused by the heating time or the acid concentration used in the process developed in the present study.

Download:

Table 3. Characterization of the hydrolyzates according to the treatments applied for detoxification.

https://doi.org/10.1371/journal.pone.0195206.t003

Detoxification processes

Detoxification by pH adjustment and adsorption with activated charcoal.

After adjusting the pH value to 10 and then to 5.5, there was no significant loss of xylose. However, these steps do not result in the removal of phenolic compounds. Huang et al. reported that alkalization lead to loss of sugars, which causes a reduction in fermentation efficiency, in addition to requiring additional processes for the removal of precipitated calcium sulfate or calcium phosphate [12]. After the application of activated charcoal (DETOX), there was a 78% decrease in phenolic compounds and the concentration remained at 0.15 g.L^-1, showing that this step is fundamental to the process of detoxification of CPHHH. Misra et al. noted that several reports suggest that the presence of activated charcoal in the hydrolysate helps primarily with the reduction of phenolic compounds generated during acid hydrolysis [3]. Ge et al. reported that alkalization and activated charcoal treatment resulted in the complete removal of furfural, while acetic acid and phenolic compounds decreased by 62.4% and 96.6%, respectively [35]. In the present study, the reduction in concentration of furfural and HMF by means of the same method was greater than 99%.

Use of ion-exchange resins.

The resin treatment almost completely eliminated the total phenolic compounds, furfural and HMF, as well as the arabinose present in the compounds. There was no significant loss of xylose or glucose after treatment with ion-exchange resins. Canilha et al. reported that there was less loss of sugars with resin treatment compared to pH adjustment and use of activated charcoal [36]. There were no significant differences between the methodologies used for detoxification in the present study.

Fermentation of the CPHHH

Fermentation of the CPHHH without detoxification by C. boidinii.

Despite the high concentration of inhibitors, it was possible to observe cell growth at all concentrations of the hydrolysate in liquid medium composed of non-detoxified CPHHH. The initial concentrations of total phenolics compounds in the non-detoxified CPHHH (original and concentrated 2×, 3× and 4×) were 2.15, 3.52, 4.82 and 5.92 g.L^-1, respectively. Despite the low inoculation rates used in this study (approximately 0.05 g.L^-1), C. boidinii was able to reduce the concentration of total phenolic compounds at all levels in the medium (Fig 2A).

Download:

Fig 2.

Concentration of TPC (g.L^-1) in the CPHHH before (black columns) and after (white columns) the growth of C. boidinii (A) and percentage of TPC decreasing after fermentation (B).

https://doi.org/10.1371/journal.pone.0195206.g002

Although the greatest reduction (19.01%) was observed in the medium with the lowest (original) concentration after 96 h, the highest phenolic concentration present with other treatments did not cause complete inhibition of cellular activity. Even with the medium that was concentrated four times, it is possible to note the continued reduction of TPC after 120 h and 144 h of cultivation, for which the second highest percentage reduction of these compounds was observed (Fig 2B). All of these data show the adaptability of the isolate of C. boidinii to conditions that are considered aggressive for yeast [37,38]. Nevertheless, the values for biological reduction of phenolic compounds were lower than those obtained for the alkali treatment and activated charcoal, and with the use of ion-exchange resins (Table 3), which show removal rates varying between 78% and 100%.

Table 4 shows the consumption of substrate and cell growth for the treatments tested in this study. It is noted that the increase in concentration of CPHHH resulted in lower consumption of substrate and cell growth during the growing period that was investigated. However, none of the conditions tested was aggressive enough to cause death or total inhibition of the culture, showing the high tolerance of the C. boidinii isolated in supporting high concentrations of inhibitor compounds. Despite the low consumption of xylose in the treatment with the highest concentration factor for CPHHH, microbial activity could be demonstrated by the significant consumption of glucose. With regard to the conversion factor for the cell substrate (Y_x/s), CPHHH 1× was the condition that produced the highest value for this parameter.

Download:

Table 4. Xylose and glucose consumption and biomass formation by C. boidinnii in CPHHH without detoxification.

https://doi.org/10.1371/journal.pone.0195206.t004

According to Wang et al., the level of tolerance of C. tropicalis to concentrated corn cob hydrolysate gradually increased with the process of adaptation [6]. Misra et al. stated that improvement in fermentation performance in the adapted strain may result from the ability of yeast to maintain the initial pH value, which in turn leads to the inactivation of toxic compounds present in the hydrolysate [3].

Detoxification with C. boidinii in the original concentration of CPHHH proved to provide the most favorable conditions of those tested for the reduction of such hemicellulose hydrolysate inhibitor compounds. Thus, this treatment was accompanied for a period of 264 h, in order to assess how cell growth is influenced by the presence of these compounds. The data are shown in Fig 3.

Download:

Fig 3. Cell growth monitoring and TPC decreasing by C. boidinii in non-detoxified CPHHH.

https://doi.org/10.1371/journal.pone.0195206.g003

Phenolic compounds usually lead to a prolonged lag phase in the cells, and growth is only evident after reduction in the concentration of these compounds [39]. However, cell growth of C. boidinii was not as strongly inhibited by the presence of phenolic compounds present in the CPHHH without detoxification. Stabilization of cellular growth occurred between 120 h and 168 h of fermentation. When the TPC concentration reached approximately 1.0 g.L^-1, the number of cells increased again after 168 h of growth, even though this concentration is relatively high and considered inhibitory to yeast. This may indicate a perfect adaptation of cells to TPC concentrations of approximately 1.0 g.L^-1 or it could also be attributed to a phenomenon of diauxic growth, wherein another carbon source begins to be metabolized at this point, causing increased cell mass in the medium.

