Alternative splicing of a Drosophila GABA receptor subunit gene identifies determinants of agonist potency

doi:10.1016/S0306-4522(00)00483-8

Neuroscience

Volume 102, Issue 3, 5 February 2001, Pages 709-714

https://doi.org/10.1016/S0306-4522(00)00483-8 Get rights and content

Abstract

Alternative splicing of the Drosophila melanogaster Rdl gene yields four ionotropic GABA receptor subunits. The two Rdl splice variants cloned to date, RDL_ac and RDL_bd (DRC17-1-2), differ in their apparent agonist affinity. Here, we report the cloning of a third splice variant of Rdl, RDL_ad. Two-electrode voltage clamp electrophysiology was used to investigate agonist pharmacology of this expressed subunit following cRNA injection into Xenopus laevis oocytes. The EC_so values for GABA and its analogues isoguvacine, muscimol, isonipecotic acid and 3-amino sulphonic acid on the RDL_ad homomeric receptor differed from those previously described for RDL_ac and DRC17-1-2 receptors. In addition to providing a possible physiological role for the alternative splicing of Rdl, these data delineate a hitherto functionally unassigned region of the N-terminal domain of GABA receptor subunits, which affects agonist potency and aligns closely with known determinants of potency in nicotinic acetylcholine receptors.

Thus, using expression in Xenopus oocytes, we have demonstrated differences in agonist potency for the neurotransmitter GABA (and four analogues) between splice variant products of the Drosophila melanogaster Rdl gene encoding homomer-forming GABA receptor subunits.

Section snippets

Cloning of a Drosophila GABA receptor subunit complementary DNA

A Drosophila embryonic (12–24 h) cDNA library in pNB40⁶ was divided into aliquots of clones which were screened for Rdl-encoded cDNAs using the polymerase chain reaction (PCR). Thirty-five cycles of PCR (1 min at 94°C, 1 min at 60°C, 2 min at 72°C) were performed with 50 pmol of each oligonucleotide primer (forward: ATGAGTGATTCAAAAATGGACAAGC; reverse: TCGTGGACCTTGAATCTCACCT) and with Taq DNA polymerase (Promega). The chosen primers would not distinguish between cDNAs encoding the splice variants of

An Rdl splice variant product (RDL_ad) with altered affinity for GABA

A clone of plasmid pDRA was isolated from an embryonic cDNA library⁶ and included a 1818 nucleotide open reading frame. This open reading frame was 97.3% identical with cDNA encoding the Drosophila GABA receptor subunit RDL_ac¹⁵ and contained three putative start codons within the first 35 bases. A 222-bp region containing multiple stop codons in all three reading frames was located 5′ to the 1818 bp open reading frame.

The nucleotide sequence of the cDNA in pDRA differed from that of RDL_ac only

Discussion

There is mounting evidence that subunits encoded by insect Rdl genes underly the characteristic pharmacology of the bicuculline-insensitive GABA receptors that predominate in insect nervous systems.²⁴ cRNAs exhibiting a high identity (>80%) with those encoding Drosophila RDL subunits, have been cloned from a variety of insect species belonging to three orders26., 34., 45., 46. and are widely distributed in insect CNS. Although the intron-exon structures of Rdl genes from insect species other

Conclusion

The present study demonstrates that a naturally occurring substitution of residues in the extracellular region of Drosophila GABA receptors underlies moderate changes in the potency of the natural agonist, GABA, and may therefore serve a physiological role. The region containing these changes aligns with determinants of agonist potency on nAChRs. It is therefore possible that this region may also affect either the agonist responses of vertebrate GABA receptors, or the kinetics of channel

Acknowledgements

The authors are grateful to Drs H. A. Baylis and M. L. Hutton for advice on cDNA cloning. Support for AMH included a Medical Research Council Research Studentship, a grant from Dupont Agricultural Products and a short-term award from The Babraham Institute. SDB acknowledges the support of The Babraham Institute. The Support of the Medical Research Council and the Biotechnology and Biological Research Council of the UK is gratefully acknowledged by DBS.

