Abstract

Controlled ovarian hyperstimulation (COH) used in IVF produces lower implantation rates per embryo transferred compared to natural cycles utilized in ovum donation, suggesting a suboptimal endometrial development. Endometrial receptivity has recently been investigated in natural menstrual cycles with the aid of microarray technology. The aim of this study is to investigate the impact of COH using urinary gonadotrophins with a long protocol with GnRH agonists without progesterone supplementation (similar to the natural cycle) on endometrial gene expression profiles during the window of implantation by comparing the profiles at day hCG+7 of COH versus LH+7 of a previous natural cycle in the same women. For this purpose we have used microarray technology by Affymetrix (GeneChip HG_U133A), which allows more than 22 000 genes to be tested simultaneously. Results were validated by semi-quantitative PCR and quantitative PCR experiments. We found that more than 200 genes showed a differential expression of more than 3-fold when COH and normal cycles were compared at hCG+7 versus LH+7. We simultaneously re-analysed the LH+2 versus LH+7 endometrial gene expression profiles in previous natural cycles in the same subject using this specific GeneChip, the results obtained were consistent with our own published results. This is the first time that gene expression profiles of the endometrium during COH are reported. The large degree of gene expression disturbance is surprising and highlights the need for further efforts to optimize COH protocols.

Introduction

Assisted reproduction technologies have provided considerable insight into the human reproductive processes. However, lower implantation rates per transferred embryo than those in natural cycles remain a major problem that is compensated for by increasing the number of transferred embryos (American Society for Reproductive Medicine, 2002) at the cost of increased numbers of twin and triplet pregnancies.

Clinical studies suggest that in patients that display high response to gonadotrophins, supraphysiological levels of estradiol (E2) on the day of hCG administration, are deleterious to embryonic implantation (Simón et al., 1995, 1998, 2003; Pellicer et al., 1996). Furthermore, it has been demonstrated that while low doses of E2 maintain the uterus in a receptive state, high doses cause it to become refractory in mice (Ma et al., 2003). Uterine receptivity is diminished during controlled ovarian hyperstimulation (COH) used for IVF compared to natural cycles (Paulson et al., 2000). The endometrium suffers a morphological advancement in the early luteal phase, which is demonstrated by histological techniques (Seif et al., 1992; Psychoyos, 1994; Kolb and Paulson, 1997; Kolibianakis et al., 2003), scanning electron microscopy (Nikas et al., 1999; Giudice, 2003), down-regulation of endometrial estrogen receptor and progesterone receptor (Develioglu et al., 1999) and biochemical changes in the endometrial fluid (Simón et al., 1996). This is not surprising considering that the aim of ovulation induction is to recruit a sufficient number of oocytes, and as a side-effect supraphysiological levels of steroid hormones and paracrine mediators are produced and received by the endometrium.

Following completion of the Human Genome sequence, the principal goal in this field of work has been to enumerate genes involved in the physiological and pathological processes. Genomic analysis of human endometrial receptivity have recently been employed and genome-wide analysis with DNA microarray technology demonstrates that receptivity is an active process involving hundreds of up- and down-regulated genes (Carson et al., 2002; Kao et al., 2002; Borthwick et al., 2003; Riesewijk et al., 2003). One important step forward would be a more operational understanding of the molecular impact of therapeutic interventions in the development of endometrial receptivity. In the present study, we have investigated the genomic impact of COH on the human endometrium during IVF treatment. Our institution's oocyte donation programme allows us the opportunity of obtaining endometrial biopsies in patients undergoing a COH cycle but who did not undergo embryo transfer. Experiments were designed to analyse, using microarray technology, the endometrial gene expression profile in the prereceptive (LH+2, 5 samples) and receptive (LH+7, 14 samples) endometrium in a natural cycle and compare it with that at day hCG+7 (5 samples) during COH in the IVF cycle.

Materials and methods

Experimental subjects

The study population comprised of healthy, fertile women with normal cycles (Caucasians, between the ages of 23 and 39) who served as oocyte donors in our institution. Volunteers signed an informed consent form approved by the Institutional Review Board of our Institution. Patients were followed-up during their natural cycles and during the following cycle, in which COH was performed for IVF.

Endometrial biopsies were obtained from two groups of patients using different experimental designs. In the first group, samples were obtained at days LH+2 (n=5) and LH+7 (n=5) as determined by urinary LH surge during the natural cycle from the same patients to reconfirm previous findings. In the second group, endometrial samples were obtained from the same patients at day LH+7 (n=9) of the natural cycle and at day hCG+7 (n=5) of the next cycle during COH used for IVF treatment (10 women were included in this group, 10 samples were obtained in the natural cycle but one was removed because of the low quality of RNA, only five patients continued the study and samples were obtained at day hCG+7).

In total, 24 endometrial biopsies were obtained, 5 corresponding to LH+2, 14 to LH+7 and 5 to hCG+7. Daily assessment of the urinary LH levels beginning on cycle day 10 was performed by the patients using a commercially available ovulation predictor kit (Donacheck ovulación, Novalab Ibérica, S.A.L, Coslada, Madrid, Spain) and the day of the urinary LH surge was considered as LH = 0. Overall, 24 biopsies were obtained from the uterine fundus using a Pipelle catheter (Genetics, Namont-Achel, Belgium) under sterile conditions.

COH protocol

The protocol for ovarian stimulation used was a long protocol with GnRH agonist without progesterone supplementation. It was initiated by pituitary desensitization via administration of 1 mg/d leuprolide acetate, subcutaneously (Procrin, Abbot S.A., Madrid, Spain), beginning in the luteal phase of the previous cycle. Serum E2 levels <60 pg/ml (220 pmol/l) and negative vaginal ultrasonographic scans were used to define ovarian quiescence. On days 1 and 2 of ovarian stimulation, one ampule/day HMG (Pergonal, Serono Laboratories, Madrid, Spain) was administered together with three ampules of highly purified FSH (FSH HP, Neo-Fertinorm, Serono). On days 3, 4 and 5 of ovarian stimulation, one ampule/day of HMG and one ampule/day of FSH HP were given to each patient. From day 6 onwards, HMG/FSH HP was administered on an individual basis according to the serum E2 levels and transvaginal ovarian ultrasound scans. hCG (10 000 IU, Profasi, Serono) was administered when two or more follicles with a maximum diameter of >19 mm and when serum E2 levels >800 pg/ml (2.94 nmol/l) were observed. Leuprolide acetate and gonadotropin injections were discontinued on the day of hCG administration. Oocyte retrieval was scheduled 36–38 h after hCG injection and no progesterone luteal support was given to the patients, as in a natural cycle.

RNA isolation

Endometrial samples were snap-frozen in liquid nitrogen and stored at −70 °C until further processing. Total RNA was extracted using the ‘TRIzol method’ according to the protocol recommended by the manufacturer (Life Technologies, Inc., Gaithersburg, MD). In short, homogenized biopsies (1 ml TRIzol reagent/75 mg tissue) were incubated at room temperature for 5 min, chloroform (0.2 volumes of TRIzol) was then added and samples incubated for 2.5 min at room temperature. Thereafter, the said samples were centrifuged for 15 min at 12 000 g (4 °C). The aqueous phase was precipitated with an equal volume of 2-propanol, stored in ice for 5 min and centrifuged for 30 min at 12 000 g (4 °C). The pellet was washed with 75% ethanol and dissolved in DEPC-treated water. Approximately, 1–2 μg of total RNA was obtained per microgram of endometrial tissue. RNA quality was confirmed by Agilent 2100 bioanalyzer.

Affymetrix chip hybridization

All samples were hybridized onto the GeneChip HG_U133A (Affymetrix, High Wycombe, UK) encompassing more than 22 000 human DNA fragments (Liu et al., 2003). Details of the chip's content are available at the NetAffx Analysis Centre (www.affymetrix.com/analysis/index.affx).

The protocols for sample preparation and hybridization of the endometrial samples (5×LH+2, 14×LH+7, and 5×hCG+7) were adapted from the Affymetrix Technical Manual. In short, first strand cDNA was transcribed from 5 μg of total RNA (cDNA synthesis kit, Cat. No. 11917-020, Invitrogen, San Diego, CA) using T7-Oligo(dT)24 Promotor Primer (Ambion Cat. No. 5710, Austin, TX), followed by second strand synthesis using DNA polymerase I (Invitrogen, Cat. No. 11917-020). Double stranded cDNA was cleaned with the GeneChip® Sample Clean-up Module Kit (Affymetrix, Cat. No. 900371). Half of the sample was in vitro transcribed and biotin-labelled with the Enzo RNA Transcript Labeling Kit (Enzo Diagnostics, Farmingdale, NY). The cRNA synthesis typically yielded between 30 and 60 μg. Following a further clean-up round (Affymetrix, Cat. No. 900371), cRNA was fragmented into pieces ranging from 35 to 200 bases which was confirmed using Agilent 2100 Bioanalyzer technology. Fragmented cRNA samples (15 μg) were hybridized onto chips through 16 h of incubation at 45 °C with constant rotation. Chips were washed and stained using Affymetrix GeneChip Fluidics Station 400. Hybridized chips were scanned and data automigrated into Rosetta Resolver (Rosetta Biosoftware, Kirkland, WA). A chip quality report was evaluated for abnormal glyceraldehyde-3-phosphatedehydrogenase 3′/5′ ratios, average background and percentage of ‘Present Calls’.

Principal component analysis

Principal component analysis (PCA) was performed using the ‘analyse experiments using PCA’ option within Spotfire DecisionSite 7.2 (Spotfire, Göteborg, Sweden). A representative set of 500 random genes was selected by K-means clustering. The resulting table of 500 rows (genes) and columns (endometrial samples) was transposed and PCA was ran to detect and reduce the number of variables to three principal components, which represent the majority of the variability in the dataset. A two- or three-dimensional scatterplot was produced in order to visualize the differences in sample sets (LH+2, LH+7 and hCG+7) based on each sample's gene expression profile.

Gene expression analysis

The Rosetta Resolver allows normalization of sample data following selection of the appropriate samples for calculation of one-way analysis of variance (ANOVA). A one-way ANOVA with build ratio was calculated (LH+7 samples as baseline) in order to identify significant changes in expression levels between sample sets. The results of ANOVA contain fold change values and P-values per gene.

Three criteria were used to define genes that had altered mRNA abundance among the different sample sets:

  1. An absolute fold change of 2.0 or more.

  2. A corresponding fold change P-value of 0.01 or less.

  3. The number of Present Calls within the high expressing sample group of more than 75%. (Present Calls were calculated using the P-value for significance of expression obtained from the Affymetrix Microarray Suite version 5.0 (MAS5) processed expression signals. A P-value of 0.05 or less was scored as present and higher values as absent. Depending on the sample size at least 4 out of 5, or 11 out of 14 samples in the high expressing group should have a Present Call.

Quantitative-PCR analysis

cDNA synthesis

RNA from patients of each group (LH+2, LH+7 and hCG+7) was pooled. Oligo(dT)12–18 primer (0.5 μg, Invitrogen) and 1.0 μg pd(N)6 (Amersham Pharmacia Biotech, Inc.) was added to 1 μg of total RNA. The mixture was heated at 65 °C for 5 min and briefly chilled on ice for 2 min. cDNA was synthesized in a total volume of 20 μl containing 50 mM Tris–HCl (pH 8.3), 75 mM KCl, 3 mM MgCl2, 10 mM dithiothreitol, 0.5 mM dNTPs and 200 U Superscript II RNase H Reverse Transcriptase (Invitrogen). The subsequent incubation process was carried out as follows: 10 min at 25 °C, 50 min at 42 °C and 15 min at 70 °C. The cDNA was diluted to a concentration equivalent to 2 ng/μl RNA.

Q-PCR

Q-PCR was performed using cDNA equivalent to 10 ng RNA in a total of 25 μl PCR mix. The total mix contained cDNA, 300 nM forward primer, 300 nM reverse primer and 1×SYBRgreen PCR Master Mix. The 2×SYBRgreen PCR Master Mix (Applied Biosystems) is optimized for SYBRgreen reactions and contains SYBRgreen I Dye, AmpliTaq Gold DNA Polymerase, dNTPs with dUTP, passive reference and optimized buffer components. The Q-PCR was performed in a MicroAmp Optical 96-well Reaction Plate (Applied Biosystems) with an ABI Prism Optical Adhesive Cover (Applied Biosystems) in the ABI PRISM 7900HT Sequence Detection System (Applied Biosystems). The selected program consisted of 10 min at 95 °C, 100% ramp, 40 cycles of 15 s at 95 °C, 100% ramp and 1 min at 60 °C, 100% ramp, followed by a dissociation curve step of 15 s at 95 °C, 100% ramp, 15 s at 60 °C, 100% ramp and 15 s at 95 °C, 2% ramp. Ramp is the speed with which the thermocycler switches to the next temperature, 100% is fast and 2% is slow. Standard curve material consisted of pooled endometrial RNA from all three groups. All reactions were performed in triplicate. The microarray data set was searched for genes that were not regulated in the three different sample sets, and therefore could be used for normalization in the Q-PCR experiments. Capping protein fulfilled these criteria (data not shown) and was subsequently used for normalization purposes in the Q-PCR. Table I shows the Q-PCR primer sequences, forward (F) and reverse (R).

Results

DNA chip hybridization data analysis

Ten patients started the protocol to obtain an endometrial biopsy at LH+7 in a natural cycle and at hCG+7 during a subsequent COH cycle. From nine of the 10 LH+7 samples, good quality RNA was obtained and five patients failed to deliver the hCG+7 biopsy, and in total from five hCG+7 biopsies good quality RNA was obtained. Together with the previously obtained LH+2 and LH+7 biopsies, in a total of 24 samples (5 LH+2, 14 LH+7 and 5 COH-hCG+7) were hybridized onto the Affymetrix HG_U133A chip. All 24 samples passed quality control.

Figure 1 shows a PCA for all the samples, which determines the key variables within the data set that explain the differences between the samples based on the expression profiles of 500 randomly selected genes. LH+2 samples are clearly distinguished from the two other sample sets at a separate position in the PCA analysis. Moreover, the five COH-hCG+7 samples also cluster together, whereas the majority of the LH+7 samples (11/14) cluster together at yet a different position in the PCA analysis. A minority of the LH+7 samples (3/14) seem to cluster in the proximity of the COH-hCG+7 samples. However, these are LH+7 samples and since we have not performed histological analyses on these samples we cannot omit these samples from further analysis.