The decrease in furfural and HMF concentration were by 99.5% and 99.2%, respectively during 264 h of cultivation. The initial concentrations amounted to 0.32 g.L^-1 and 0.4 g.L^-1for furfural and HMF, respectively. The presence of these compounds at such concentrations did not cause an extension of the lag phase, similar to the phenolic compounds, as shown in Fig 3. This effect was also observed by Huang et al. with C. tropicalis JH030 in Napier grass hydrolysate containing 1.2 and 0.5 g.L^-1 of furfural and HMF, respectively[12]. Nevertheless, C. tropicallis and C. guilliermondii showed growth only after the concentration of these compounds decreased in the medium, suggesting that the duration of the lag phase depends on the concentration of furfural and HMF [10, 11, 40]. The growth inhibition caused by furfural and HMF is probably a result of their action on several key glycolytic enzymes. The inhibitory effect of these compounds was most remarkable in fermentations conducted with low levels of inoculum, leading to a decrease in the initial number of viable cells [10, 40]. Huang et al.reported that furfural concentrations greater than 1.0 g.L^-1exertan inhibitory effect on Picchia stipites [12]. However, the data obtained in this study show that the C. boidinii isolated presented high tolerance to these inhibitors, reducing the concentration of these compounds to similar levels to those obtained by traditionally applied physical and chemical methods of detoxification, as shown in Table 3.

In spite of the good adaptation of C. boidinii to the medium without detoxification, the ability to produce xylitol in fermentation medium was completely suppressed in the experimental conditions tested here. Wang et al. studied the effect of inhibitory compounds in C. tropicallis [10]. According to the authors, both the xylose uptake rate (XUR) and the xylitol oxidation rate (XOR) were stimulated in the groups treated with inhibitors. However, the XOR/XUR ratio was higher for the group treated with inhibitors than control group. This study has also observed an increase in the rate of consumption of xylose by pentose phosphate, which promotes the oxidation of xylitol, thus reducing its accumulation. The increased NADH/NAD+ ratio of the treated groups compared to the control also indicates that the oxidation of xylitol was enhanced. This may explain the fact that C. boidinii did not show accumulation of xylitol in medium without detoxification in the present work.

Fermentation of the CPHHH detoxified by pH adjustment and activated charcoal.

The production of xylitol was studied in CPHHH detoxified by pH adjustment and activated charcoal, because this method is cheaper and has demonstrated similar efficiency to that of ion-exchange resins, and because there is still a lack of studies on biodetoxification. Fig 4 shows that due to the presence of large amounts of glucose in the CPHHH, xylose consumption effectively began after 120 h of cultivation, from which point there was a decrease in glucose levels. The production of xylitol also starts began after this period.

Download:

Fig 4. Fermentation of detoxified CPHHH by isolated C. boidinii.

https://doi.org/10.1371/journal.pone.0195206.g004

The presence of glucose causes suppression in the consumption of other carbon sources present in the growth medium. In the case of CPHHH fermentation, this amount of glucose can be used in the production of any other compound of interest, and the production of xylitol begins as soon as the sugar content starts to decrease. In this study, the xylose:glucose ratio was approximately 1:1 (w/w). Other studies indicate that glucose has a positive effect on the metabolism of xylose, and suggest that, in order to increase the production of xylitol, the optimal glucose:xylose ratio should range between 1:5 and 1:10 [12]. Cellular growth can be considered as moderate, in light of the large amount of substrate available in the medium. The final value for biomass produced was 5.29 g.L^-1. Excessive production of biomass may indicate that the process is following an inappropriate path, providing conditions that favor higher biomass production at the expense of product formation. The final yield (Y_p/s) in the production of xylitol was 0.52 g.g^-1 with an efficiency (ε) of 56.6% in comparison to the stoichiometric yield. The highest value observed for Y_p/s was 0.69 g.g^-1, obtained after 264 h and corresponding to an efficiency level ε of 75.56%. In Table 5 it is possible to compare the results obtained in this work with others found in the literature. The final consumption of xylose was 86.86% and the highest value achieved for xylitol was 11.34 g.L^-1 after 372 h of fermentation. The xylitol concentration did not decrease even with the long fermentation time. Gonçalves et al. obtained xylitol values between 2 and 4 g.L^-1 in fermentations with C. boidinii in hydrolysate of macaúba pie[41]. Vandeska et al. achieved xylitol values of 39.41 g.L^-1 with C. boidinii in synthetic medium containing glucose and xylose, while in medium containing only xylose, the obtained values were 46.5 and 59.3 g.L^-1[42]. The authors reported values of between 0.57 g.g^-1 and 0.68 g.g^-1 in fed batches.

Download:

Table 5. Concentration and yield of xylitol found in the literature.

https://doi.org/10.1371/journal.pone.0195206.t005

The maximum yield for xylitol of 0.72 g.g^-1 for C. tropicallis was obtained when using concentrated corn cob hydrolysate twice as the medium. These authors postulated that the higher yield could be attributed to the rapid increase of yeast biomass, resulting from rapid glucose utilization during the initial stage of fermentation of the hydrolysates [39]. The yield for xylitol is not always negatively affected by hydrolysates. Huang et al. also noted that the yield obtained with the fermentation of xylitol from rice straw hydrolysate was greater than that obtained with the synthetic fermentation of xylose[12].

The long fermentation time obtained in this paper indicates the need for an adequate initial concentration of cells. Higher initial values of inoculum lead to shorter fermentation times and less inhibitory effects of toxic compounds. Wang et al. reported that the increase in the initial inoculum concentration from 0.4 g.L^-1 to 1.6 g.L^-1was followed by a 37% decrease in fermentation time [39]. Yield and productivity of xylitol respectively increased by 6% and 67.9%.

Conclusions

The biotechnological reutilization of residual biomass is considered as an alternative for reducing environmental impacts and producing high value-added molecules.

Candida boidinii XM02G, isolated from cocoa cultivation areas, has shown interesting characteristics relating to the biotechnological production of xylitol because it proved able to withstand the toxicity present in CPHHH, even without any type of detoxification. This feature is interesting because it can result in reduction of steps and costs for the use of this biomass. The yield and efficiency values for the fermentation process reported in this study are interesting and in agreement with other published works.

These findings reinforce the importance of biodiversity for this region, since micro-organisms with differentiated characteristics can be found in this region. The use of the biomass of the cocoa pod husks to produce xylitol is an interesting proposal for reuse of this residue, which is abundant in the southern region of Bahiaand elsewhere in the world.