References (50)

S.D. Buckingham et al.
Actions of agonists and convulsant site antagonists on a Drosophila melanogaster GABA receptor (Rd1) homo-oligomer expressed in Xenopus oocytes
Neurosci. Lett.
(1994)
J.D. Clements
Transmitter timecourse in the synaptic cleft: its central synaptic function
Trends Neurosci.
(1996)
C. Czajkowski et al.
Agonist binding site of Torpedo electric tissue nicotinic acetylcholine receptor: a negatively charged region of the δ subunit within 0.9 nm of the α subunit binding site disulphide
J. biol. Chem.
(1995)
A.P. Feinberg et al.
A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity
Analyt. Biochem.
(1983)
J.L. Galzi et al.
Neuronal nicotinic receptors: molecular organization and regulations
Neuropharmacology
(1995)
A.M. Hosie et al.
Molecular biology of insect neuronal GABA receptors
Trends Neurosci.
(1997)
G.A.R Johnston
Cis- and trans-4-aminocrotonic acid as GABA analogues of restricted conformation
Trends pharmac. Sci.
(1996)
K. Kaku et al.
Identification of the site of mutation within the M2 region of the GABA receptor of the cyclodiene-resistant German cockroach
Comp. Biochem. Physiol. Pharmacol. Toxicol. Endocrinol.
(1994)
A. Karlin et al.
Towards a structural basis of the function of nicotinic acetylcholine receptors and their cousins
Neuron
(1995)
H.J. Lee et al.
Expression of a Drosophila GABA receptor in a Baculovirus-insect cell system—functional expression of insecticide susceptible and resitant GABA receptors from the cyclodiene resistant gene Rd1
Fedn Eur. biochem. Socs Lett.
(1993)

C. Lena et al.

Allosteric nicotinic receptors, human pathologies

J. Physiol., Paris

(1998)

M. Miyazaki et al.

DNA sequence and site of mutation of the GABA receptor of cyclodiene-resistant red flour beetle, Tribolium castaneum

Comp. Biochem. Physiol. Biochem. Molec. Biol.

(1995)

I. Mody et al.

Bridging the cleft at GABA synapses in the brain

Trends Neurosci.

(1994)

D.B. Sattelle

GABA receptors of insects

Adv. Insect Physiol.

(1990)

G.B. Smith et al.

Functional domains of GABA_A receptors

Trends Neurosci.

(1995)

M. Thompson et al.

Cloning & sequencing of the cyclodiene insecticide resistance gene from the yellow fever mosquito Aedes aegypti

Fedn Eur. biochem. Socs Lett.

(1993)

J. Amin et al.

GABA_A receptors need two homologous domains of the β subunit for activation by GABA but not pentobarbital

Nature

(1993)

J. Amin et al.

Homomeric p1 GABR channels: activation properties and domains

Receptors and Channels

(1994)

T.P. Angelotti et al.

Assembly of GABA_A receptor subunits: a1β, and a1β1γ2s subunits produce unique ion channels with dissimilar single channel properties

J. Neurosci.

(1993)

K. Aronstein et al.

Immunocytochemistry of a novel GABA receptor subunit Rdl in Drosophila melanogaster

Invert. Neurosci.

(1995)

D. Belelli et al.

Interaction of positive allosteric modulators with human and Drosophila recombinant GABA receptors expressed in Xenopus laevis oocytes

Br. J. Pharmac.

(1996)

N.H. Brown et al.

Functional cDNA libraries from Drosophila embryos

J. Molec. Biol.

(1988)

A.B. Brussard et al.

Plasticity in fast synaptic inhibition of adult oxytocin neurons caused by a switch in GABA (A) receptor subunit expression

Neuron

(1997)

R. Chen et al.

Cloning and functional expression of a Drosophila γ-aminobutyric acid receptor

Proc. natn. Acad. Sci. USA

(1994)

C. Czajkowski et al.

Negatively charged amino acid residues in the nicotinic receptor δ subunit that contribute to the binding of acetylcholine

Proc. natn. Acad. Sci. USA

(1993)

Cited by (46)