In order to identify consistent changes in gene expression, the data of the different patients were grouped per category (LH+2;5 samples, LH+7;14 samples and hCG+7;5 samples). Genes that were differentially expressed among the groups were identified according to the procedure described in Materials and methods. As explained previously, the formation of a receptive endometrium is a dynamic process requiring the activation and repression of a large number of genes. Using our criteria, we compared the sets of data for LH+2 and LH+7 and identified 505 genes that were down-regulated in time (at LH+7), and 894 genes that were up-regulated, more than 2-fold during the formation of a receptive endometrium. Many of these genes were regulated over 5-fold (178 up- and 80 down-regulated). For the complete set of data see the supplementary information (Table R1, data sent to the reviewers).

We compared the data of the LH+2 versus LH+7 samples in the present study with our previous work employing an identical experimental design and methodology (Riesewijk et al., 2003). We found that 39 of the 40 most strongly up-regulated and 29 of the 30 most down-regulated genes of the previous study appeared in the results of the present study (Table R2, data sent to the reviewers). This finding is reassuring and indicates the consistency between the HU_95A and the HU_133A microarrays. Surprisingly, one of the new genes that came up in this study was leukaemia inhibitory factor (LIF) (+37-fold up-regulated at LH+7). This gene was also present at the HG_95A chip but was previously scored as not expressed.

In order to identify consistent changes in endometrial gene expression during the receptive phase in a natural cycle versus a COH cycle, data from the different patients were grouped according to category (LH+7 versus hCG+7). Genes differentially expressed in the two groups were identified according to the procedure described in Materials and methods.

COH induces significant differences in endometrial gene expression when compared to the previous natural cycle. In total 558 DNA fragments on the Affymetrix chip were differentially expressed, from which 281 were up-regulated compared to the natural cycle (166 genes between 2- and 3-fold, 74 between 3- and 5-fold and 41 >5-fold). Two hundred and seventy-seven genes were down-regulated (162 between 2- and 3-fold decrease, 72 between 3- and 5-fold and 44 >5-fold decrease). Genes that were up- or down-regulated by more than 3-fold are depicted in Tables II and III, respectively. These results are consistent with the high degree of difference between the three sample sets as observed in the PCA analysis.

Those genes that are differentially expressed in the LH+2 and LH+7 samples in natural cycles are important for the formation of a receptive endometrium [named as window of implantation (WOI) genes]. Therefore, we investigated whether the genes that were differentially expressed in the COH protocol and the natural cycle also belonged to the said group of WOI genes. Of the 558 DNA fragments that were differentially expressed in hCG+7 and LH+7 groups, 351 were also regulated during the formation of a receptive endometrium. Interestingly, genes that were normally down-regulated during the formation of a receptive endometrium tended to be expressed at a higher level during COH, whereas genes that were up-regulated in the WOI tended to be down-regulated during COH (Table IV). There were few genes that were up-regulated during the WOI and showed an increase in the said up-regulation following ovarian hyperstimulation. No genes were down-regulated during the WOI and further down-regulated after COH. The genes that were down-regulated in receptive endometrium and up-regulated in the IVF protocol or up-regulated in receptive endometrium and down-regulated in the IVF protocol are shown in bold in Tables II and III, respectively.

Validation of the microarray data by SQ-PCR and Q-PCR

To confirm our microarray data we performed semi-quantitative PCR (SQ-PCR) and Q-PCR analysis. SQ-PCR experiments were performed on pooled patient samples from each group to confirm the differential expression of 40 genes, among which were the progestagen-associated endometrial protein (glycodelin), transcobalamin I, the insulin-like growth factor binding protein 3, laminin beta-3 and calpain 6. Differential expression levels could be confirmed by SQ-PCR for most of the selected genes (R3, data sent to the reviewers). However, SQ-PCR is not a quantitative technique. Therefore seven genes (glycodelin, glutathione peroxidase 3 (GPx3), transcobalamin I and dipeptidyl peptidase 4 (DPP4), squalene epoxidase, secretoglobin 1D and CXCL13) were subjected to Q-PCR on the pooled material from LH+2, LH+7 and hCG+7 RNA samples. Capping protein, a non-regualted endometrially expressed gene, was used for normalization purposes. The results of the microarray and Q-PCR for these genes are depicted in Figure 2A and B, respectively. Differential expression was confirmed for all seven genes. In most cases, the fold change obtained with Q-PCR was greater than that calculated from the microarray. However, it was difficult to establish the fold change, for e.g. glycodelin and GPx3, since the LH+2 expression value was hardly detectable.

Discussion

It has long been hypothesized that gonadotrophins and GnRH agonist/antagonists used to induce multifollicular development in COH might also affect endometrial receptivity, either directly or indirectly. In this study we have used a genome-wide approach to compare gene expression patterns during the WOI in patients undergoing first a natural cycle and then a cycle in which COH with gonadotrophins and GnRH analogs is carried out for IVF.

All the women participating in this study were fertile and healthy and participated as oocyte donors in our IVF oocyte donation programme. Since embryos were not transferred back to these women it was possible to obtain an endometrial biopsy during the WOI following COH. The protocol used for COH was similar to protocols used for IVF in many clinics at the time the study was performed, with the difference that no luteal support was given to the oocyte donors in order to accurate comparison with the previous natural cycle without progesterone supplementation. COH was performed with a combination of human menopausal gonadotropin and purified FSH at a relatively high dose. In general, this protocol results in the retrieval of 13–18 oocytes and an average E2 level of 2200±300 pg/ml and progesterone levels below 1.2 ng/ml at the time of hCG administration (Pellicer et al., 1996). At hCG+7 we have previously reported an E2 level of 650 ± 30 pg/ml and a progesterone levels of 70 ng/ml (Pellicer et al., 1996).

Two sets of data were obtained as a result of this study: genes regulated during the formation of a receptive endometrium (LH+2 versus LH+7), called WOI genes and genes dys-regulated at the time of implantation in a COH protocol for IVF (hCG+7 versus LH+7). We have previously published the WOI gene data, generated with the LH+7 versus LH+2 comparison using Affymetrix HG-U95A array. In this study we have used the recently available HG-U133A genechip, which contains almost twice as many gene fragments. A large degree of overlap was identified when we compared our HG-U95A LH+7/LH+2 data with the genes identified in this study. More specifically, of the top 40 up-regulated and top 30 down-regulated genes from the HG-U95A set of data, 68 were also identified as being equally regulated in this study. Differences between the two data sets could be due to the fact that the new genechip (HG-U133A) includes more genes than the previously used genechip (HG-U95A) and that different probe sets were used for several genes. The latter is the case for the LIF gene which is also present in the previously used HG_U95A GeneChip, but which did not yield good hybridization signals when the said genechip was employed. This is in agreement with the results of other endometrial microarray studies, also using the HG_U95A chip (Carson et al., 2002; Kao et al., 2002; Borthwick et al., 2003). Another probe set is present for the LIF gene on the newer HG_U133A chip yielding good expression values and showing differential expression of LIF both in the natural cycle (36-fold up at LH+7) and during COH (23-fold down). LIF is a multifunctional cytokine, considered to be an essential endometrial factor for implantation in the mouse model (Stewart et al., 1992). In both studies we found that, during the formation of a receptive endometrium, more genes were up- than down-regulated in contrast to other authors (Carson et al., 2002; Kao et al., 2002).

When comparing the data of the hCG+7 samples with that of the natural cycle at LH+7 we found to our surprise that the expression of a large number of genes (558) was dys-regulated. We identified equal numbers of up- and down-regulated genes, while more than 200 genes were dys-regulated with a fold change of >3, of which 80 showed a fold change of >5. This unexpected result was confirmed for a number of genes by SQ-PCR and Q-PCR. The consistency of the individual endometrial expression profiles, demonstrated using microarray technology, is surprising. At the microscopical level a large degree of variation in endometrial morphology has been described (Nikas, 2000). Unfortunately, since no histological data are presented, the genomic differences obtained in the endometrium from COH cycle versus the previous natural cycle from the same patient could be due to the advancement of endometrial histology or not.

Why is endometrial gene expression disturbed in such a dramatic way in these patients? We know from previous studies that luteal phase defects are frequently observed during COH. The addition of luteal support, either in the form of progesterone, or as hCG, improves endometrial quality, and consequently, implantation rates. However, the biological mechanism of this luteal support is unclear, since progesterone levels are already supra-physiological in COH cycles, at least during the first 7 days after hCG (Fauser and Devroey, 2003), which is within the time frame in which our biopsies were taken. It would be interesting to analyse whether the dys-regulated genes are indeed transcriptionally regulated by progesterone and/or E2. Probably, the aberrant endometrial receptivity development observed in the COH patients is due, in a large part, to the lack of luteal support.

The fact that so many genes are dys-regulated suggests a shift in time in the differentiation towards a receptive endometrium caused by COH treatment, rather than the direct dys-regulation of a limited number of genes by the hormones used. Indeed, evidence can be found in the literature that, on the day of oocyte retrieval (36 h after hCG administration) the endometrium appears morphologically advanced (Seif et al., 1992; Psychoyos, 1994; Kolb and Paulson, 1997; Kolibianakis et al., 2003), whereas delayed, advanced and in phase endometrium is described during the WOI following COH. Our study shows that, for many of the genes that are regulated during the formation of the WOI, the expression levels in hCG+7 samples are more comparable with those of LH+2 than with LH+7 patterns (see Figure 2). This observation suggests a delay in the regulation of gene expression necessary for the formation of a receptive endometrium due to COH treatment. The altered gene expression profiles, strongly suggests that a COH endometrium is not optimally prepared for implantation. This could have negative effects on the implantation process and therefore could be one of the main causes of low success rates in COH.

Some of the dys-regulated genes are known to be implicated in endometrial receptivity such as PP-14 (Glycodelin) (Julkunen et al., 1986) or LIF (Stewart et al., 1992) but others have more general functions. From the 151 genes that are dys-regulated more than 3-fold in the COH endometrium we have selected seven of them to analyse their possible implication in endometrial receptivity. Figure 2A shows the fold change expression of these genes in the LH+7 natural cycle endometrium versus hCG+7 endometrium.

Glycodelin appears to be up-regulated in three out of four studies focused on genome-wide analysis of endometrial receptivity (Kao et al., 2002; Borthwick et al., 2003; Riesewijk et al., 2003). First described in 1986 (Julkunen et al., 1986), it belongs to a family of lipocalins that participate in the regulation of the immune response (Akerstrom et al., 2000). The lipocalins typically bind small hydrophobic molecules, like retinol and retinoic acid, although this is not so for glycodelin (Seppala et al., 2001). It appears as different glycoforms that exhibit quantitative physicochemical and functional differences in different sources and individuals (Koistinen et al., 2003). Recently it has been demonstrated that glycodelin gene expression is dys-regulated in patients with endometriosis (Kao et al., 2003) although its specific role in implantation is still uncertain.

Glutathione peroxidase 3 (GPx3) was first described in 1991 (Esworthy et al., 1991). It is a selenoprotein enzyme that protects cells from oxidative damage by catalysing the reduction of hydrogen peroxidase, lipid peroxides and organic hydroxyperoxide by glutathione. In reproductive tissues of female mice, it is regulated by 17β-E2 (Waters et al., 2001) and selenium. Its expression has been demonstrated to increase in ovarian (Hough et al., 2001), uterine and breast cancers (Gorodzanskaya et al., 2001). Several publications have previously reported that its expression increases markedly during the WOI and that it could be implicated in endometrial receptivity (Borthwick et al., 2003; Riesewijk et al., 2003).

Dipeptidyl peptidase-IV (DPPIV) is a serine proteinase that is widely distributed in mammalian tissues, including lymphocytes, where it is identical to the T-cell activation antigen, cluster differentiation antigen-26 (Liu and Hansen, 1995). It has been reported that DPPIV is a membrane-bound peptidase and that it is expressed on human placental cytotrophoblasts. It is considered to be a differentiation marker for glandular cells and surface epithelium (Sato et al., 2002). It also has been demonstrated to be important for the non-invasive phenotype of the extravillous trophoblast and the down-regulation of this enzyme is strongly associated with migration of invasive extravillous trophoblast phenotype (Imai et al., 1992).

Transcobalamin I (TCI) is a vitamin B12-binding protein that transports cobalamin (vitamin B12) into cells. Its expression is significantly increased during the formation of a receptive endometrium (+27.3-fold) but decreased by COH treatment (−7.7-fold). Vitamin B12 deficiency has been associated with infertility and recurrent fetal loss and is associated with folate metabolism (Bennet, 2001). The TCI–vitamin B12 complex can bind to the Megalin receptor, which is involved in the cellular uptake of vitamin B12. Megalin is expressed in the kidney, one of the major organs regulating vitamin B12 levels, and also in the epithelia of other tissues, including the placenta where it plays a role in fetal vitamin B12 supply (Moestrup et al., 1996). Lack of TCI could result in a diminished supply of vitamin B12, which would have negative effects on embryonic implantation and development.

As we have mentioned, LIF is a pleiotropic cytokine of the interleukin-6 family. This means that it has effects on many different cell types and that its activities are not restricted to one lineage. It was first identified by Metcalf and colleagues (Gearing et al., 1987). Other groups have demonstrated that LIF levels are relatively low in the proliferative phase, rise after ovulation and remain high until the end of the menstrual cycle before dropping to baseline levels (Chen et al., 1995; Vogiagis et al., 1996). LIF mRNA is only detected during the mid and late secretory phases of the cycle after day 20 and is maximally present in the human endometrium around the time of implantation suggesting a paracrine and/or autocrine role in endometrial function (Lass et al., 2001). However, until now, there was no evidence of this regulation in microarrays studies. This work incorporates LIF, one of the classic implantation molecules, to the long list of WOI genes described until the moment by means of this technique.

There is a surprisingly high number of genes involved in endometrial receptivity, the WOI genes that are aberrantly expressed in COH endometrium (342 genes), showing expression levels more similar to those in a non-receptive endometrium. This suggests that endometrial development is hampered and delayed under these conditions.

Together, these studies highlight the necessity for continued research in this field and for modifying COH treatments in order to achieve an endometrium that resembles, both morphologically and functionally, the natural cycle endometrium, which will subsequently lead to improved success rates in IVF.