Supporting information

S1 Supporting Information. Subjacent data—Plos One.

https://doi.org/10.1371/journal.pone.0195206.s001

(DOCX)

S1 Fig. Fermentation chromatogram of CPHHH.

https://doi.org/10.1371/journal.pone.0195206.s002

(TIF)

Acknowledgments

The authors thank the State University of Santa Cruz, State University of Southwestern Bahia and Capes.

References

1. Santos DT, Sarrouh BF, Rivaldi JD, Converti A, Silva SS. Use of sugarcane bagasse as biomaterial for cell immobilization for xylitol production. J Food Eng [Internet]. 2008 Jun [cited 2013 Aug 12];86(4):542–8. Available from: http://linkinghub.elsevier.com/retrieve/pii/S0260877407005687
- View Article
- Google Scholar
2. Parajó JC, Dominguez H, Domínguez JM. Improved xylitol production with Debaryomyces hansenii Y-7426 from raw or detoxified wood hydrolysates. Enzyme Microb Technol [Internet]. 1997;21(1):18–24. Available from: http://linkinghub.elsevier.com/retrieve/pii/S0141022996002104
- View Article
- Google Scholar
3. Misra S, Raghuwanshi S, Saxena RK. Evaluation of corncob hemicellulosic hydrolysate for xylitol production by adapted strain of Candida tropicalis. Carbohydr Polym [Internet]. Elsevier Ltd.; 2013 Feb 15 [cited 2013 Aug 12];92(2):1596–601. Available from: http://www.ncbi.nlm.nih.gov/pubmed/23399194 pmid:23399194
- View Article
- PubMed/NCBI
- Google Scholar
4. Zhang D, Ong YL, Li Z, Wu JC. Optimization of dilute acid-catalyzed hydrolysis of oil palm empty fruit bunch for high yield production of xylose. Chem Eng J [Internet]. Elsevier B.V.; 2012;181–182:636–42. Available from: http://dx.doi.org/10.1016/j.cej.2011.12.030
- View Article
- Google Scholar
5. Zhang J, Geng A, Yao C, Lu Y, Li Q. Xylitol production from D-xylose and horticultural waste hemicellulosic hydrolysate by a new isolate of Candida athensensis SB18. Bioresour Technol [Internet]. Elsevier Ltd; 2012 Feb [cited 2013 Aug 12];105:134–41. Available from: http://www.ncbi.nlm.nih.gov/pubmed/22196071 pmid:22196071
- View Article
- PubMed/NCBI
- Google Scholar
6. Wang L, Yang M, Fan X, Zhu X, Xu T, Yuan Q. An environmentally friendly and efficient method for xylitol bioconversion with high-temperature-steaming corncob hydrolysate by adapted Candida tropicalis. Process Biochem [Internet]. Elsevier Ltd; 2011 Aug [cited 2013 Aug 12];46(8):1619–26. Available from: http://linkinghub.elsevier.com/retrieve/pii/S1359511311001632
- View Article
- Google Scholar
7. Ravindran R, Jaiswal AK. A comprehensive review on pre-treatment strategy for lignocellulosic food industry waste: Challenges and opportunities. Bioresour Technol [Internet]. Elsevier Ltd; 2016;199:92–102. Available from: http://dx.doi.org/10.1016/j.biortech.2015.07.106 pmid:26277268
- View Article
- PubMed/NCBI
- Google Scholar
8. Sindhu R, Binod P, Pandey A. Biological pretreatment of lignocellulosic biomass—An overview. Bioresour Technol [Internet]. Elsevier Ltd; 2016;199:76–82. Available from: http://dx.doi.org/10.1016/j.biortech.2015.08.030 pmid:26320388
- View Article
- PubMed/NCBI
- Google Scholar
9. Jönsson LJ, Martín C. Pretreatment of lignocellulose: Formation of inhibitory by-products and strategies for minimizing their effects. Bioresour Technol. 2016;199:103–12. pmid:26482946
- View Article
- PubMed/NCBI
- Google Scholar
10. Wang S, Li H, Fan X, Zhang J, Tang P, Yuan Q. Metabolic responses in Candida tropicalis to complex inhibitors during xylitol bioconversion. Fungal Genet Biol [Internet]. Elsevier Inc.; 2015;82:1–8. Available from: http://linkinghub.elsevier.com/retrieve/pii/S1087184515001498 pmid:26127015
- View Article
- PubMed/NCBI
- Google Scholar
11. Ping Y, Ling H-Z, Song G, Ge J-P. Xylitol production from non-detoxified corncob hemicellulose acid hydrolysate by Candida tropicalis. Biochem Eng J [Internet]. Elsevier B.V.; 2013 Jun [cited 2013 Aug 12];75:86–91. Available from: http://linkinghub.elsevier.com/retrieve/pii/S1369703X13000934
- View Article
- Google Scholar
12. Huang CF, Jiang YF, Guo GL, Hwang WS. Development of a yeast strain for xylitol production without hydrolysate detoxification as part of the integration of co-product generation within the lignocellulosic ethanol process. Bioresour Technol [Internet]. Elsevier Ltd; 2011;102(3):3322–9. Available from: http://dx.doi.org/10.1016/j.biortech.2010.10.111 pmid:21095119
- View Article
- PubMed/NCBI
- Google Scholar
13. Cortez DV, Roberto IC. Individual and interaction effects of vanillin and syringaldehyde on the xylitol formation by Candida guilliermondii. Bioresour Technol [Internet]. Elsevier Ltd; 2010;101(6):1858–65. Available from: http://dx.doi.org/10.1016/j.biortech.2009.09.072 pmid:19822420
- View Article
- PubMed/NCBI
- Google Scholar
14. Uwagboe EO, Hamzat A, Olumide M, Akinbile LA. Utilization of cocoa pod husk (CPH) as substitute for maize in layers mash and perception of poultry farmers in NIgeria. Int J Sci an Nat. 2010;1(2):272–5.
- View Article
- Google Scholar
15. Network Commodity. Global Cocoa Production for 2015–2016 Pegged at 4.031 Million Tons [Internet]. CoffeeNetwork; 2016. Available from: http://www.coffeenetwork.com/Portal/Entities/_ShowContent.aspx?Eid=735&Iid=176436&Path=Documents/News/2016-12/735/ICCO quarterly bulletin dec 20 2016.doc&ContentType=application/msword
16. El-Shekeil YA, Sapuan SM, Algrafi MW. Effect of fiber loading on mechanical and morphological properties of cocoa pod husk fibers reinforced thermoplastic polyurethane composites. Mater Des [Internet]. Elsevier Ltd; 2014;64:330–3. Available from: http://dx.doi.org/10.1016/j.matdes.2014.07.034
- View Article
- Google Scholar
17. Njoku VO. Biosorption potential of cocoa pod husk for the removal of Zn(II) from aqueous phase. J Environ Chem Eng [Internet]. Elsevier Ltd.; 2014;2(2):881–7. Available from: http://dx.doi.org/10.1016/j.jece.2014.03.003
- View Article
- Google Scholar
18. Daud Z, Sari A, Kassim M, Aripin AM, Awang H, Hatta ZM. Chemical Composition and Morphological of Cocoa Pod Husks and Cassava Peels for Pulp and Paper Production. Aust J Basic Appl Sci. 2013;7(9):406–11.
- View Article
- Google Scholar
19. Igbinadolor RO, Onilude a a. Bioprocess systems applied for the production of bio- ethanol from lignocellulosic biomass of cocoa pod husk (Theobroma cacao L.) and other agricultural residues: A review. African J Biotechology. 2013;12(35):5375–88.
- View Article
- Google Scholar
20. Ofori-Boateng C, Lee KT. The potential of using cocoa pod husks as green solid base catalysts for the transesterification of soybean oil into biodiesel: Effects of biodiesel on engine performance. Chem Eng J [Internet]. 2013;220:395–401. Available from: http://dx.doi.org/10.1016/j.cej.2013.01.046
- View Article
- Google Scholar
