Current Biology
Research PaperCre-loxP-mediated gene replacement: a mouse strain producing humanized antibodies
Section snippets
Background:
The ability of the bacteriophage P1 Cre–loxP site-specific recombination system to work in mammalian cells [1], [2] has opened new possibilities for manipulating the mammalian —in particular, mouse —germ line. The strategy of Cre–loxP-mediated gene replacement in mouse embryonic stem (ES) cells [3] is shown in Figure 1. In the first step, conventional gene targeting [4], [5] is used to replace the endogenous gene with a construct that carries the new (mutant) gene segment, selectable marker
Gene targeting
The targeting vector was constructed as follows. A 0.9 kb DNA fragment that is homologous to the 5′ end of the BamHI site of the border of the first exon of the mouse Cγ1 gene was isolated from the plasmid PG1A by PCR [18]. The fragment was cloned into the pGH-1 vector [3], which contains the neor–tk cassette with a loxP site at its 5′ end. The primers used for amplification were TTATCGATACAGAGGCTCAACCTACAAA at the 5′ end, and CCAAGATTCGCTACTTTTGCACCCTT at the 3′ end. A HindIII-PvuII fragment
Acknowledgements
We are grateful to Ralf Kühn and Jürgen Roes for discussion. This work was supported by the Fazit Foundation, the Land Nordrhein-Westfalen and the Deutsche Forschungs-gemeinschaft through SFB 243.
Yong-Rui Zou, Werner Müller, Hua Gu and Klaus Rajewsky (corresponding author), Institute of Genetics, University of Cologne, Cologne D-50931, Germany.
Present address for Yong-Rui Zou: NIAID, LCMI, Building 4, Room 111 NIH, 9000 Rockville Pike, Behesda, Maryland 20892, USA.
Present address for Hua Gu: NIAID, Twinbrook II Facility, 12441 Parklawn Drive, Bethesda, Maryland 20892, USA.
References (25)
- et al.
Bacteriophage P1 site-specific recombination. I. Recombination between loxP sites
J Mol Biol
(1981) - et al.
Independent control of immunoglobulin switch recombination at individual switch regions evidenced through Cre-loxP-mediated gene targeting
Cell
(1993) - et al.
Site-directed mutagenesis by gene targeting in mouse embryo-derived stem cells
Cell
(1987) - et al.
Cell selection by antigen in the immune response
Adv Immunol
(1969) - et al.
Maturation of the immune response in germinal centers
Cell
(1991) - et al.
Cloning and complete nucleotide sequence of mouse immunoglobulin γ1 chain gene
Cell
(1979) - et al.
Trans-acting nuclear protein responsible for induction of rearranged human immunoglobulin heavy chain gene
Cell
(1986) - et al.
Site-specific DNA recombination in mammalian cells by the Cre recombinase of bacteriophage P1
Proc Natl Acad Sci USA
(1988) - et al.
Generation of a mouse strain that produces immunoglobulin kappa chains with human constant regions
Science
(1993) - et al.
The length of homology required for gene targeting in embryonic stem cells
Mol Cell Biol
(1991)
Regulatory elements in the introns of the human HPRT gene are necessary for its expression in embryonic stem cells
Proc Natl Acad Sci USA
Use of double-replacement gene targeting to replace the murine alpha-lactalbumin gene with its human counterpart in embryonic stem cells and mice
Mol Cell Biol
Cited by (0)
Yong-Rui Zou, Werner Müller, Hua Gu and Klaus Rajewsky (corresponding author), Institute of Genetics, University of Cologne, Cologne D-50931, Germany.
Present address for Yong-Rui Zou: NIAID, LCMI, Building 4, Room 111 NIH, 9000 Rockville Pike, Behesda, Maryland 20892, USA.
Present address for Hua Gu: NIAID, Twinbrook II Facility, 12441 Parklawn Drive, Bethesda, Maryland 20892, USA.