Figure 1.

PCA analysis of the 24 endometrial samples using 500 genes randomly selected by K-means clustering. Percentage of variation for the PCA1 and PCA2 axis are 36 and 18%, respectively.

Figure 2.

Confirmation of the microarray data by Q-PCR. (A) Microarray gene expression values for each of the seven selected genes and the fold changes between the LH+2/LH+7 and LH+7/hCG+7 samples. (B) Normalized RNA values for the seven selected genes. Patient material was pooled per group. Capping protein was used for normalization purposes.

Table I.

List of oligonucleotides used for Q-PCR and the size of the amplified product

Gene nameSequence 5′–3′Amplicon (bp)
Glycodelin AFGGAGAGAAGACTGAGAATCCAAAGA100
RAGAGAAACAGGAAATTGTCGTAGTCA
Capping proteinFGGTCATTCTTCAGAGCTTCTTGTTT104
RGCTGAACGAGATCTACTTTGGAAAA
Glutathione peroxidase 3FCAGGAACCAGGAGAGAACTCAGA63
RCCTCCACCTGGTCGGACATA
Transcobalamin IFGGGCTCTTACTGTTTTCTTTTATTC80
RTTTAGGCGGATGTAGTTTTCTTCAC
Squalene epoxidaseFGGGTGGTTATCATGTTCTCAAAGA68
RCAACCTGGGCATCAAGACCTT
Secretoglobin 1D member 2FGCTGGCCCTCTGCTGCTA54
RGAAACAAGAGCTGGGCAGAACT
CXCL13FCCCGTGGGAATGGTTGTC73
RGGGTCCACACACACAATTGACT
dpp4FTGGTCATATGGAGGGTACGTAACC81
RAGGCGCCACGGCTATTC
Gene nameSequence 5′–3′Amplicon (bp)
Glycodelin AFGGAGAGAAGACTGAGAATCCAAAGA100
RAGAGAAACAGGAAATTGTCGTAGTCA
Capping proteinFGGTCATTCTTCAGAGCTTCTTGTTT104
RGCTGAACGAGATCTACTTTGGAAAA
Glutathione peroxidase 3FCAGGAACCAGGAGAGAACTCAGA63
RCCTCCACCTGGTCGGACATA
Transcobalamin IFGGGCTCTTACTGTTTTCTTTTATTC80
RTTTAGGCGGATGTAGTTTTCTTCAC
Squalene epoxidaseFGGGTGGTTATCATGTTCTCAAAGA68
RCAACCTGGGCATCAAGACCTT
Secretoglobin 1D member 2FGCTGGCCCTCTGCTGCTA54
RGAAACAAGAGCTGGGCAGAACT
CXCL13FCCCGTGGGAATGGTTGTC73
RGGGTCCACACACACAATTGACT
dpp4FTGGTCATATGGAGGGTACGTAACC81
RAGGCGCCACGGCTATTC
Table I.

List of oligonucleotides used for Q-PCR and the size of the amplified product

Gene nameSequence 5′–3′Amplicon (bp)
Glycodelin AFGGAGAGAAGACTGAGAATCCAAAGA100
RAGAGAAACAGGAAATTGTCGTAGTCA
Capping proteinFGGTCATTCTTCAGAGCTTCTTGTTT104
RGCTGAACGAGATCTACTTTGGAAAA
Glutathione peroxidase 3FCAGGAACCAGGAGAGAACTCAGA63
RCCTCCACCTGGTCGGACATA
Transcobalamin IFGGGCTCTTACTGTTTTCTTTTATTC80
RTTTAGGCGGATGTAGTTTTCTTCAC
Squalene epoxidaseFGGGTGGTTATCATGTTCTCAAAGA68
RCAACCTGGGCATCAAGACCTT
Secretoglobin 1D member 2FGCTGGCCCTCTGCTGCTA54
RGAAACAAGAGCTGGGCAGAACT
CXCL13FCCCGTGGGAATGGTTGTC73
RGGGTCCACACACACAATTGACT
dpp4FTGGTCATATGGAGGGTACGTAACC81
RAGGCGCCACGGCTATTC
Gene nameSequence 5′–3′Amplicon (bp)
Glycodelin AFGGAGAGAAGACTGAGAATCCAAAGA100
RAGAGAAACAGGAAATTGTCGTAGTCA
Capping proteinFGGTCATTCTTCAGAGCTTCTTGTTT104
RGCTGAACGAGATCTACTTTGGAAAA
Glutathione peroxidase 3FCAGGAACCAGGAGAGAACTCAGA63
RCCTCCACCTGGTCGGACATA
Transcobalamin IFGGGCTCTTACTGTTTTCTTTTATTC80
RTTTAGGCGGATGTAGTTTTCTTCAC
Squalene epoxidaseFGGGTGGTTATCATGTTCTCAAAGA68
RCAACCTGGGCATCAAGACCTT
Secretoglobin 1D member 2FGCTGGCCCTCTGCTGCTA54
RGAAACAAGAGCTGGGCAGAACT
CXCL13FCCCGTGGGAATGGTTGTC73
RGGGTCCACACACACAATTGACT
dpp4FTGGTCATATGGAGGGTACGTAACC81
RAGGCGCCACGGCTATTC
Table II.

Up-regulated genes in hCG+7

Sequence codeNameFold changeFuntional category
218865_atHypothetical protein FLJ2239038.87Unknown
209904_atTroponin C, show30.89Structural protein
220541_atMatrix metalloproteinase 2616.96Enzyme
201562_s_atSorbitol dehydrogenase15.79Enzyme
202965_s_atCalpain 613.56Glycoprotein
205671_s_atMajor histocompatibility complex, class II, DO beta12.23Immune response
212768_s_atDifferentially expressed in hematopoietic lineages11.89Inhibitor
209443_atSerine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 511.88Inhibitor
214240_atGalanin11.79Neuropeptide
210653_s_atBranched chain keto acid dehydrogenase E1, beta polypeptide (maple syrup urine disease)10.32Enzyme
221102_s_atTransient receptor potential cation channel, subfamily M, member 610.04Receptor
206424_atCytochrome P450, family 26, subfamily A, polypeptide 19.69Energy transduction
204560_atFK506 binding protein 59.57Unknown
204437_s_atFolate receptor 1 (adult)9.30Receptor
215800_atDual oxidase 18.91Enzyme
205698_s_atMitogen-activated protein kinase kinase 68.65Cell cycle
205073_atCytochrome P450, family 2, subfamily J, polypeptide 27.89Energy transduction
204288_s_atArg/Abl-interacting protein ArgBP27.77Signal transduction
219597_s_atDual oxidase 17.40Enzyme
201563_atSorbitol dehydrogenase7.32Enzyme
205373_atCatenin (cadherin-associated protein), alpha 27.32Cell adhesion
205316_atSolute carrier family 15 (H+/peptide transporter), member 27.05Transporter
202966_atCalpain 67.04Protease
214324_atGlycoprotein 2 (zymogen granule membrana)6.93Glycoprotein
213050_atKIAA0633 protein6.47Unknown
205960_atPyruvate dehydrogenase kinase, isoenzyme 46.44Enzyme
205779_atReceptor (calcitonin) activity modifying protein 26.43Receptor
220724_atHypothetical protein FLJ215116.16Unknown
209278_s_atTissue factor pathway inhibitor 26.13Inhibitor
214279_s_atNDRG family member 26.11Development
213562_s_atSqualene epoxidase6.06Enzyme
209723_atSerine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 96.05Inhibitor
220994_s_atSyntaxin binding protein 6 (amisyn)5.98Unknown
206453_s_atNDRG family member 25.70Development
205379_atCarbonyl reductase 35.64Enzyme
205413_atChromosome 11 open reading frame 85.53Unknown
204394_atProstate cancer overexpressed gene 15.45Unknown
214209_s_atATP-binding cassette, sub-family B (MDR/TAP), member 95.34Transporter
206799_atSecretoglobin, family 1D, member 25.27Secretory protein
205833_s_atProstate androgen-regulated transcript 15.09Enzyme
205593_s_atPhosphodiesterase 9A5.04Enzyme
209825_s_atUridine monophosphate kinase4.96Enzyme
216248_s_atNuclear receptor subfamily 4, group A, member 24.95Receptor
218839_atHairy/enhancer-of-split related with YRPW motif 14.91Unknown
220677_s_atA disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 84.88Unknown
204941_s_atAldehyde dehydrogenase 3 family, member B24.86Enzyme
209277_atTissue factor pathway inhibitor 24.72Inhibitor
221094_s_atLikely ortholog of mouse elongation protein 3 homolog (S. cerevisiae)4.72Unknown
214040_s_atGelsolin (amyloidosis, Finnish type)4.68Calcium-related
205317_s_atSolute carrier family 15 (H+/peptide transporter), member 24.65Transporter
213033_s_atHomo sapiens mRNA; cDNA DKFZp564H1916 (from clone DKFZp564H1916)4.52Unknown
47553_atDKFZP434N014 protein4.45Unknown
207910_atSecretoglobin, family 1D, member 14.41Signal transduction
204794_atDual specificity phosphatase 24.31Enzyme
218816_atLAP (leucine-rich repeats and PDZ) and no PDZ protein4.28Unknown
203779_s_atEpithelial V-like antigen 14.27Enzyme
214307_atHomogentisate 1,2-dioxygenase (homogentisate oxidase)4.23Enzyme
218692_atHypothetical protein FLJ203664.21Unknown
204130_atHydroxysteroid (11-beta) dehydrogenase 24.18Enzyme
206723_s_atEndothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 43.91Receptor
204622_x_atNuclear receptor subfamily 4, group A, member 23.85Nuclear receptor
208004_atProline rich 13.81Secretory protein
209781_s_atKH domain containing, RNA binding, signal transduction associated 33.80Unknown
210538_s_atBaculoviral IAP repeat-containing 33.80Unknown
213587_s_atChromosome 7 open reading frame 323.80Unknown
205081_atCysteine-rich protein 1 (intestinal)3.74Unknown
212686_atKIAA1157 protein3.73Unknown
218292_s_atKIAA1157 protein3.73Unknown
205221_atHomogentisate 1,2-dioxygenase (homogentisate oxidase)3.71Enzyme
203932_atMajor histocompatibility complex, class II, DM beta3.70Immune response
213032_atHomo sapiens mRNA; cDNA DKFZp564H1916 (from clone DKFZp564H1916)3.70Unknown
204942_s_atAldehyde dehydrogenase 3 family, member B23.69Enzyme
219667_s_atHypothetical protein FLJ207063.69Unknown
219786_atMetallothionein-like 5, testis-specific (tesmin)3.66Enzyme
220723_s_atHypothetical protein FLJ215113.65Unknown
212110_atKIAA0062 protein3.63Unknown
211470_s_atSulfotransferase family, cytosolic, 1C, member 13.56Enzyme
221887_s_atSulfotransferase family, cytosolic, 1C, member 13.54Enzyme
205864_atSolute carrier family 7 (cationic amino acid transporter, y+ system), member 43.50Transporter
206385_s_atAnkyrin 3, node of Ranvier (ankyrin G)3.50Membrane protein
217284_x_atKraken-like3.50Enzyme
209442_x_atAnkyrin 3, node of Ranvier (ankyrin G)3.49Membrane protein
217973_atDicarbonyl/l-xylulose reductase3.49Enzyme
213498_atOld astrocyte specifically induced substance3.40Transcription factor
44783_s_atHairy/enhancer-of-split related with YRPW motif 13.38Unknown
207030_s_atCysteine and glycine-rich protein 23.35Development
211126_s_atCysteine and glycine-rich protein 23.35Development
217080_s_atHomer homolog 2 (Drosophila)3.35Unknown
210657_s_atPeanut-like 2 (Drosophila)3.33Unknown
202150_s_atEnhancer of filamentation 13.31Unknown