21. Pua FL, Sajab MS, Chia CH, Zakaria S, Rahman IA, Salit MS. Alkaline-treated cocoa pod husk as adsorbent for removing methylene blue from aqueous solutions. J Environ Chem Eng [Internet]. Elsevier B.V.; 2013;1(3):460–5. Available from: http://dx.doi.org/10.1016/j.jece.2013.06.012
- View Article
- Google Scholar
22. Syamsiro M, Saptoadi H, Tambunan BH, Pambudi NA. A preliminary study on use of cocoa pod husk as a renewable source of energy in Indonesia. Energy Sustain Dev [Internet]. International Energy Initiative; 2012;16(1):74–7. Available from: http://dx.doi.org/10.1016/j.esd.2011.10.005
- View Article
- Google Scholar
23. Vriesmann LC, Teófilo RF, Petkowicz CL de O. Extraction and characterization of pectin from cacao pod husks (Theobroma cacao L.) with citric acid. LWT—Food Sci Technol. 2012;49(1):108–16.
- View Article
- Google Scholar
24. Oddoye EOK, Rhule SWA, Anchirinah V, Ansah FO. Fresh cocoa pod husk as an ingredient in the diets of growing pigs. Sci Res Essays. 2010;5(May):1141–4.
- View Article
- Google Scholar
25. Alemawor F, Dzogbefia VP, Oddoye EOK, Oldham JH. Enzyme cocktail for enhancing poultry utilisation of cocoa pod husk. Sci Res Essays. 2009;4(6):555–9.
- View Article
- Google Scholar
26. Aregheore EM. Chemical evaluation and digestibility of cocoa (Theobroma cacao) byproducts fed to goats. Trop Anim Health Prod. 2002;34(4):339–48. pmid:12166335
- View Article
- PubMed/NCBI
- Google Scholar
27. AOAC—Association of Official Analytical Chemistry. Official Methods of Analysis. Arlington.: AOAC International; 1995.
28. SILVA FILHO EA, MELO HF, ANTUNES DF, SANTOS SK, RESENDE AM, SIMÕES DA, et al. Isolation by genetic and physiological characteristics of a fuel-ethanol fermentative Saccharomyces cerevisiae strain with potential for genetic manipulation. J Ind Microbiol Biotechnol. 2005;32(10):481–6. pmid:16175407
- View Article
- PubMed/NCBI
- Google Scholar
29. Villarreal ML., Prata a MR, Felipe MG., Almeida E Silva JB. Detoxification procedures of eucalyptus hemicellulose hydrolysate for xylitol production by Candida guilliermondii. Enzyme Microb Technol [Internet]. 2006 Dec [cited 2013 Aug 12];40(1):17–24. Available from: http://linkinghub.elsevier.com/retrieve/pii/S0141022906002237
- View Article
- Google Scholar
30. Canilha L, Carvalho W, de Almeida Felipe M. et al. Ethanol Production from Sugarcane Bagasse Hydrolysate Using Pichiastipitis. Appl Biochem Biotechnol. 2010;84:161.
- View Article
- Google Scholar
31. Preziosi-Belloy L, Nolleau V, Navarro JM. Fermentation of hemicellulosic sugars and sugar mixtures to xylitol by Candida parapsilosis. Enzyme Microb Technol [Internet]. 1997;21(2):124–9. Available from: http://linkinghub.elsevier.com/retrieve/pii/S0141022996002475
- View Article
- Google Scholar
32. Caes BR, Teixeira RE, Knapp KG, Raines RT. Biomass to Furanics: Renewable Routes to Chemicals and Fuels. ACS Sustain Chem Eng. 2015;3(11):2591–605.
- View Article
- Google Scholar
33. Li H, Chen X, Ren J, Deng H, Peng F, Sun R. Functional relationship of furfural yields and the hemicellulose-derived sugars in the hydrolysates from corncob by microwave-assisted hydrothermal pretreatment. Biotechnol Biofuels [Internet]. BioMed Central; 2015;8(1):127. Available from: http://www.scopus.com/inward/record.url?eid=2-s2.0-84940185265&partnerID=tZOtx3y1
- View Article
- Google Scholar
34. Tamanini C, Hauly MCDO. Agro-industrial residues in biotechnological production of xylitol. Semin Ciências Agrárias. 2004;25(4):315–30.
- View Article
- Google Scholar
35. Salgado JM, Rodríguez N, Cortés S, Domínguez JM. Coupling two sizes of CSTR-type bioreactors for sequential lactic acid and xylitol production from hemicellulosic hydrolysates of vineshoot trimmings. N Biotechnol [Internet]. 2012 Feb 15 [cited 2013 Aug 12];29(3):421–7. Available from: http://www.ncbi.nlm.nih.gov/pubmed/21807126 pmid:21807126
- View Article
- PubMed/NCBI
- Google Scholar
36. Rocha MVP, Rodrigues THS, de Albuquerque TL, Gonçalves LRB, de Macedo GR. Evaluation of dilute acid pretreatment on cashew apple bagasse for ethanol and xylitol production. Chem Eng J [Internet]. Elsevier B.V.; 2014;243:234–43. Available from: http://dx.doi.org/10.1016/j.cej.2013.12.099
- View Article
- Google Scholar
37. Ge JP, Cai BY, Liu GM, Ling HZ, Fang BZ, Song G, et al. Comparison of different detoxification methods for corn cob hemicelluose hydrolysate to improve ethanol production by Candida shehatae ACCC 20335. African J Microbiol Res [Internet]. 2011;5(10):1163–8. Available from: http://www.scopus.com/inward/record.url?eid=2-s2.0-79960183218&partnerID=40&md5=e0986b76551995473c6dd5a0b670c3fe
- View Article
- Google Scholar
38. Canilha L, de Almeida e Silva JB, Solenzal AIN. Eucalyptus hydrolysate detoxification with activated charcoal adsorption or ion-exchange resins for xylitol production. Process Biochem [Internet]. 2004 Oct [cited 2013 Aug 12];39(12):1909–12. Available from: http://linkinghub.elsevier.com/retrieve/pii/S0032959203003558
- View Article
- Google Scholar
39. Zhang J, Geng A, Yao C, Lu Y, Li Q. Effects of lignin-derived phenolic compounds on xylitol production and key enzyme activities by a xylose utilizing yeast Candida athensensis SB18. Bioresour Technol [Internet]. Elsevier Ltd; 2012 Oct [cited 2013 Aug 12];121:369–78. Available from: http://www.ncbi.nlm.nih.gov/pubmed/22864173 pmid:22864173
- View Article
- PubMed/NCBI
- Google Scholar
40. Venkateswar Rao L, Goli JK, Gentela J, Koti S. Bioconversion of lignocellulosic biomass to xylitol: An overview. Bioresour Technol [Internet]. Elsevier Ltd; 2015;213:299–310. Available from: http://dx.doi.org/10.1016/j.biortech.2016.04.092
- View Article
- Google Scholar
41. Wang W, Ling H, Zhao H. Steam explosion pretreatment of corn straw on xylose recovery and xylitol production using hydrolysate without detoxification. Process Biochem [Internet]. Elsevier Ltd; 2015; Available from: http://linkinghub.elsevier.com/retrieve/pii/S1359511315300106
- View Article
- Google Scholar
42. Felipe MGA, Alves LA, Silva SS, Roberto IC, Mancilha IM, Almeida e Silva JB. Fermentation of Eucalyptus Hemicellulosic Hydrolysate to Xylitol by Candida guilliermondii. Bioresour Technol. 1996;56:281–3.
- View Article
- Google Scholar
43. Vandeska E, Amartey S, Kuzmanova S, Jeffries TW. Fed-batch culture for xylitol production by Candida boidinii. Process Biochem. 1996;31(3):265–70.
- View Article
- Google Scholar
44. Gonçalves DB, Batista AF, Rodrigues MQRB, Nogueira KM V, Santos VL. Ethanol production from macaúba (Acrocomia aculeata) presscake hemicellulosic hydrolysate by Candida boidinii UFMG14. Bioresour Technol [Internet]. Elsevier Ltd; 2013;146:261–6. Available from: http://dx.doi.org/10.1016/j.biortech.2013.07.075 pmid:23941709
- View Article
- PubMed/NCBI
- Google Scholar

[ref1] 1. Santos DT, Sarrouh BF, Rivaldi JD, Converti A, Silva SS. Use of sugarcane bagasse as biomaterial for cell immobilization for xylitol production. J Food Eng [Internet]. 2008 Jun [cited 2013 Aug 12];86(4):542–8. Available from: http://linkinghub.elsevier.com/retrieve/pii/S0260877407005687
View Article
Google Scholar

[2] View Article

[3] Google Scholar

[ref2] 2. Parajó JC, Dominguez H, Domínguez JM. Improved xylitol production with Debaryomyces hansenii Y-7426 from raw or detoxified wood hydrolysates. Enzyme Microb Technol [Internet]. 1997;21(1):18–24. Available from: http://linkinghub.elsevier.com/retrieve/pii/S0141022996002104
View Article
Google Scholar

[5] View Article

[6] Google Scholar

[ref3] 3. Misra S, Raghuwanshi S, Saxena RK. Evaluation of corncob hemicellulosic hydrolysate for xylitol production by adapted strain of Candida tropicalis. Carbohydr Polym [Internet]. Elsevier Ltd.; 2013 Feb 15 [cited 2013 Aug 12];92(2):1596–601. Available from: http://www.ncbi.nlm.nih.gov/pubmed/23399194 pmid:23399194
View Article
PubMed/NCBI
Google Scholar