218963_s_atKeratin 23 (histone deacetylase inducible)3.30Structural protein
207367_atATPase, H+/K+ transporting, nongastric, alpha polypeptide3.29Transporter
210372_s_atTumour protein D52-like 13.29Oncogene
214308_s_atHomogentisate 1,2-dioxygenase (homogentisate oxidase)3.28Enzyme
205348_s_atDynein, cytoplasmic, intermediate polypeptide 13.24Cytoskeletal protein
219735_s_atLBP protein; likely ortholog of mouse CRTR-13.23Unknown
211676_s_atInterferon gamma receptor 13.22Immune response
205345_atBRCA1 associated RING domain 13.20Apoptosis
219968_atKRAB-zinc finger protein SZF1-13.19Unknown
210145_atPhospholipase A2, group IVA (cytosolic, calcium-dependent)3.18Enzyme
206299_atTED protein3.17Unknown
209218_atSqualene epoxidase3.16Enzyme
207950_s_atAnkyrin 3, node of Ranvier (ankyrin G)3.14Membrane protein
217276_x_atKraken-like3.13Enzyme
201467_s_atNAD(P)H dehydrogenase, quinone 13.12Enzyme
208286_x_atPOU domain, class 5, transcription factor 13.12Transcription factor
211113_s_atATP-binding cassette, sub-family G (WHITE), member 13.12Transporter
204187_atGuanosine monophosphate reductase3.11Enzyme
215783_s_atAlkaline phosphatase, liver/bone/kidney3.11Enzyme
221648_s_atAlkaline phosphatase, liver/bone/kidney3.07Enzyme
203892_atCGI-146 protein3.05Unknown
204698_atWAP four-disulfide core domain 23.05Unknown
202149_atInterferon stimulated gene 20kDa3.04Immune response
210062_s_atEnhancer of filamentation 13.04Transcription factor
213029_atKRAB-zinc finger protein SZF1-13.04Unknown
Sequence codeNameFold changeFuntional category
218865_atHypothetical protein FLJ2239038.87Unknown
209904_atTroponin C, show30.89Structural protein
220541_atMatrix metalloproteinase 2616.96Enzyme
201562_s_atSorbitol dehydrogenase15.79Enzyme
202965_s_atCalpain 613.56Glycoprotein
205671_s_atMajor histocompatibility complex, class II, DO beta12.23Immune response
212768_s_atDifferentially expressed in hematopoietic lineages11.89Inhibitor
209443_atSerine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 511.88Inhibitor
214240_atGalanin11.79Neuropeptide
210653_s_atBranched chain keto acid dehydrogenase E1, beta polypeptide (maple syrup urine disease)10.32Enzyme
221102_s_atTransient receptor potential cation channel, subfamily M, member 610.04Receptor
206424_atCytochrome P450, family 26, subfamily A, polypeptide 19.69Energy transduction
204560_atFK506 binding protein 59.57Unknown
204437_s_atFolate receptor 1 (adult)9.30Receptor
215800_atDual oxidase 18.91Enzyme
205698_s_atMitogen-activated protein kinase kinase 68.65Cell cycle
205073_atCytochrome P450, family 2, subfamily J, polypeptide 27.89Energy transduction
204288_s_atArg/Abl-interacting protein ArgBP27.77Signal transduction
219597_s_atDual oxidase 17.40Enzyme
201563_atSorbitol dehydrogenase7.32Enzyme
205373_atCatenin (cadherin-associated protein), alpha 27.32Cell adhesion
205316_atSolute carrier family 15 (H+/peptide transporter), member 27.05Transporter
202966_atCalpain 67.04Protease
214324_atGlycoprotein 2 (zymogen granule membrana)6.93Glycoprotein
213050_atKIAA0633 protein6.47Unknown
205960_atPyruvate dehydrogenase kinase, isoenzyme 46.44Enzyme
205779_atReceptor (calcitonin) activity modifying protein 26.43Receptor
220724_atHypothetical protein FLJ215116.16Unknown
209278_s_atTissue factor pathway inhibitor 26.13Inhibitor
214279_s_atNDRG family member 26.11Development
213562_s_atSqualene epoxidase6.06Enzyme
209723_atSerine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 96.05Inhibitor
220994_s_atSyntaxin binding protein 6 (amisyn)5.98Unknown
206453_s_atNDRG family member 25.70Development
205379_atCarbonyl reductase 35.64Enzyme
205413_atChromosome 11 open reading frame 85.53Unknown
204394_atProstate cancer overexpressed gene 15.45Unknown
214209_s_atATP-binding cassette, sub-family B (MDR/TAP), member 95.34Transporter
206799_atSecretoglobin, family 1D, member 25.27Secretory protein
205833_s_atProstate androgen-regulated transcript 15.09Enzyme
205593_s_atPhosphodiesterase 9A5.04Enzyme
209825_s_atUridine monophosphate kinase4.96Enzyme
216248_s_atNuclear receptor subfamily 4, group A, member 24.95Receptor
218839_atHairy/enhancer-of-split related with YRPW motif 14.91Unknown
220677_s_atA disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 84.88Unknown
204941_s_atAldehyde dehydrogenase 3 family, member B24.86Enzyme
209277_atTissue factor pathway inhibitor 24.72Inhibitor
221094_s_atLikely ortholog of mouse elongation protein 3 homolog (S. cerevisiae)4.72Unknown
214040_s_atGelsolin (amyloidosis, Finnish type)4.68Calcium-related
205317_s_atSolute carrier family 15 (H+/peptide transporter), member 24.65Transporter
213033_s_atHomo sapiens mRNA; cDNA DKFZp564H1916 (from clone DKFZp564H1916)4.52Unknown
47553_atDKFZP434N014 protein4.45Unknown
207910_atSecretoglobin, family 1D, member 14.41Signal transduction
204794_atDual specificity phosphatase 24.31Enzyme
218816_atLAP (leucine-rich repeats and PDZ) and no PDZ protein4.28Unknown
203779_s_atEpithelial V-like antigen 14.27Enzyme
214307_atHomogentisate 1,2-dioxygenase (homogentisate oxidase)4.23Enzyme
218692_atHypothetical protein FLJ203664.21Unknown
204130_atHydroxysteroid (11-beta) dehydrogenase 24.18Enzyme
206723_s_atEndothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 43.91Receptor
204622_x_atNuclear receptor subfamily 4, group A, member 23.85Nuclear receptor
208004_atProline rich 13.81Secretory protein
209781_s_atKH domain containing, RNA binding, signal transduction associated 33.80Unknown
210538_s_atBaculoviral IAP repeat-containing 33.80Unknown
213587_s_atChromosome 7 open reading frame 323.80Unknown
205081_atCysteine-rich protein 1 (intestinal)3.74Unknown
212686_atKIAA1157 protein3.73Unknown
218292_s_atKIAA1157 protein3.73Unknown
205221_atHomogentisate 1,2-dioxygenase (homogentisate oxidase)3.71Enzyme
203932_atMajor histocompatibility complex, class II, DM beta3.70Immune response
213032_atHomo sapiens mRNA; cDNA DKFZp564H1916 (from clone DKFZp564H1916)3.70Unknown
204942_s_atAldehyde dehydrogenase 3 family, member B23.69Enzyme
219667_s_atHypothetical protein FLJ207063.69Unknown
219786_atMetallothionein-like 5, testis-specific (tesmin)3.66Enzyme
220723_s_atHypothetical protein FLJ215113.65Unknown
212110_atKIAA0062 protein3.63Unknown
211470_s_atSulfotransferase family, cytosolic, 1C, member 13.56Enzyme
221887_s_atSulfotransferase family, cytosolic, 1C, member 13.54Enzyme
205864_atSolute carrier family 7 (cationic amino acid transporter, y+ system), member 43.50Transporter
206385_s_atAnkyrin 3, node of Ranvier (ankyrin G)3.50Membrane protein
217284_x_atKraken-like3.50Enzyme
209442_x_atAnkyrin 3, node of Ranvier (ankyrin G)3.49Membrane protein
217973_atDicarbonyl/l-xylulose reductase3.49Enzyme
213498_atOld astrocyte specifically induced substance3.40Transcription factor
44783_s_atHairy/enhancer-of-split related with YRPW motif 13.38Unknown
207030_s_atCysteine and glycine-rich protein 23.35Development
211126_s_atCysteine and glycine-rich protein 23.35Development
217080_s_atHomer homolog 2 (Drosophila)3.35Unknown
210657_s_atPeanut-like 2 (Drosophila)3.33Unknown
202150_s_atEnhancer of filamentation 13.31Unknown
218963_s_atKeratin 23 (histone deacetylase inducible)3.30Structural protein
207367_atATPase, H+/K+ transporting, nongastric, alpha polypeptide3.29Transporter
210372_s_atTumour protein D52-like 13.29Oncogene
214308_s_atHomogentisate 1,2-dioxygenase (homogentisate oxidase)3.28Enzyme
205348_s_atDynein, cytoplasmic, intermediate polypeptide 13.24Cytoskeletal protein
219735_s_atLBP protein; likely ortholog of mouse CRTR-13.23Unknown
211676_s_atInterferon gamma receptor 13.22Immune response
205345_atBRCA1 associated RING domain 13.20Apoptosis
219968_atKRAB-zinc finger protein SZF1-13.19Unknown
210145_atPhospholipase A2, group IVA (cytosolic, calcium-dependent)3.18Enzyme
206299_atTED protein3.17Unknown
209218_atSqualene epoxidase3.16Enzyme
207950_s_atAnkyrin 3, node of Ranvier (ankyrin G)3.14Membrane protein
217276_x_atKraken-like3.13Enzyme
201467_s_atNAD(P)H dehydrogenase, quinone 13.12Enzyme
208286_x_atPOU domain, class 5, transcription factor 13.12Transcription factor
211113_s_atATP-binding cassette, sub-family G (WHITE), member 13.12Transporter
204187_atGuanosine monophosphate reductase3.11Enzyme
215783_s_atAlkaline phosphatase, liver/bone/kidney3.11Enzyme
221648_s_atAlkaline phosphatase, liver/bone/kidney3.07Enzyme
203892_atCGI-146 protein3.05Unknown
204698_atWAP four-disulfide core domain 23.05Unknown
202149_atInterferon stimulated gene 20kDa3.04Immune response
210062_s_atEnhancer of filamentation 13.04Transcription factor
213029_atKRAB-zinc finger protein SZF1-13.04Unknown
Table II.