[8] View Article

[9] PubMed/NCBI

[10] Google Scholar

[ref4] 4. Zhang D, Ong YL, Li Z, Wu JC. Optimization of dilute acid-catalyzed hydrolysis of oil palm empty fruit bunch for high yield production of xylose. Chem Eng J [Internet]. Elsevier B.V.; 2012;181–182:636–42. Available from: http://dx.doi.org/10.1016/j.cej.2011.12.030
View Article
Google Scholar

[12] View Article

[13] Google Scholar

[ref5] 5. Zhang J, Geng A, Yao C, Lu Y, Li Q. Xylitol production from D-xylose and horticultural waste hemicellulosic hydrolysate by a new isolate of Candida athensensis SB18. Bioresour Technol [Internet]. Elsevier Ltd; 2012 Feb [cited 2013 Aug 12];105:134–41. Available from: http://www.ncbi.nlm.nih.gov/pubmed/22196071 pmid:22196071
View Article
PubMed/NCBI
Google Scholar

[15] View Article

[16] PubMed/NCBI

[17] Google Scholar

[ref6] 6. Wang L, Yang M, Fan X, Zhu X, Xu T, Yuan Q. An environmentally friendly and efficient method for xylitol bioconversion with high-temperature-steaming corncob hydrolysate by adapted Candida tropicalis. Process Biochem [Internet]. Elsevier Ltd; 2011 Aug [cited 2013 Aug 12];46(8):1619–26. Available from: http://linkinghub.elsevier.com/retrieve/pii/S1359511311001632
View Article
Google Scholar

[19] View Article

[20] Google Scholar

[ref7] 7. Ravindran R, Jaiswal AK. A comprehensive review on pre-treatment strategy for lignocellulosic food industry waste: Challenges and opportunities. Bioresour Technol [Internet]. Elsevier Ltd; 2016;199:92–102. Available from: http://dx.doi.org/10.1016/j.biortech.2015.07.106 pmid:26277268
View Article
PubMed/NCBI
Google Scholar

[22] View Article

[23] PubMed/NCBI

[24] Google Scholar

[ref8] 8. Sindhu R, Binod P, Pandey A. Biological pretreatment of lignocellulosic biomass—An overview. Bioresour Technol [Internet]. Elsevier Ltd; 2016;199:76–82. Available from: http://dx.doi.org/10.1016/j.biortech.2015.08.030 pmid:26320388
View Article
PubMed/NCBI
Google Scholar

[26] View Article

[27] PubMed/NCBI

[28] Google Scholar

[ref9] 9. Jönsson LJ, Martín C. Pretreatment of lignocellulose: Formation of inhibitory by-products and strategies for minimizing their effects. Bioresour Technol. 2016;199:103–12. pmid:26482946
View Article
PubMed/NCBI
Google Scholar

[30] View Article

[31] PubMed/NCBI

[32] Google Scholar

[ref10] 10. Wang S, Li H, Fan X, Zhang J, Tang P, Yuan Q. Metabolic responses in Candida tropicalis to complex inhibitors during xylitol bioconversion. Fungal Genet Biol [Internet]. Elsevier Inc.; 2015;82:1–8. Available from: http://linkinghub.elsevier.com/retrieve/pii/S1087184515001498 pmid:26127015
View Article
PubMed/NCBI
Google Scholar

[34] View Article

[35] PubMed/NCBI

[36] Google Scholar

[ref11] 11. Ping Y, Ling H-Z, Song G, Ge J-P. Xylitol production from non-detoxified corncob hemicellulose acid hydrolysate by Candida tropicalis. Biochem Eng J [Internet]. Elsevier B.V.; 2013 Jun [cited 2013 Aug 12];75:86–91. Available from: http://linkinghub.elsevier.com/retrieve/pii/S1369703X13000934
View Article
Google Scholar

[38] View Article

[39] Google Scholar

[ref12] 12. Huang CF, Jiang YF, Guo GL, Hwang WS. Development of a yeast strain for xylitol production without hydrolysate detoxification as part of the integration of co-product generation within the lignocellulosic ethanol process. Bioresour Technol [Internet]. Elsevier Ltd; 2011;102(3):3322–9. Available from: http://dx.doi.org/10.1016/j.biortech.2010.10.111 pmid:21095119
View Article
PubMed/NCBI
Google Scholar

[41] View Article

[42] PubMed/NCBI

[43] Google Scholar

[ref13] 13. Cortez DV, Roberto IC. Individual and interaction effects of vanillin and syringaldehyde on the xylitol formation by Candida guilliermondii. Bioresour Technol [Internet]. Elsevier Ltd; 2010;101(6):1858–65. Available from: http://dx.doi.org/10.1016/j.biortech.2009.09.072 pmid:19822420
View Article
PubMed/NCBI
Google Scholar

[45] View Article

[46] PubMed/NCBI

[47] Google Scholar

[ref14] 14. Uwagboe EO, Hamzat A, Olumide M, Akinbile LA. Utilization of cocoa pod husk (CPH) as substitute for maize in layers mash and perception of poultry farmers in NIgeria. Int J Sci an Nat. 2010;1(2):272–5.
View Article
Google Scholar

[49] View Article

[50] Google Scholar

[ref15] 15. Network Commodity. Global Cocoa Production for 2015–2016 Pegged at 4.031 Million Tons [Internet]. CoffeeNetwork; 2016. Available from: http://www.coffeenetwork.com/Portal/Entities/_ShowContent.aspx?Eid=735&Iid=176436&Path=Documents/News/2016-12/735/ICCO quarterly bulletin dec 20 2016.doc&ContentType=application/msword

[ref16] 16. El-Shekeil YA, Sapuan SM, Algrafi MW. Effect of fiber loading on mechanical and morphological properties of cocoa pod husk fibers reinforced thermoplastic polyurethane composites. Mater Des [Internet]. Elsevier Ltd; 2014;64:330–3. Available from: http://dx.doi.org/10.1016/j.matdes.2014.07.034
View Article
Google Scholar

[53] View Article

[54] Google Scholar

[ref17] 17. Njoku VO. Biosorption potential of cocoa pod husk for the removal of Zn(II) from aqueous phase. J Environ Chem Eng [Internet]. Elsevier Ltd.; 2014;2(2):881–7. Available from: http://dx.doi.org/10.1016/j.jece.2014.03.003
View Article
Google Scholar

[56] View Article

[57] Google Scholar

[ref18] 18. Daud Z, Sari A, Kassim M, Aripin AM, Awang H, Hatta ZM. Chemical Composition and Morphological of Cocoa Pod Husks and Cassava Peels for Pulp and Paper Production. Aust J Basic Appl Sci. 2013;7(9):406–11.
View Article
Google Scholar

[59] View Article

[60] Google Scholar

[ref19] 19. Igbinadolor RO, Onilude a a. Bioprocess systems applied for the production of bio- ethanol from lignocellulosic biomass of cocoa pod husk (Theobroma cacao L.) and other agricultural residues: A review. African J Biotechology. 2013;12(35):5375–88.
View Article
Google Scholar

[62] View Article

[63] Google Scholar

[ref20] 20. Ofori-Boateng C, Lee KT. The potential of using cocoa pod husks as green solid base catalysts for the transesterification of soybean oil into biodiesel: Effects of biodiesel on engine performance. Chem Eng J [Internet]. 2013;220:395–401. Available from: http://dx.doi.org/10.1016/j.cej.2013.01.046
View Article
Google Scholar

[65] View Article

[66] Google Scholar

[ref21] 21. Pua FL, Sajab MS, Chia CH, Zakaria S, Rahman IA, Salit MS. Alkaline-treated cocoa pod husk as adsorbent for removing methylene blue from aqueous solutions. J Environ Chem Eng [Internet]. Elsevier B.V.; 2013;1(3):460–5. Available from: http://dx.doi.org/10.1016/j.jece.2013.06.012
View Article
Google Scholar

[68] View Article

[69] Google Scholar

[ref22] 22. Syamsiro M, Saptoadi H, Tambunan BH, Pambudi NA. A preliminary study on use of cocoa pod husk as a renewable source of energy in Indonesia. Energy Sustain Dev [Internet]. International Energy Initiative; 2012;16(1):74–7. Available from: http://dx.doi.org/10.1016/j.esd.2011.10.005
View Article
Google Scholar

[71] View Article

[72] Google Scholar

[ref23] 23. Vriesmann LC, Teófilo RF, Petkowicz CL de O. Extraction and characterization of pectin from cacao pod husks (Theobroma cacao L.) with citric acid. LWT—Food Sci Technol. 2012;49(1):108–16.
View Article
Google Scholar

[74] View Article

[75] Google Scholar

[ref24] 24. Oddoye EOK, Rhule SWA, Anchirinah V, Ansah FO. Fresh cocoa pod husk as an ingredient in the diets of growing pigs. Sci Res Essays. 2010;5(May):1141–4.
View Article
Google Scholar

[77] View Article

[78] Google Scholar

[ref25] 25. Alemawor F, Dzogbefia VP, Oddoye EOK, Oldham JH. Enzyme cocktail for enhancing poultry utilisation of cocoa pod husk. Sci Res Essays. 2009;4(6):555–9.
View Article
Google Scholar

[80] View Article

[81] Google Scholar

[ref26] 26. Aregheore EM. Chemical evaluation and digestibility of cocoa (Theobroma cacao) byproducts fed to goats. Trop Anim Health Prod. 2002;34(4):339–48. pmid:12166335
View Article
PubMed/NCBI
Google Scholar

[83] View Article

[84] PubMed/NCBI

[85] Google Scholar

[ref27] 27. AOAC—Association of Official Analytical Chemistry. Official Methods of Analysis. Arlington.: AOAC International; 1995.

[ref28] 28. SILVA FILHO EA, MELO HF, ANTUNES DF, SANTOS SK, RESENDE AM, SIMÕES DA, et al. Isolation by genetic and physiological characteristics of a fuel-ethanol fermentative Saccharomyces cerevisiae strain with potential for genetic manipulation. J Ind Microbiol Biotechnol. 2005;32(10):481–6. pmid:16175407
View Article
PubMed/NCBI
Google Scholar

[88] View Article

[89] PubMed/NCBI

[90] Google Scholar

[ref29] 29. Villarreal ML., Prata a MR, Felipe MG., Almeida E Silva JB. Detoxification procedures of eucalyptus hemicellulose hydrolysate for xylitol production by Candida guilliermondii. Enzyme Microb Technol [Internet]. 2006 Dec [cited 2013 Aug 12];40(1):17–24. Available from: http://linkinghub.elsevier.com/retrieve/pii/S0141022906002237
View Article
Google Scholar

[92] View Article

[93] Google Scholar

[ref30] 30. Canilha L, Carvalho W, de Almeida Felipe M. et al. Ethanol Production from Sugarcane Bagasse Hydrolysate Using Pichiastipitis. Appl Biochem Biotechnol. 2010;84:161.
View Article
Google Scholar

[95] View Article

[96] Google Scholar

[ref31] 31. Preziosi-Belloy L, Nolleau V, Navarro JM. Fermentation of hemicellulosic sugars and sugar mixtures to xylitol by Candida parapsilosis. Enzyme Microb Technol [Internet]. 1997;21(2):124–9. Available from: http://linkinghub.elsevier.com/retrieve/pii/S0141022996002475
View Article
Google Scholar

[98] View Article

[99] Google Scholar

[ref32] 32. Caes BR, Teixeira RE, Knapp KG, Raines RT. Biomass to Furanics: Renewable Routes to Chemicals and Fuels. ACS Sustain Chem Eng. 2015;3(11):2591–605.
View Article
Google Scholar

[101] View Article

[102] Google Scholar

[ref33] 33. Li H, Chen X, Ren J, Deng H, Peng F, Sun R. Functional relationship of furfural yields and the hemicellulose-derived sugars in the hydrolysates from corncob by microwave-assisted hydrothermal pretreatment. Biotechnol Biofuels [Internet]. BioMed Central; 2015;8(1):127. Available from: http://www.scopus.com/inward/record.url?eid=2-s2.0-84940185265&partnerID=tZOtx3y1
View Article
Google Scholar