Up-regulated genes in hCG+7

Sequence codeNameFold changeFuntional category
218865_atHypothetical protein FLJ2239038.87Unknown
209904_atTroponin C, show30.89Structural protein
220541_atMatrix metalloproteinase 2616.96Enzyme
201562_s_atSorbitol dehydrogenase15.79Enzyme
202965_s_atCalpain 613.56Glycoprotein
205671_s_atMajor histocompatibility complex, class II, DO beta12.23Immune response
212768_s_atDifferentially expressed in hematopoietic lineages11.89Inhibitor
209443_atSerine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 511.88Inhibitor
214240_atGalanin11.79Neuropeptide
210653_s_atBranched chain keto acid dehydrogenase E1, beta polypeptide (maple syrup urine disease)10.32Enzyme
221102_s_atTransient receptor potential cation channel, subfamily M, member 610.04Receptor
206424_atCytochrome P450, family 26, subfamily A, polypeptide 19.69Energy transduction
204560_atFK506 binding protein 59.57Unknown
204437_s_atFolate receptor 1 (adult)9.30Receptor
215800_atDual oxidase 18.91Enzyme
205698_s_atMitogen-activated protein kinase kinase 68.65Cell cycle
205073_atCytochrome P450, family 2, subfamily J, polypeptide 27.89Energy transduction
204288_s_atArg/Abl-interacting protein ArgBP27.77Signal transduction
219597_s_atDual oxidase 17.40Enzyme
201563_atSorbitol dehydrogenase7.32Enzyme
205373_atCatenin (cadherin-associated protein), alpha 27.32Cell adhesion
205316_atSolute carrier family 15 (H+/peptide transporter), member 27.05Transporter
202966_atCalpain 67.04Protease
214324_atGlycoprotein 2 (zymogen granule membrana)6.93Glycoprotein
213050_atKIAA0633 protein6.47Unknown
205960_atPyruvate dehydrogenase kinase, isoenzyme 46.44Enzyme
205779_atReceptor (calcitonin) activity modifying protein 26.43Receptor
220724_atHypothetical protein FLJ215116.16Unknown
209278_s_atTissue factor pathway inhibitor 26.13Inhibitor
214279_s_atNDRG family member 26.11Development
213562_s_atSqualene epoxidase6.06Enzyme
209723_atSerine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 96.05Inhibitor
220994_s_atSyntaxin binding protein 6 (amisyn)5.98Unknown
206453_s_atNDRG family member 25.70Development
205379_atCarbonyl reductase 35.64Enzyme
205413_atChromosome 11 open reading frame 85.53Unknown
204394_atProstate cancer overexpressed gene 15.45Unknown
214209_s_atATP-binding cassette, sub-family B (MDR/TAP), member 95.34Transporter
206799_atSecretoglobin, family 1D, member 25.27Secretory protein
205833_s_atProstate androgen-regulated transcript 15.09Enzyme
205593_s_atPhosphodiesterase 9A5.04Enzyme
209825_s_atUridine monophosphate kinase4.96Enzyme
216248_s_atNuclear receptor subfamily 4, group A, member 24.95Receptor
218839_atHairy/enhancer-of-split related with YRPW motif 14.91Unknown
220677_s_atA disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 84.88Unknown
204941_s_atAldehyde dehydrogenase 3 family, member B24.86Enzyme
209277_atTissue factor pathway inhibitor 24.72Inhibitor
221094_s_atLikely ortholog of mouse elongation protein 3 homolog (S. cerevisiae)4.72Unknown
214040_s_atGelsolin (amyloidosis, Finnish type)4.68Calcium-related
205317_s_atSolute carrier family 15 (H+/peptide transporter), member 24.65Transporter
213033_s_atHomo sapiens mRNA; cDNA DKFZp564H1916 (from clone DKFZp564H1916)4.52Unknown
47553_atDKFZP434N014 protein4.45Unknown
207910_atSecretoglobin, family 1D, member 14.41Signal transduction
204794_atDual specificity phosphatase 24.31Enzyme
218816_atLAP (leucine-rich repeats and PDZ) and no PDZ protein4.28Unknown
203779_s_atEpithelial V-like antigen 14.27Enzyme
214307_atHomogentisate 1,2-dioxygenase (homogentisate oxidase)4.23Enzyme
218692_atHypothetical protein FLJ203664.21Unknown
204130_atHydroxysteroid (11-beta) dehydrogenase 24.18Enzyme
206723_s_atEndothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 43.91Receptor
204622_x_atNuclear receptor subfamily 4, group A, member 23.85Nuclear receptor
208004_atProline rich 13.81Secretory protein
209781_s_atKH domain containing, RNA binding, signal transduction associated 33.80Unknown
210538_s_atBaculoviral IAP repeat-containing 33.80Unknown
213587_s_atChromosome 7 open reading frame 323.80Unknown
205081_atCysteine-rich protein 1 (intestinal)3.74Unknown
212686_atKIAA1157 protein3.73Unknown
218292_s_atKIAA1157 protein3.73Unknown
205221_atHomogentisate 1,2-dioxygenase (homogentisate oxidase)3.71Enzyme
203932_atMajor histocompatibility complex, class II, DM beta3.70Immune response
213032_atHomo sapiens mRNA; cDNA DKFZp564H1916 (from clone DKFZp564H1916)3.70Unknown
204942_s_atAldehyde dehydrogenase 3 family, member B23.69Enzyme
219667_s_atHypothetical protein FLJ207063.69Unknown
219786_atMetallothionein-like 5, testis-specific (tesmin)3.66Enzyme
220723_s_atHypothetical protein FLJ215113.65Unknown
212110_atKIAA0062 protein3.63Unknown
211470_s_atSulfotransferase family, cytosolic, 1C, member 13.56Enzyme
221887_s_atSulfotransferase family, cytosolic, 1C, member 13.54Enzyme
205864_atSolute carrier family 7 (cationic amino acid transporter, y+ system), member 43.50Transporter
206385_s_atAnkyrin 3, node of Ranvier (ankyrin G)3.50Membrane protein
217284_x_atKraken-like3.50Enzyme
209442_x_atAnkyrin 3, node of Ranvier (ankyrin G)3.49Membrane protein
217973_atDicarbonyl/l-xylulose reductase3.49Enzyme
213498_atOld astrocyte specifically induced substance3.40Transcription factor
44783_s_atHairy/enhancer-of-split related with YRPW motif 13.38Unknown
207030_s_atCysteine and glycine-rich protein 23.35Development
211126_s_atCysteine and glycine-rich protein 23.35Development
217080_s_atHomer homolog 2 (Drosophila)3.35Unknown
210657_s_atPeanut-like 2 (Drosophila)3.33Unknown
202150_s_atEnhancer of filamentation 13.31Unknown
218963_s_atKeratin 23 (histone deacetylase inducible)3.30Structural protein
207367_atATPase, H+/K+ transporting, nongastric, alpha polypeptide3.29Transporter
210372_s_atTumour protein D52-like 13.29Oncogene
214308_s_atHomogentisate 1,2-dioxygenase (homogentisate oxidase)3.28Enzyme
205348_s_atDynein, cytoplasmic, intermediate polypeptide 13.24Cytoskeletal protein
219735_s_atLBP protein; likely ortholog of mouse CRTR-13.23Unknown
211676_s_atInterferon gamma receptor 13.22Immune response
205345_atBRCA1 associated RING domain 13.20Apoptosis
219968_atKRAB-zinc finger protein SZF1-13.19Unknown
210145_atPhospholipase A2, group IVA (cytosolic, calcium-dependent)3.18Enzyme
206299_atTED protein3.17Unknown
209218_atSqualene epoxidase3.16Enzyme
207950_s_atAnkyrin 3, node of Ranvier (ankyrin G)3.14Membrane protein
217276_x_atKraken-like3.13Enzyme
201467_s_atNAD(P)H dehydrogenase, quinone 13.12Enzyme
208286_x_atPOU domain, class 5, transcription factor 13.12Transcription factor
211113_s_atATP-binding cassette, sub-family G (WHITE), member 13.12Transporter
204187_atGuanosine monophosphate reductase3.11Enzyme
215783_s_atAlkaline phosphatase, liver/bone/kidney3.11Enzyme
221648_s_atAlkaline phosphatase, liver/bone/kidney3.07Enzyme
203892_atCGI-146 protein3.05Unknown
204698_atWAP four-disulfide core domain 23.05Unknown
202149_atInterferon stimulated gene 20kDa3.04Immune response
210062_s_atEnhancer of filamentation 13.04Transcription factor
213029_atKRAB-zinc finger protein SZF1-13.04Unknown
Sequence codeNameFold changeFuntional category
218865_atHypothetical protein FLJ2239038.87Unknown
209904_atTroponin C, show30.89Structural protein
220541_atMatrix metalloproteinase 2616.96Enzyme
201562_s_atSorbitol dehydrogenase15.79Enzyme
202965_s_atCalpain 613.56Glycoprotein
205671_s_atMajor histocompatibility complex, class II, DO beta12.23Immune response
212768_s_atDifferentially expressed in hematopoietic lineages11.89Inhibitor
209443_atSerine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 511.88Inhibitor
214240_atGalanin11.79Neuropeptide
210653_s_atBranched chain keto acid dehydrogenase E1, beta polypeptide (maple syrup urine disease)10.32Enzyme
221102_s_atTransient receptor potential cation channel, subfamily M, member 610.04Receptor
206424_atCytochrome P450, family 26, subfamily A, polypeptide 19.69Energy transduction
204560_atFK506 binding protein 59.57Unknown
204437_s_atFolate receptor 1 (adult)9.30Receptor
215800_atDual oxidase 18.91Enzyme
205698_s_atMitogen-activated protein kinase kinase 68.65Cell cycle
205073_atCytochrome P450, family 2, subfamily J, polypeptide 27.89Energy transduction
204288_s_atArg/Abl-interacting protein ArgBP27.77Signal transduction
219597_s_atDual oxidase 17.40Enzyme
201563_atSorbitol dehydrogenase7.32Enzyme
205373_atCatenin (cadherin-associated protein), alpha 27.32Cell adhesion
205316_atSolute carrier family 15 (H+/peptide transporter), member 27.05Transporter
202966_atCalpain 67.04Protease
214324_atGlycoprotein 2 (zymogen granule membrana)6.93Glycoprotein
213050_atKIAA0633 protein6.47Unknown
205960_atPyruvate dehydrogenase kinase, isoenzyme 46.44Enzyme
205779_atReceptor (calcitonin) activity modifying protein 26.43Receptor
220724_atHypothetical protein FLJ215116.16Unknown
209278_s_atTissue factor pathway inhibitor 26.13Inhibitor
214279_s_atNDRG family member 26.11Development
213562_s_atSqualene epoxidase6.06Enzyme
209723_atSerine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 96.05Inhibitor
220994_s_atSyntaxin binding protein 6 (amisyn)5.98Unknown
206453_s_atNDRG family member 25.70Development
205379_atCarbonyl reductase 35.64Enzyme
205413_atChromosome 11 open reading frame 85.53Unknown
204394_atProstate cancer overexpressed gene 15.45Unknown
214209_s_atATP-binding cassette, sub-family B (MDR/TAP), member 95.34Transporter
206799_atSecretoglobin, family 1D, member 25.27Secretory protein
205833_s_atProstate androgen-regulated transcript 15.09Enzyme
205593_s_atPhosphodiesterase 9A5.04Enzyme
209825_s_atUridine monophosphate kinase4.96Enzyme
216248_s_atNuclear receptor subfamily 4, group A, member 24.95Receptor
218839_atHairy/enhancer-of-split related with YRPW motif 14.91Unknown
220677_s_atA disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 84.88Unknown
204941_s_atAldehyde dehydrogenase 3 family, member B24.86Enzyme
209277_atTissue factor pathway inhibitor 24.72Inhibitor
221094_s_atLikely ortholog of mouse elongation protein 3 homolog (S. cerevisiae)4.72Unknown
214040_s_atGelsolin (amyloidosis, Finnish type)4.68Calcium-related
205317_s_atSolute carrier family 15 (H+/peptide transporter), member 24.65Transporter
213033_s_atHomo sapiens mRNA; cDNA DKFZp564H1916 (from clone DKFZp564H1916)4.52Unknown
47553_atDKFZP434N014 protein4.45Unknown
207910_atSecretoglobin, family 1D, member 14.41Signal transduction
204794_atDual specificity phosphatase 24.31Enzyme
218816_atLAP (leucine-rich repeats and PDZ) and no PDZ protein4.28Unknown
203779_s_atEpithelial V-like antigen 14.27Enzyme
214307_atHomogentisate 1,2-dioxygenase (homogentisate oxidase)4.23Enzyme
218692_atHypothetical protein FLJ203664.21Unknown
204130_atHydroxysteroid (11-beta) dehydrogenase 24.18Enzyme
206723_s_atEndothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 43.91Receptor
204622_x_atNuclear receptor subfamily 4, group A, member 23.85Nuclear receptor
208004_atProline rich 13.81Secretory protein
209781_s_atKH domain containing, RNA binding, signal transduction associated 33.80Unknown
210538_s_atBaculoviral IAP repeat-containing 33.80Unknown
213587_s_atChromosome 7 open reading frame 323.80Unknown
205081_atCysteine-rich protein 1 (intestinal)3.74Unknown
212686_atKIAA1157 protein3.73Unknown
218292_s_atKIAA1157 protein3.73Unknown
205221_atHomogentisate 1,2-dioxygenase (homogentisate oxidase)3.71Enzyme
203932_atMajor histocompatibility complex, class II, DM beta3.70Immune response
213032_atHomo sapiens mRNA; cDNA DKFZp564H1916 (from clone DKFZp564H1916)3.70Unknown
204942_s_atAldehyde dehydrogenase 3 family, member B23.69Enzyme
219667_s_atHypothetical protein FLJ207063.69Unknown
219786_atMetallothionein-like 5, testis-specific (tesmin)3.66Enzyme
220723_s_atHypothetical protein FLJ215113.65Unknown
212110_atKIAA0062 protein3.63Unknown
211470_s_atSulfotransferase family, cytosolic, 1C, member 13.56Enzyme
221887_s_atSulfotransferase family, cytosolic, 1C, member 13.54Enzyme
205864_atSolute carrier family 7 (cationic amino acid transporter, y+ system), member 43.50Transporter
206385_s_atAnkyrin 3, node of Ranvier (ankyrin G)3.50Membrane protein
217284_x_atKraken-like3.50Enzyme
209442_x_atAnkyrin 3, node of Ranvier (ankyrin G)3.49Membrane protein
217973_atDicarbonyl/l-xylulose reductase3.49Enzyme
213498_atOld astrocyte specifically induced substance3.40Transcription factor
44783_s_atHairy/enhancer-of-split related with YRPW motif 13.38Unknown
207030_s_atCysteine and glycine-rich protein 23.35Development
211126_s_atCysteine and glycine-rich protein 23.35Development
217080_s_atHomer homolog 2 (Drosophila)3.35Unknown
210657_s_atPeanut-like 2 (Drosophila)3.33Unknown
202150_s_atEnhancer of filamentation 13.31Unknown
218963_s_atKeratin 23 (histone deacetylase inducible)3.30Structural protein
207367_atATPase, H+/K+ transporting, nongastric, alpha polypeptide3.29Transporter
210372_s_atTumour protein D52-like 13.29Oncogene
214308_s_atHomogentisate 1,2-dioxygenase (homogentisate oxidase)3.28Enzyme
205348_s_atDynein, cytoplasmic, intermediate polypeptide 13.24Cytoskeletal protein
219735_s_atLBP protein; likely ortholog of mouse CRTR-13.23Unknown
211676_s_atInterferon gamma receptor 13.22Immune response
205345_atBRCA1 associated RING domain 13.20Apoptosis
219968_atKRAB-zinc finger protein SZF1-13.19Unknown
210145_atPhospholipase A2, group IVA (cytosolic, calcium-dependent)3.18Enzyme
206299_atTED protein3.17Unknown
209218_atSqualene epoxidase3.16Enzyme
207950_s_atAnkyrin 3, node of Ranvier (ankyrin G)3.14Membrane protein
217276_x_atKraken-like3.13Enzyme
201467_s_atNAD(P)H dehydrogenase, quinone 13.12Enzyme
208286_x_atPOU domain, class 5, transcription factor 13.12Transcription factor
211113_s_atATP-binding cassette, sub-family G (WHITE), member 13.12Transporter
204187_atGuanosine monophosphate reductase3.11Enzyme
215783_s_atAlkaline phosphatase, liver/bone/kidney3.11Enzyme
221648_s_atAlkaline phosphatase, liver/bone/kidney3.07Enzyme
203892_atCGI-146 protein3.05Unknown
204698_atWAP four-disulfide core domain 23.05Unknown
202149_atInterferon stimulated gene 20kDa3.04Immune response
210062_s_atEnhancer of filamentation 13.04Transcription factor
213029_atKRAB-zinc finger protein SZF1-13.04Unknown
Table III.

Down-regulated genes in hCG+7

Sequence codeNameFold changeFuncional category
205713_s_atCartilage oligomeric matrix protein (pseudoachondroplasia, epiphyseal dysplasia 1, multiple)58.55Structural protein
203716_s_atDipeptidylpeptidase 4 (CD26, adenosine deaminase complexing protein 2)54.37Immune response
211478_s_atDipeptidylpeptidase 4 (CD26, adenosine deaminase complexing protein 2)43.48Immune response
203888_atThrombomodulin24.38Coagulation factor
205266_atLeukaemia inhibitory factor (cholinergic differentiation factor)23.02Cytokine
220196_atMucin 1613.61Membrane protein
203717_atDipeptidylpeptidase 4 (CD26, adenosine deaminase complexing protein 2)13.58Immune response
205765_atCytochrome P450, family 3, subfamily A, polypeptide 512.96Energy transduction
201348_atGlutathione peroxidase 3 (plasma)12.51Enzyme
205302_atInsulin-like growth factor binding protein 111.99Regulatory protein
209641_s_atATP-binding cassette, sub-family C (CFTR/MRP), member 311.12Transporter
214091_s_atGlutathione peroxidase 3 (plasma)11.12Enzyme
207254_atSolute carrier family 15 (oligopeptide transporter), member 110.62Transporter
208791_atClusterin (complement lysis inhibitor, SP-40,40, sulfated glycoprotein 2, testosterone-repressed prostate message 2, apolipoprotein J)10.04Apoptosis
206859_s_atProgestagen-associated endometrial protein (placental protein 14, pregnancy-associated endometrial alpha-2-globulin, alpha uterine protein)9.83Secreted protein
214234_s_atCytochrome P450, family 3, subfamily A, polypeptide 59.32Energy transduction
203951_atCalponin 1, basic, smooth muscle9.26Muscle protein
208335_s_atDuffy blood group9.24Receptor
218002_s_atChemokine (C-X-C motif) ligand 148.95Chemokine
206396_atSolute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 18.18Transporter
208161_s_atATP-binding cassette, sub-family C (CFTR/MRP), member 38.04Transporter
205513_atTranscobalamin I (vitamin B12 binding protein, R binder family)7.77Transporter
207961_x_atMyosin, heavy polypeptide 11, smooth muscle7.71Muscle protein
204863_s_atInterleukin 6 signal transducer (gp130, oncostatin M receptor)7.42Immune response
212531_atLipocalin 2 (oncogene 24p3)7.35Protection factor
209260_atStratifin7.04Epithelial marker
209201_x_atChemokine (C-X-C motif) receptor 46.83Chemokine
209173_atAnterior gradient 2 homolog (Xenopus laevis)6.73Unknown
206010_atHyaluronan binding protein 26.41Enzyme
205083_atAldehyde oxidase 16.24Enzyme
203559_s_atAmiloride binding protein 1 [amine oxidase (copper-containing)]6.01Enzyme
219369_s_atChromosome 14 open reading frame 1375.92Unknown
203126_atInositol(myo)-1(or 4)-monophosphatase 25.88Enzyme
214235_atCytochrome P450, family 3, subfamily A, polypeptide 55.86Energy transduction
203824_atTransmembrane 4 superfamily member 35.84Transmembrane protein
202481_atShort-chain dehydrogenase/reductase 15.80Enzyme
209270_atlaminin, beta 35.68Cell adhesion
208893_s_atDual specificity phosphatase 65.66Signal transduction
220293_atHypothetical protein FLJ142985.62Unknown
206392_s_atRetinoic acid receptor responder (tazarotene induced) 15.39Receptor
205082_s_atAldehyde oxidase 15.27Enzyme
210652_s_atChromosome 1 open reading frame 345.26Unknown
204304_s_atProminin 15.03Membrana protein
206043_s_atKIAA0703 gene product5.02Unknown
213524_s_atPutative lymphocyte G0/G1 switch gene4.95Regulatory protein
206391_atRetinoic acid receptor responder (tazarotene induced) 14.79Receptor
203887_s_atThrombomodulin4.75Coagulation factor
209114_atTetraspan 14.75Cell adhesion
205844_atVanin 14.74Membrana protein
217521_atHistidine ammonia-lyase4.74Enzyme
213664_atSolute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 14.73Transporter
212143_s_atInsulin-like growth factor binding protein 3 (3′ region) (human, tuberous sclerosis cells, mRNA Partial, 704 nt)4.67Regulatory protein
204720_s_atDnaJ (Hsp40) homolog, subfamily C, member 64.66Unknown
220017_x_atCytochrome P450, family 2, subfamily C, polypeptide 94.66Energy transduction
39249_atAquaporin 34.61Channel
205674_x_atFXYD domain containing ion transport regulator 24.60Transmembrane protein
212196_atHomo sapiens mRNA; cDNA DKFZp564F053 (from clone DKFZp564F053)4.55Unknown
201497_x_atMyosin, heavy polypeptide 11, smooth muscle4.47Muscle protein
211919_s_atChemokine (C-X-C motif) receptor 44.47Chemokine
207434_s_atFXYD domain containing ion transport regulator 24.46Transmembrane protein
221872_atRetinoic acid receptor responder (tazarotene induced) 14.46Receptor
205627_atCytidine deaminase4.45Enzyme
209687_atChemokine (C-X-C motif) ligand 12 (stromal cell-derived factor 1)4.40Chemokine
205141_atRibonuclease, RNase A family, 44.36Enzyme
206643_atHistidina ammonia-lyase4.35Enzyme
208792_s_atClusterin (complement lysis inhibitor, SP-40,40, sulfated glycoprotein 2, testosterone-repressed prostate message 2, apolipoprotein J)4.22Apoptosis
204259_atMatrix metalloproteinase 7 (matrilysin, uterine)4.20Enzyme
206303_s_atNudix (nucleoside diphosphate linked moiety X)-type motif 44.20Enzyme
204726_atCadherin 13, H-cadherin (heart)4.09Cell adhesion
203766_s_atLeiomodin 1 (smooth muscle)4.08Cytoskeletal protein
205730_s_atKIAA0843 protein4.06Unknown
203662_s_atTropomodulin 14.05Muscle protein
219195_atPeroxisome proliferative activated receptor, gamma, coactivator 14.05Receptor
205681_atBCL2-related protein A13.97Apoptosis
211000_s_atInterleukin 6 signal transducer (gp130, oncostatin M receptor)3.97Immune response
212942_s_atKIAA1199 protein3.96Unknown
219313_atHypothetical protein DKFZp434C03283.96Unknown
206631_atProstaglandin E receptor 2 (subtype EP2), 53 kDa3.88Receptor
210095_s_atInsulin-like growth factor binding protein 33.85Regulatory protein
205547_s_atTransgelin3.72Muscle protein
202357_s_atB-factor, properdin3.66Immune response
208138_atGastrin3.64Regulatory protein
218404_atSorting nexin 103.64Unknown
202541_atSmall inducible cytokine subfamily E, member 1 (endothelial monocyte-activating)3.61Chemotaxis
208102_s_atPleckstrin and Sec7 domain protein3.58Secretion involved
206488_s_atAquaporin 33.55Channel
39248_atCD36 antigen (collagen type I receptor, thrombospondin receptor)3.55Receptor
204363_atCoagulation factor III (thromboplastin, tissue factor)3.52Coagulation factor
201998_atSialyltransferase 1 (beta-galactoside alpha-2,6-sialyltransferase)3.41Enzyme
209869_atAdrenergic, alpha-2A- receptor3.37Receptor
212326_atKIAA0453 protein3.34Unknown
220112_atHypothetical protein FLJ117953.32Unknown
219630_atEpithelial protein up-regulated in carcinoma, membrane associated protein 173.30Membrane protein
205074_atSolute carrier family 22 (organic cation transporter), member 53.28Transporter
203144_s_atKIAA0040 gene product3.26Unknown
205597_atChromosome 6 open reading frame 293.26Unknown
206528_atTransient receptor potential cation channel, subfamily C, member 63.25Channel
201110_s_atThrombospondin 13.24Cell adhesion
203878_s_atMatrix metalloproteinase 11 (stromelysin 3)3.24Enzyme
201510_atE74-like factor 3 (ets domain transcription factor, epithelial-specific)3.23Unknown
201843_s_atEGF-containing fibulin-like extracellular matrix protein 13.22Extracellular matrix protein
206785_s_atKiller cell lectin-like receptor subfamily C, member 13.22Receptor
204273_atEndothelin receptor type B3.20Receptor
219432_atEllis van Creveld síndrome3.19Unknown
209373_atBENE protein3.13Unknown
209552_atPaired box gene 83.13Regulatory protein
209955_s_atFibroblast activation protein, alpha3.10Receptor
203060_s_at3′-phosphoadenosine 5′-phosphosulfate synthase 23.08Enzyme
212741_atMonoamine oxidase A3.07Enzyme
203725_atGrowth arrest and DNA-damage-inducible, alpha3.03Neuromodulator
205190_atPlastin 1 (I isoform)3.03Signal transduction
219010_atHypothetical protein FLJ109013.03Unknown
203747_atAquaporin 33.02Channel
205654_atComplement component 4 binding protein, alpha3.02Immune response
203083_atThrombospondin 23.01Cell adhesion
205355_atAcyl-Coenzyme A dehydrogenase, short/branched chain3.00Enzyme
Sequence codeNameFold changeFuncional category
205713_s_atCartilage oligomeric matrix protein (pseudoachondroplasia, epiphyseal dysplasia 1, multiple)58.55Structural protein
203716_s_atDipeptidylpeptidase 4 (CD26, adenosine deaminase complexing protein 2)54.37Immune response
211478_s_atDipeptidylpeptidase 4 (CD26, adenosine deaminase complexing protein 2)43.48Immune response
203888_atThrombomodulin24.38Coagulation factor
205266_atLeukaemia inhibitory factor (cholinergic differentiation factor)23.02Cytokine
220196_atMucin 1613.61Membrane protein
203717_atDipeptidylpeptidase 4 (CD26, adenosine deaminase complexing protein 2)13.58Immune response
205765_atCytochrome P450, family 3, subfamily A, polypeptide 512.96Energy transduction
201348_atGlutathione peroxidase 3 (plasma)12.51Enzyme
205302_atInsulin-like growth factor binding protein 111.99Regulatory protein
209641_s_atATP-binding cassette, sub-family C (CFTR/MRP), member 311.12Transporter
214091_s_atGlutathione peroxidase 3 (plasma)11.12Enzyme
207254_atSolute carrier family 15 (oligopeptide transporter), member 110.62Transporter
208791_atClusterin (complement lysis inhibitor, SP-40,40, sulfated glycoprotein 2, testosterone-repressed prostate message 2, apolipoprotein J)10.04Apoptosis
206859_s_atProgestagen-associated endometrial protein (placental protein 14, pregnancy-associated endometrial alpha-2-globulin, alpha uterine protein)9.83Secreted protein
214234_s_atCytochrome P450, family 3, subfamily A, polypeptide 59.32Energy transduction
203951_atCalponin 1, basic, smooth muscle9.26Muscle protein
208335_s_atDuffy blood group9.24Receptor
218002_s_atChemokine (C-X-C motif) ligand 148.95Chemokine
206396_atSolute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 18.18Transporter
208161_s_atATP-binding cassette, sub-family C (CFTR/MRP), member 38.04Transporter
205513_atTranscobalamin I (vitamin B12 binding protein, R binder family)7.77Transporter
207961_x_atMyosin, heavy polypeptide 11, smooth muscle7.71Muscle protein
204863_s_atInterleukin 6 signal transducer (gp130, oncostatin M receptor)7.42Immune response
212531_atLipocalin 2 (oncogene 24p3)7.35Protection factor
209260_atStratifin7.04Epithelial marker
209201_x_atChemokine (C-X-C motif) receptor 46.83Chemokine
209173_atAnterior gradient 2 homolog (Xenopus laevis)6.73Unknown
206010_atHyaluronan binding protein 26.41Enzyme
205083_atAldehyde oxidase 16.24Enzyme
203559_s_atAmiloride binding protein 1 [amine oxidase (copper-containing)]6.01Enzyme
219369_s_atChromosome 14 open reading frame 1375.92Unknown
203126_atInositol(myo)-1(or 4)-monophosphatase 25.88Enzyme
214235_atCytochrome P450, family 3, subfamily A, polypeptide 55.86Energy transduction
203824_atTransmembrane 4 superfamily member 35.84Transmembrane protein
202481_atShort-chain dehydrogenase/reductase 15.80Enzyme
209270_atlaminin, beta 35.68Cell adhesion
208893_s_atDual specificity phosphatase 65.66Signal transduction
220293_atHypothetical protein FLJ142985.62Unknown
206392_s_atRetinoic acid receptor responder (tazarotene induced) 15.39Receptor
205082_s_atAldehyde oxidase 15.27Enzyme
210652_s_atChromosome 1 open reading frame 345.26Unknown
204304_s_atProminin 15.03Membrana protein
206043_s_atKIAA0703 gene product5.02Unknown
213524_s_atPutative lymphocyte G0/G1 switch gene4.95Regulatory protein
206391_atRetinoic acid receptor responder (tazarotene induced) 14.79Receptor
203887_s_atThrombomodulin4.75Coagulation factor
209114_atTetraspan 14.75Cell adhesion
205844_atVanin 14.74Membrana protein
217521_atHistidine ammonia-lyase4.74Enzyme
213664_atSolute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 14.73Transporter
212143_s_atInsulin-like growth factor binding protein 3 (3′ region) (human, tuberous sclerosis cells, mRNA Partial, 704 nt)4.67Regulatory protein
204720_s_atDnaJ (Hsp40) homolog, subfamily C, member 64.66Unknown
220017_x_atCytochrome P450, family 2, subfamily C, polypeptide 94.66Energy transduction
39249_atAquaporin 34.61Channel
205674_x_atFXYD domain containing ion transport regulator 24.60Transmembrane protein
212196_atHomo sapiens mRNA; cDNA DKFZp564F053 (from clone DKFZp564F053)4.55Unknown
201497_x_atMyosin, heavy polypeptide 11, smooth muscle4.47Muscle protein
211919_s_atChemokine (C-X-C motif) receptor 44.47Chemokine
207434_s_atFXYD domain containing ion transport regulator 24.46Transmembrane protein
221872_atRetinoic acid receptor responder (tazarotene induced) 14.46Receptor
205627_atCytidine deaminase4.45Enzyme
209687_atChemokine (C-X-C motif) ligand 12 (stromal cell-derived factor 1)4.40Chemokine
205141_atRibonuclease, RNase A family, 44.36Enzyme
206643_atHistidina ammonia-lyase4.35Enzyme
208792_s_atClusterin (complement lysis inhibitor, SP-40,40, sulfated glycoprotein 2, testosterone-repressed prostate message 2, apolipoprotein J)4.22Apoptosis
204259_atMatrix metalloproteinase 7 (matrilysin, uterine)4.20Enzyme
206303_s_atNudix (nucleoside diphosphate linked moiety X)-type motif 44.20Enzyme
204726_atCadherin 13, H-cadherin (heart)4.09Cell adhesion
203766_s_atLeiomodin 1 (smooth muscle)4.08Cytoskeletal protein
205730_s_atKIAA0843 protein4.06Unknown
203662_s_atTropomodulin 14.05Muscle protein
219195_atPeroxisome proliferative activated receptor, gamma, coactivator 14.05Receptor
205681_atBCL2-related protein A13.97Apoptosis
211000_s_atInterleukin 6 signal transducer (gp130, oncostatin M receptor)3.97Immune response
212942_s_atKIAA1199 protein3.96Unknown
219313_atHypothetical protein DKFZp434C03283.96Unknown
206631_atProstaglandin E receptor 2 (subtype EP2), 53 kDa3.88Receptor
210095_s_atInsulin-like growth factor binding protein 33.85Regulatory protein
205547_s_atTransgelin3.72Muscle protein
202357_s_atB-factor, properdin3.66Immune response
208138_atGastrin3.64Regulatory protein
218404_atSorting nexin 103.64Unknown
202541_atSmall inducible cytokine subfamily E, member 1 (endothelial monocyte-activating)3.61Chemotaxis
208102_s_atPleckstrin and Sec7 domain protein3.58Secretion involved
206488_s_atAquaporin 33.55Channel
39248_atCD36 antigen (collagen type I receptor, thrombospondin receptor)3.55Receptor
204363_atCoagulation factor III (thromboplastin, tissue factor)3.52Coagulation factor
201998_atSialyltransferase 1 (beta-galactoside alpha-2,6-sialyltransferase)3.41Enzyme
209869_atAdrenergic, alpha-2A- receptor3.37Receptor
212326_atKIAA0453 protein3.34Unknown
220112_atHypothetical protein FLJ117953.32Unknown
219630_atEpithelial protein up-regulated in carcinoma, membrane associated protein 173.30Membrane protein
205074_atSolute carrier family 22 (organic cation transporter), member 53.28Transporter
203144_s_atKIAA0040 gene product3.26Unknown
205597_atChromosome 6 open reading frame 293.26Unknown
206528_atTransient receptor potential cation channel, subfamily C, member 63.25Channel
201110_s_atThrombospondin 13.24Cell adhesion
203878_s_atMatrix metalloproteinase 11 (stromelysin 3)3.24Enzyme
201510_atE74-like factor 3 (ets domain transcription factor, epithelial-specific)3.23Unknown
201843_s_atEGF-containing fibulin-like extracellular matrix protein 13.22Extracellular matrix protein
206785_s_atKiller cell lectin-like receptor subfamily C, member 13.22Receptor
204273_atEndothelin receptor type B3.20Receptor
219432_atEllis van Creveld síndrome3.19Unknown
209373_atBENE protein3.13Unknown
209552_atPaired box gene 83.13Regulatory protein
209955_s_atFibroblast activation protein, alpha3.10Receptor
203060_s_at3′-phosphoadenosine 5′-phosphosulfate synthase 23.08Enzyme
212741_atMonoamine oxidase A3.07Enzyme
203725_atGrowth arrest and DNA-damage-inducible, alpha3.03Neuromodulator
205190_atPlastin 1 (I isoform)3.03Signal transduction
219010_atHypothetical protein FLJ109013.03Unknown
203747_atAquaporin 33.02Channel
205654_atComplement component 4 binding protein, alpha3.02Immune response
203083_atThrombospondin 23.01Cell adhesion
205355_atAcyl-Coenzyme A dehydrogenase, short/branched chain3.00Enzyme
Table III.