[104] View Article

[105] Google Scholar

[ref34] 34. Tamanini C, Hauly MCDO. Agro-industrial residues in biotechnological production of xylitol. Semin Ciências Agrárias. 2004;25(4):315–30.
View Article
Google Scholar

[107] View Article

[108] Google Scholar

[ref35] 35. Salgado JM, Rodríguez N, Cortés S, Domínguez JM. Coupling two sizes of CSTR-type bioreactors for sequential lactic acid and xylitol production from hemicellulosic hydrolysates of vineshoot trimmings. N Biotechnol [Internet]. 2012 Feb 15 [cited 2013 Aug 12];29(3):421–7. Available from: http://www.ncbi.nlm.nih.gov/pubmed/21807126 pmid:21807126
View Article
PubMed/NCBI
Google Scholar

[110] View Article

[111] PubMed/NCBI

[112] Google Scholar

[ref36] 36. Rocha MVP, Rodrigues THS, de Albuquerque TL, Gonçalves LRB, de Macedo GR. Evaluation of dilute acid pretreatment on cashew apple bagasse for ethanol and xylitol production. Chem Eng J [Internet]. Elsevier B.V.; 2014;243:234–43. Available from: http://dx.doi.org/10.1016/j.cej.2013.12.099
View Article
Google Scholar

[114] View Article

[115] Google Scholar

[ref37] 37. Ge JP, Cai BY, Liu GM, Ling HZ, Fang BZ, Song G, et al. Comparison of different detoxification methods for corn cob hemicelluose hydrolysate to improve ethanol production by Candida shehatae ACCC 20335. African J Microbiol Res [Internet]. 2011;5(10):1163–8. Available from: http://www.scopus.com/inward/record.url?eid=2-s2.0-79960183218&partnerID=40&md5=e0986b76551995473c6dd5a0b670c3fe
View Article
Google Scholar

[117] View Article

[118] Google Scholar

[ref38] 38. Canilha L, de Almeida e Silva JB, Solenzal AIN. Eucalyptus hydrolysate detoxification with activated charcoal adsorption or ion-exchange resins for xylitol production. Process Biochem [Internet]. 2004 Oct [cited 2013 Aug 12];39(12):1909–12. Available from: http://linkinghub.elsevier.com/retrieve/pii/S0032959203003558
View Article
Google Scholar

[120] View Article

[121] Google Scholar

[ref39] 39. Zhang J, Geng A, Yao C, Lu Y, Li Q. Effects of lignin-derived phenolic compounds on xylitol production and key enzyme activities by a xylose utilizing yeast Candida athensensis SB18. Bioresour Technol [Internet]. Elsevier Ltd; 2012 Oct [cited 2013 Aug 12];121:369–78. Available from: http://www.ncbi.nlm.nih.gov/pubmed/22864173 pmid:22864173
View Article
PubMed/NCBI
Google Scholar

[123] View Article

[124] PubMed/NCBI

[125] Google Scholar

[ref40] 40. Venkateswar Rao L, Goli JK, Gentela J, Koti S. Bioconversion of lignocellulosic biomass to xylitol: An overview. Bioresour Technol [Internet]. Elsevier Ltd; 2015;213:299–310. Available from: http://dx.doi.org/10.1016/j.biortech.2016.04.092
View Article
Google Scholar

[127] View Article

[128] Google Scholar

[ref41] 41. Wang W, Ling H, Zhao H. Steam explosion pretreatment of corn straw on xylose recovery and xylitol production using hydrolysate without detoxification. Process Biochem [Internet]. Elsevier Ltd; 2015; Available from: http://linkinghub.elsevier.com/retrieve/pii/S1359511315300106
View Article
Google Scholar

[130] View Article

[131] Google Scholar

[ref42] 42. Felipe MGA, Alves LA, Silva SS, Roberto IC, Mancilha IM, Almeida e Silva JB. Fermentation of Eucalyptus Hemicellulosic Hydrolysate to Xylitol by Candida guilliermondii. Bioresour Technol. 1996;56:281–3.
View Article
Google Scholar

[133] View Article

[134] Google Scholar

[ref43] 43. Vandeska E, Amartey S, Kuzmanova S, Jeffries TW. Fed-batch culture for xylitol production by Candida boidinii. Process Biochem. 1996;31(3):265–70.
View Article
Google Scholar

[136] View Article

[137] Google Scholar

[ref44] 44. Gonçalves DB, Batista AF, Rodrigues MQRB, Nogueira KM V, Santos VL. Ethanol production from macaúba (Acrocomia aculeata) presscake hemicellulosic hydrolysate by Candida boidinii UFMG14. Bioresour Technol [Internet]. Elsevier Ltd; 2013;146:261–6. Available from: http://dx.doi.org/10.1016/j.biortech.2013.07.075 pmid:23941709
View Article
PubMed/NCBI
Google Scholar

[139] View Article

[140] PubMed/NCBI

[141] Google Scholar

Figures

Abstract

Introduction

Materials and methods

Characterization of waste

Microorganism and medium preparation

Experimental design and statistical analysis on obtaining the hemicellulose hydrolysate

Hydrolysate detoxification

pH adjustment and adsorption with activated charcoal.

Use of ion-exchange resins.

Fermentation of the CPHHH

Fermentation of the CPHHH without detoxification by C. boidinii.

Fermentation of the physicochemically-detoxified CPHHH.

Analytical methods

Results and discussion

Optimization of the acid hydrolysis of cocoa residue

Characterization of the hydrolysate

Detoxification processes

Detoxification by pH adjustment and adsorption with activated charcoal.

Use of ion-exchange resins.

Fermentation of the CPHHH

Fermentation of the CPHHH without detoxification by C. boidinii.

Fermentation of the CPHHH detoxified by pH adjustment and activated charcoal.

Conclusions

Supporting information

S1 Supporting Information. Subjacent data—Plos One.

S1 Fig. Fermentation chromatogram of CPHHH.

Acknowledgments

References