Down-regulated genes in hCG+7

Sequence codeNameFold changeFuncional category
205713_s_atCartilage oligomeric matrix protein (pseudoachondroplasia, epiphyseal dysplasia 1, multiple)58.55Structural protein
203716_s_atDipeptidylpeptidase 4 (CD26, adenosine deaminase complexing protein 2)54.37Immune response
211478_s_atDipeptidylpeptidase 4 (CD26, adenosine deaminase complexing protein 2)43.48Immune response
203888_atThrombomodulin24.38Coagulation factor
205266_atLeukaemia inhibitory factor (cholinergic differentiation factor)23.02Cytokine
220196_atMucin 1613.61Membrane protein
203717_atDipeptidylpeptidase 4 (CD26, adenosine deaminase complexing protein 2)13.58Immune response
205765_atCytochrome P450, family 3, subfamily A, polypeptide 512.96Energy transduction
201348_atGlutathione peroxidase 3 (plasma)12.51Enzyme
205302_atInsulin-like growth factor binding protein 111.99Regulatory protein
209641_s_atATP-binding cassette, sub-family C (CFTR/MRP), member 311.12Transporter
214091_s_atGlutathione peroxidase 3 (plasma)11.12Enzyme
207254_atSolute carrier family 15 (oligopeptide transporter), member 110.62Transporter
208791_atClusterin (complement lysis inhibitor, SP-40,40, sulfated glycoprotein 2, testosterone-repressed prostate message 2, apolipoprotein J)10.04Apoptosis
206859_s_atProgestagen-associated endometrial protein (placental protein 14, pregnancy-associated endometrial alpha-2-globulin, alpha uterine protein)9.83Secreted protein
214234_s_atCytochrome P450, family 3, subfamily A, polypeptide 59.32Energy transduction
203951_atCalponin 1, basic, smooth muscle9.26Muscle protein
208335_s_atDuffy blood group9.24Receptor
218002_s_atChemokine (C-X-C motif) ligand 148.95Chemokine
206396_atSolute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 18.18Transporter
208161_s_atATP-binding cassette, sub-family C (CFTR/MRP), member 38.04Transporter
205513_atTranscobalamin I (vitamin B12 binding protein, R binder family)7.77Transporter
207961_x_atMyosin, heavy polypeptide 11, smooth muscle7.71Muscle protein
204863_s_atInterleukin 6 signal transducer (gp130, oncostatin M receptor)7.42Immune response
212531_atLipocalin 2 (oncogene 24p3)7.35Protection factor
209260_atStratifin7.04Epithelial marker
209201_x_atChemokine (C-X-C motif) receptor 46.83Chemokine
209173_atAnterior gradient 2 homolog (Xenopus laevis)6.73Unknown
206010_atHyaluronan binding protein 26.41Enzyme
205083_atAldehyde oxidase 16.24Enzyme
203559_s_atAmiloride binding protein 1 [amine oxidase (copper-containing)]6.01Enzyme
219369_s_atChromosome 14 open reading frame 1375.92Unknown
203126_atInositol(myo)-1(or 4)-monophosphatase 25.88Enzyme
214235_atCytochrome P450, family 3, subfamily A, polypeptide 55.86Energy transduction
203824_atTransmembrane 4 superfamily member 35.84Transmembrane protein
202481_atShort-chain dehydrogenase/reductase 15.80Enzyme
209270_atlaminin, beta 35.68Cell adhesion
208893_s_atDual specificity phosphatase 65.66Signal transduction
220293_atHypothetical protein FLJ142985.62Unknown
206392_s_atRetinoic acid receptor responder (tazarotene induced) 15.39Receptor
205082_s_atAldehyde oxidase 15.27Enzyme
210652_s_atChromosome 1 open reading frame 345.26Unknown
204304_s_atProminin 15.03Membrana protein
206043_s_atKIAA0703 gene product5.02Unknown
213524_s_atPutative lymphocyte G0/G1 switch gene4.95Regulatory protein
206391_atRetinoic acid receptor responder (tazarotene induced) 14.79Receptor
203887_s_atThrombomodulin4.75Coagulation factor
209114_atTetraspan 14.75Cell adhesion
205844_atVanin 14.74Membrana protein
217521_atHistidine ammonia-lyase4.74Enzyme
213664_atSolute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 14.73Transporter
212143_s_atInsulin-like growth factor binding protein 3 (3′ region) (human, tuberous sclerosis cells, mRNA Partial, 704 nt)4.67Regulatory protein
204720_s_atDnaJ (Hsp40) homolog, subfamily C, member 64.66Unknown
220017_x_atCytochrome P450, family 2, subfamily C, polypeptide 94.66Energy transduction
39249_atAquaporin 34.61Channel
205674_x_atFXYD domain containing ion transport regulator 24.60Transmembrane protein
212196_atHomo sapiens mRNA; cDNA DKFZp564F053 (from clone DKFZp564F053)4.55Unknown
201497_x_atMyosin, heavy polypeptide 11, smooth muscle4.47Muscle protein
211919_s_atChemokine (C-X-C motif) receptor 44.47Chemokine
207434_s_atFXYD domain containing ion transport regulator 24.46Transmembrane protein
221872_atRetinoic acid receptor responder (tazarotene induced) 14.46Receptor
205627_atCytidine deaminase4.45Enzyme
209687_atChemokine (C-X-C motif) ligand 12 (stromal cell-derived factor 1)4.40Chemokine
205141_atRibonuclease, RNase A family, 44.36Enzyme
206643_atHistidina ammonia-lyase4.35Enzyme
208792_s_atClusterin (complement lysis inhibitor, SP-40,40, sulfated glycoprotein 2, testosterone-repressed prostate message 2, apolipoprotein J)4.22Apoptosis
204259_atMatrix metalloproteinase 7 (matrilysin, uterine)4.20Enzyme
206303_s_atNudix (nucleoside diphosphate linked moiety X)-type motif 44.20Enzyme
204726_atCadherin 13, H-cadherin (heart)4.09Cell adhesion
203766_s_atLeiomodin 1 (smooth muscle)4.08Cytoskeletal protein
205730_s_atKIAA0843 protein4.06Unknown
203662_s_atTropomodulin 14.05Muscle protein
219195_atPeroxisome proliferative activated receptor, gamma, coactivator 14.05Receptor
205681_atBCL2-related protein A13.97Apoptosis
211000_s_atInterleukin 6 signal transducer (gp130, oncostatin M receptor)3.97Immune response
212942_s_atKIAA1199 protein3.96Unknown
219313_atHypothetical protein DKFZp434C03283.96Unknown
206631_atProstaglandin E receptor 2 (subtype EP2), 53 kDa3.88Receptor
210095_s_atInsulin-like growth factor binding protein 33.85Regulatory protein
205547_s_atTransgelin3.72Muscle protein
202357_s_atB-factor, properdin3.66Immune response
208138_atGastrin3.64Regulatory protein
218404_atSorting nexin 103.64Unknown
202541_atSmall inducible cytokine subfamily E, member 1 (endothelial monocyte-activating)3.61Chemotaxis
208102_s_atPleckstrin and Sec7 domain protein3.58Secretion involved
206488_s_atAquaporin 33.55Channel
39248_atCD36 antigen (collagen type I receptor, thrombospondin receptor)3.55Receptor
204363_atCoagulation factor III (thromboplastin, tissue factor)3.52Coagulation factor
201998_atSialyltransferase 1 (beta-galactoside alpha-2,6-sialyltransferase)3.41Enzyme
209869_atAdrenergic, alpha-2A- receptor3.37Receptor
212326_atKIAA0453 protein3.34Unknown
220112_atHypothetical protein FLJ117953.32Unknown
219630_atEpithelial protein up-regulated in carcinoma, membrane associated protein 173.30Membrane protein
205074_atSolute carrier family 22 (organic cation transporter), member 53.28Transporter
203144_s_atKIAA0040 gene product3.26Unknown
205597_atChromosome 6 open reading frame 293.26Unknown
206528_atTransient receptor potential cation channel, subfamily C, member 63.25Channel
201110_s_atThrombospondin 13.24Cell adhesion
203878_s_atMatrix metalloproteinase 11 (stromelysin 3)3.24Enzyme
201510_atE74-like factor 3 (ets domain transcription factor, epithelial-specific)3.23Unknown
201843_s_atEGF-containing fibulin-like extracellular matrix protein 13.22Extracellular matrix protein
206785_s_atKiller cell lectin-like receptor subfamily C, member 13.22Receptor
204273_atEndothelin receptor type B3.20Receptor
219432_atEllis van Creveld síndrome3.19Unknown
209373_atBENE protein3.13Unknown
209552_atPaired box gene 83.13Regulatory protein
209955_s_atFibroblast activation protein, alpha3.10Receptor
203060_s_at3′-phosphoadenosine 5′-phosphosulfate synthase 23.08Enzyme
212741_atMonoamine oxidase A3.07Enzyme
203725_atGrowth arrest and DNA-damage-inducible, alpha3.03Neuromodulator
205190_atPlastin 1 (I isoform)3.03Signal transduction
219010_atHypothetical protein FLJ109013.03Unknown
203747_atAquaporin 33.02Channel
205654_atComplement component 4 binding protein, alpha3.02Immune response
203083_atThrombospondin 23.01Cell adhesion
205355_atAcyl-Coenzyme A dehydrogenase, short/branched chain3.00Enzyme
Sequence codeNameFold changeFuncional category
205713_s_atCartilage oligomeric matrix protein (pseudoachondroplasia, epiphyseal dysplasia 1, multiple)58.55Structural protein
203716_s_atDipeptidylpeptidase 4 (CD26, adenosine deaminase complexing protein 2)54.37Immune response
211478_s_atDipeptidylpeptidase 4 (CD26, adenosine deaminase complexing protein 2)43.48Immune response
203888_atThrombomodulin24.38Coagulation factor
205266_atLeukaemia inhibitory factor (cholinergic differentiation factor)23.02Cytokine
220196_atMucin 1613.61Membrane protein
203717_atDipeptidylpeptidase 4 (CD26, adenosine deaminase complexing protein 2)13.58Immune response
205765_atCytochrome P450, family 3, subfamily A, polypeptide 512.96Energy transduction
201348_atGlutathione peroxidase 3 (plasma)12.51Enzyme
205302_atInsulin-like growth factor binding protein 111.99Regulatory protein
209641_s_atATP-binding cassette, sub-family C (CFTR/MRP), member 311.12Transporter
214091_s_atGlutathione peroxidase 3 (plasma)11.12Enzyme
207254_atSolute carrier family 15 (oligopeptide transporter), member 110.62Transporter
208791_atClusterin (complement lysis inhibitor, SP-40,40, sulfated glycoprotein 2, testosterone-repressed prostate message 2, apolipoprotein J)10.04Apoptosis
206859_s_atProgestagen-associated endometrial protein (placental protein 14, pregnancy-associated endometrial alpha-2-globulin, alpha uterine protein)9.83Secreted protein
214234_s_atCytochrome P450, family 3, subfamily A, polypeptide 59.32Energy transduction
203951_atCalponin 1, basic, smooth muscle9.26Muscle protein
208335_s_atDuffy blood group9.24Receptor
218002_s_atChemokine (C-X-C motif) ligand 148.95Chemokine
206396_atSolute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 18.18Transporter
208161_s_atATP-binding cassette, sub-family C (CFTR/MRP), member 38.04Transporter
205513_atTranscobalamin I (vitamin B12 binding protein, R binder family)7.77Transporter
207961_x_atMyosin, heavy polypeptide 11, smooth muscle7.71Muscle protein
204863_s_atInterleukin 6 signal transducer (gp130, oncostatin M receptor)7.42Immune response
212531_atLipocalin 2 (oncogene 24p3)7.35Protection factor
209260_atStratifin7.04Epithelial marker
209201_x_atChemokine (C-X-C motif) receptor 46.83Chemokine
209173_atAnterior gradient 2 homolog (Xenopus laevis)6.73Unknown
206010_atHyaluronan binding protein 26.41Enzyme
205083_atAldehyde oxidase 16.24Enzyme
203559_s_atAmiloride binding protein 1 [amine oxidase (copper-containing)]6.01Enzyme
219369_s_atChromosome 14 open reading frame 1375.92Unknown
203126_atInositol(myo)-1(or 4)-monophosphatase 25.88Enzyme
214235_atCytochrome P450, family 3, subfamily A, polypeptide 55.86Energy transduction
203824_atTransmembrane 4 superfamily member 35.84Transmembrane protein
202481_atShort-chain dehydrogenase/reductase 15.80Enzyme
209270_atlaminin, beta 35.68Cell adhesion
208893_s_atDual specificity phosphatase 65.66Signal transduction
220293_atHypothetical protein FLJ142985.62Unknown
206392_s_atRetinoic acid receptor responder (tazarotene induced) 15.39Receptor
205082_s_atAldehyde oxidase 15.27Enzyme
210652_s_atChromosome 1 open reading frame 345.26Unknown
204304_s_atProminin 15.03Membrana protein
206043_s_atKIAA0703 gene product5.02Unknown
213524_s_atPutative lymphocyte G0/G1 switch gene4.95Regulatory protein
206391_atRetinoic acid receptor responder (tazarotene induced) 14.79Receptor
203887_s_atThrombomodulin4.75Coagulation factor
209114_atTetraspan 14.75Cell adhesion
205844_atVanin 14.74Membrana protein
217521_atHistidine ammonia-lyase4.74Enzyme
213664_atSolute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 14.73Transporter
212143_s_atInsulin-like growth factor binding protein 3 (3′ region) (human, tuberous sclerosis cells, mRNA Partial, 704 nt)4.67Regulatory protein
204720_s_atDnaJ (Hsp40) homolog, subfamily C, member 64.66Unknown
220017_x_atCytochrome P450, family 2, subfamily C, polypeptide 94.66Energy transduction
39249_atAquaporin 34.61Channel
205674_x_atFXYD domain containing ion transport regulator 24.60Transmembrane protein
212196_atHomo sapiens mRNA; cDNA DKFZp564F053 (from clone DKFZp564F053)4.55Unknown
201497_x_atMyosin, heavy polypeptide 11, smooth muscle4.47Muscle protein
211919_s_atChemokine (C-X-C motif) receptor 44.47Chemokine
207434_s_atFXYD domain containing ion transport regulator 24.46Transmembrane protein
221872_atRetinoic acid receptor responder (tazarotene induced) 14.46Receptor
205627_atCytidine deaminase4.45Enzyme
209687_atChemokine (C-X-C motif) ligand 12 (stromal cell-derived factor 1)4.40Chemokine
205141_atRibonuclease, RNase A family, 44.36Enzyme
206643_atHistidina ammonia-lyase4.35Enzyme
208792_s_atClusterin (complement lysis inhibitor, SP-40,40, sulfated glycoprotein 2, testosterone-repressed prostate message 2, apolipoprotein J)4.22Apoptosis
204259_atMatrix metalloproteinase 7 (matrilysin, uterine)4.20Enzyme
206303_s_atNudix (nucleoside diphosphate linked moiety X)-type motif 44.20Enzyme
204726_atCadherin 13, H-cadherin (heart)4.09Cell adhesion
203766_s_atLeiomodin 1 (smooth muscle)4.08Cytoskeletal protein
205730_s_atKIAA0843 protein4.06Unknown
203662_s_atTropomodulin 14.05Muscle protein
219195_atPeroxisome proliferative activated receptor, gamma, coactivator 14.05Receptor
205681_atBCL2-related protein A13.97Apoptosis
211000_s_atInterleukin 6 signal transducer (gp130, oncostatin M receptor)3.97Immune response
212942_s_atKIAA1199 protein3.96Unknown
219313_atHypothetical protein DKFZp434C03283.96Unknown
206631_atProstaglandin E receptor 2 (subtype EP2), 53 kDa3.88Receptor
210095_s_atInsulin-like growth factor binding protein 33.85Regulatory protein
205547_s_atTransgelin3.72Muscle protein
202357_s_atB-factor, properdin3.66Immune response
208138_atGastrin3.64Regulatory protein
218404_atSorting nexin 103.64Unknown
202541_atSmall inducible cytokine subfamily E, member 1 (endothelial monocyte-activating)3.61Chemotaxis
208102_s_atPleckstrin and Sec7 domain protein3.58Secretion involved
206488_s_atAquaporin 33.55Channel
39248_atCD36 antigen (collagen type I receptor, thrombospondin receptor)3.55Receptor
204363_atCoagulation factor III (thromboplastin, tissue factor)3.52Coagulation factor
201998_atSialyltransferase 1 (beta-galactoside alpha-2,6-sialyltransferase)3.41Enzyme
209869_atAdrenergic, alpha-2A- receptor3.37Receptor
212326_atKIAA0453 protein3.34Unknown
220112_atHypothetical protein FLJ117953.32Unknown
219630_atEpithelial protein up-regulated in carcinoma, membrane associated protein 173.30Membrane protein
205074_atSolute carrier family 22 (organic cation transporter), member 53.28Transporter
203144_s_atKIAA0040 gene product3.26Unknown
205597_atChromosome 6 open reading frame 293.26Unknown
206528_atTransient receptor potential cation channel, subfamily C, member 63.25Channel
201110_s_atThrombospondin 13.24Cell adhesion
203878_s_atMatrix metalloproteinase 11 (stromelysin 3)3.24Enzyme
201510_atE74-like factor 3 (ets domain transcription factor, epithelial-specific)3.23Unknown
201843_s_atEGF-containing fibulin-like extracellular matrix protein 13.22Extracellular matrix protein
206785_s_atKiller cell lectin-like receptor subfamily C, member 13.22Receptor
204273_atEndothelin receptor type B3.20Receptor
219432_atEllis van Creveld síndrome3.19Unknown
209373_atBENE protein3.13Unknown
209552_atPaired box gene 83.13Regulatory protein
209955_s_atFibroblast activation protein, alpha3.10Receptor
203060_s_at3′-phosphoadenosine 5′-phosphosulfate synthase 23.08Enzyme
212741_atMonoamine oxidase A3.07Enzyme
203725_atGrowth arrest and DNA-damage-inducible, alpha3.03Neuromodulator
205190_atPlastin 1 (I isoform)3.03Signal transduction
219010_atHypothetical protein FLJ109013.03Unknown
203747_atAquaporin 33.02Channel
205654_atComplement component 4 binding protein, alpha3.02Immune response
203083_atThrombospondin 23.01Cell adhesion
205355_atAcyl-Coenzyme A dehydrogenase, short/branched chain3.00Enzyme
Table IV.

Number of genes up- and down-regulated in the different comparison performed

ComparisonNumber of regulated genesLH2/LH7 regulated genes FC>2.0
Up 894Down 505Not regulated
hCG+7/LH+7Up 2819115157
hCG+7/LH+7Down 277227050
ComparisonNumber of regulated genesLH2/LH7 regulated genes FC>2.0
Up 894Down 505Not regulated
hCG+7/LH+7Up 2819115157
hCG+7/LH+7Down 277227050
Table IV.

Number of genes up- and down-regulated in the different comparison performed

ComparisonNumber of regulated genesLH2/LH7 regulated genes FC>2.0
Up 894Down 505Not regulated
hCG+7/LH+7Up 2819115157
hCG+7/LH+7Down 277227050
ComparisonNumber of regulated genesLH2/LH7 regulated genes FC>2.0
Up 894Down 505Not regulated
hCG+7/LH+7Up 2819115157
hCG+7/LH+7Down 277227050

The authors would like to thank Andre van Staalduinen for performing the Q-PCR experiments. We also thank IVI Foundation professionals for processing of biopsies.

References

Akerstrom B, Flower DR and Salier JP (

2000
) Lipocalins: unity in diversity.
Biochim Biophys Acta
1482
,
1
–8.

American Society for Reproductive Medicine (

2002
) Assisted reproductive technology in the United States and Canada: 1999 results generated from the American Society for Reproductive Medicine/Assisted Reproductive Technology Registry.
Fertil Steril
78
,
5
.

Bennett M (

2001
) Vitamin B12 deficiency, infertility and recurrent fetal loss.
J Reprod Med
46
,
209
–212.

Borthwick J, Charnock-Jones S, Tom B et al. (

2003
) Determination of the transcript profile of human endometrium.
Mol Hum Reprod
9
,
19
–33.

Carson D, Lagow E, Thathiah A et al. (

2002
) Changes in gene expression during the early to mid-luteal (receptive phase) transition in human endometrium detected by high-density microarray screening.
Mol Hum Reprod
8
,
971
–979.

Chen DB, Hilsenrath R, Yang ZM et al. (

1995
) Leukaemia inhibitory factor in human endometrium during the menstrual cycle: cellular origin and action on production of glandular epithelial cell prostaglandin in vitro.
Hum Reprod
10
,
911
–918.

Develioglu OH, Hsiu JG, Nikas G et al. (

1999
) Endometrial estrogen and progesterone receptor and pinopode expression in stimulated cycles of oocyte donors.
Fertil Steril
71
,
1040
–1047.

Esworthy RS, Chu F-F, Paxton RJ et al. (

1991
) Characterization and partial amino acid sequence of human plasma glutathione peroxidase.
Arch Biochem Biophys
286
,
330
–336.

Fauser BC and Devroey P (

2003
) Reproductive biology and IVF: ovarian stimulation and luteal phase consequences.
Trends Endocrinol Metab
14
,
236
–242.

Gearing DP, Gough NM, King JA et al. (

1987
) Molecular cloning and expression of cDNA encoding a murine myeloid leukaemia inhibitory factor (LIF).
EMBO J
6
,
3995
–4002.

Giudice LC (

2003
) Elucidating endometrial function in the post-genomic era.
Hum Reprod Update
9
,
223
–235.

Gorodzanskaya EG, Larionova VB, Zubrikhina GN et al. (

2001
) Role of glutathione-dependent peroxidase in regulation of lipoperoxide utilization in malignant tumors.
Biochemistry
66
,
221
–224.

Hough CD, Cho KR, Zonderman AB et al. (

2001
) Coordinately up-regulated genes in ovarian cancer.
Biochem Biophys Res Commun
284
,
3869
–3876.

Imai K, Maeda M, Fujiwara H et al. (

1992
) Dipeptidyl peptidase IV as a differentiation marker of the human endometrial glandular cells.
Hum Reprod
7
,
1189
–1194.

Julkunen M, Koistinen R, Sjöberg J et al. (

1986
) Secretory endometrium synthesizes placental protein 14.
Endocrinology
118
,
1782
–1786.

Kao LC, Tulac S, Lobo S et al. (

2002
) Global gene profiling in human endometrium during the window implantation.
Endocrinology
143
,
2119
–2138.

Kao LC, Germeyer A, Tulac S et al. (

2003
) Expression profiling of endometrium from women with endometriosis reveals candidate genes for disease-based implantation failure and infertility.
Endocrinology
144
,
2870
–2881.

Koistinen H, Easton RL, Chiu PC et al. (

2003
) Differences in glycosylation and sperm–egg binding inhibition of pregnancy-related glycodelin.
Biol Reprod
69
,
1545
–5139.

Kolb BA and Paulson RJ (

1997
) The luteal phase of cycles utilizing controlled ovarian hyperstimulation and the possible impact of this hyperstimulation on embryo implantation.
Am J Obstet Gynecol
176
,
1262
–1267.

Kolibianakis EM, Bourgain C, Platteau P et al. (

2003
) Abnormal endometrial development occurs during the luteal phase of nonsupplemented donor cycles treated with recombinant folliclestimulating hormone and gonadotropin-releasing hormone antagonists.
Fertil Steril
80
,
464
–466.

Lass A, Weiser W, Munafo A and Loumaye E (

2001
) Leukemia inhibitory factor in human reproduction.
Fertil Steril
76
,
1091
–1096.

Liu WJ and Hansen PJ (

1995
) Progesterone-induced secretion of dipeptidyl peptidase-IV (cluster differentiation antigen-26) by the uterine endometrium of the ewe and cow that costimulates lymphocyte proliferation.
Endocrinology
136
,
779
–787.

Liu G, Loraine AE, Shigeta R et al. (

2003
) NetAffx: Affymetrix probesets and annotations.
Nucleic Acids Res
31
,
82
–86.

Ma WG, Song H, Das SK et al. (

2003
) Estrogen is a critical determinant that specifies the duration of the window of uterine receptivity for implantation.
Proc Natl Acad Sci USA
100
,
2963
–2968.

Moestrup SK, Birn H, Fischer PB et al. (

1996
) Megalin-mediated endocytosis of transcobalamin-vitamin-B12 complexes suggests a role of the receptor in vitamin-B12 homeostasis.
Proc Natl Acad Sci USA
93
,
8612
–8617.

Nikas G (

2000
) Endometrial receptivity: changes in cell-surface morphology.
Semin Reprod Med
18
,
229
–235.

Nikas G, Develioglu OH, Toner JP et al. (

1999
) Endometrial pinopodes indicate a shift in the window of receptivity in IVF cycles.
Hum Reprod
14
,
787
–792.

Paulson RJ, Sauer MV and Lobo RA (

1990
) Embryo implantation after human in vitro fertilization: importance of endometrial receptivity.
Fertil Steril
53
,
870
–874.

Pellicer A, Valbuena D, Cano F et al. (

1996
) Lower implantation rates in high responders: evidence for an altered endocrine milieu during the preimplantation period.
Fertil Steril
65
,
1190
–1195.

Psychoyos A (

1994
) The implantation window; basic and aspects. In Mori Perspectives on Assisted Reproduction. Ares-Serono Symposium 4, Roma, pp.
57
–63.

Riesewijk A, Martín J, van Os R et al. (

2003
) Gene expression profiling of human endometrial receptivity on days LH+2 versus LH+7 by microarray technology.
Mol Hum Reprod
9
,
253
–264.

Sato Y, Fujiwara H, Higuchi T, Yoshioka S, Tatsumi K, Maeda M and Fujii S (

2002
) Involvement of dipeptidyl peptidase IV in extravillous trophoblast invasion and differentiation.
J Clin Endocrinol Metab
87
,
4287
–4296.

Seif MW, Pearson JM, Ibrahim ZH et al. (

1992
) Endometrium in in-vitro fertilization cycles: morphological and functional differentiation in the implantation phase.
Hum Reprod
7
,
6
–11.

Seppala M, Koistinen H and Koistinen R (

2001
) Glycodelins.
Trends Endocrinol Metab
12
,
111
–117.

Simón C, Cano F, Valbuena D et al. (

1995
) Clinical evidence for a detrimental effect on uterine receptivity of high serum estradiol levels in high and normal responder patients.
Hum Reprod
10
,
2432
–2434.

Simón C, Mercader A, Francés A et al. (

1996
) Hormonal regulation of serum and endometrial IL-1α, IL-1β and IL-1ra: IL-1 endometrial microenvironment of the human embryo at the apposition phase under physiological and supraphysiological steroid level conditions.
J Reprod Immunol
31
,
165
–184.

Simón C, García-Velasco J, Valbuena D et al. (

1998
) Increasing uterine receptivity by decreasing estradiol levels during the preimplantation period in high responders with the use of a follicle-stimulating hormone step-down regimen.
Fertil Steril
70
,
234
–239.

Simón C, Domínguez F, Valbuena D et al. (

2003
) The role of estrogen in uterine receptivity and blastocyst implantation.
Trends Endocrinol Metab
14
,
197
–199.

Stewart CL, Kaspar P, Brunet LJ et al. (

1992
) Blastocyst implantation depends on maternal expression of leukaemia inhibitory factor.
Nature
359
,
76
–79.

Vogiagis D, Marsh MM, Fry RC et al. (

1996
) Leukaemia inhibitory factor in human endometrium throughout the menstrual cycle.
J Endocrinol
148
,
95
–102.

Waters KM, Safe S and Gaido KW (

2001
) Differential gene expression in response to methoxychlor and estradiol through ERalpha, ERbeta, and AR in reproductive tissues of female mice.
Toxicol Sci
63
,
47
–56.

Author notes

1Instituto Valenciano de Infertilidad Foundation (FIVI)-Valencia University, Spain, 2NV Organon, Department of Pharmacology, Oss, The Netherlands