Molecular Targets of Neurotoxic Insecticides in Apis mellifera
2022, European Journal of Organic Chemistry
The intensive use of insecticides, combined with other factors such as habitat loss, might explain worldwide decrease of insect populations documented in the past twenty years. However, due to the involvement of pest species in crop destruction and in vector‐borne diseases, insecticides will probably continue to be required still for decades. The most commercially successful insecticides are neurotoxicants acting on ion channels of the central nervous system affecting thereby cellular excitability and synaptic transmission and causing insect paralysis and fatality. In this article, we provide an overview of the insecticides acting on voltage‐gated sodium channels, GABA‐gated chloride channels and nicotinic acetylcholine receptors. We summarize the current knowledge on those ion channels from the honeybee Apis mellifera and discuss the possible mode of action of neurotoxic insecticides.
The novel isoxazoline ectoparasiticide fluralaner: Selective inhibition of arthropod γ-aminobutyric acid- and l-glutamate-gated chloride channels and insecticidal/acaricidal activity
2014, Insect Biochemistry and Molecular Biology
Citation Excerpt :
To investigate effects of the dieldrin resistance mutation A285 ➔ S285, the CfRDL-A285-encoding version of cfrdl was generated, which proved to be functional in Xenopus oocytes (Fig. 5B). Since the vast majority of historic RDL studies in insects have been performed with the D. melanogaster channel (Buckingham et al., 2005), the genes encoding the best-studied ac-splice variant (ffrench-Constant et al., 1991; Hosie et al., 2001) in its dieldrin-sensitive and -resistant dmrdl forms (A302, S302) were included in this study and functionally characterized, to allow better comparisons and connections to results published earlier by others. In a second step of our study, transgenic stable and clonal cell lines were generated for the three parasite RDL gene forms rmrdl, cfrdl-A285 and cfrdl-S285, for the two D. melanogaster gene versions dmrdl-A302 and dmrdl-S302, as well as the tick rmglucl.
Isoxazolines are a novel class of parasiticides that are potent inhibitors of γ-aminobutyric acid (GABA)-gated chloride channels (GABACls) and l-glutamate-gated chloride channels (GluCls). In this study, the effects of the isoxazoline drug fluralaner on insect and acarid GABACl (RDL) and GluCl and its parasiticidal potency were investigated. We report the identification and cDNA cloning of Rhipicephalus (R.) microplus RDL and GluCl genes, and their functional expression in Xenopus laevis oocytes. The generation of six clonal HEK293 cell lines expressing Rhipicephalus microplus RDL and GluCl, Ctenocephalides felis RDL-A₂₈₅ and RDL-S₂₈₅, as well as Drosophila melanogaster RDLCl-A₃₀₂ and RDL-S₃₀₂, combined with the development of a membrane potential fluorescence dye assay allowed the comparison of ion channel inhibition by fluralaner with that of established insecticides addressing RDL and GluCl as targets. In these assays fluralaner was several orders of magnitude more potent than picrotoxinin and dieldrin, and performed 5-236 fold better than fipronil on the arthropod RDLs, while a rat GABACl remained unaffected. Comparative studies showed that R. microplus RDL is 52-fold more sensitive than R. microplus GluCl to fluralaner inhibition, confirming that the GABA-gated chloride channel is the primary target of this new parasiticide. In agreement with the superior RDL on-target activity, fluralaner outperformed dieldrin and fipronil in insecticidal screens on cat fleas (Ctenocephalides felis), yellow fever mosquito larvae (Aedes aegypti) and sheep blowfly larvae (Lucilia cuprina), as well as in acaricidal screens on cattle tick (R. microplus) adult females, brown dog tick (Rhipicephalus sanguineus) adult females and Ornithodoros moubata nymphs. These findings highlight the potential of fluralaner as a novel ectoparasiticide.
Expression pattern and function of alternative splice variants of glutamate-gated chloride channel in the housefly Musca domestica
2014, Insect Biochemistry and Molecular Biology
Citation Excerpt :
The Drosophila GABACl subunit gene Rdl also undergoes pre-mRNA splicing and editing. The changes by these processes cause differences in the sensitivity of the receptor to GABA and GABACl blockers (Buckingham et al., 2005; Es-Salah et al., 2008; ffrench-Constant and Rocheleau, 1993; Hosie et al., 2001; Jones et al., 2009). The macrocyclic lactone ivermectin B1a is a positive allosteric modulator of GluCls (Ozoe, 2013).
Glutamate-gated chloride channels (GluCls) mediate fast inhibitory neurotransmission in invertebrate nervous systems. cDNAs encoding two alternative splice variants (MdGluClB and C) of the GluCl subunit were cloned from the housefly Musca domestica. The expression patterns of three variants, including the previously reported MdGluClA, differed among the body parts (head, thorax, abdomen, and leg) of the adult housefly and among developmental stages (embryo, larva, pupa, and adult). The MdGluClA and B transcripts were abundant in the central nervous system of the adult, whereas the MdGluClC transcript was expressed in the central nervous system and as the predominant variant in the peripheral tissues. The sensitivities to the agonist glutamate and the allosteric activator ivermectin B_1a did not differ between channels containing MdGluCl variants when they were singly or co-expressed in Xenopus oocytes. By contrast, MdGluClA and B channels were more sensitive to the channel blockers fipronil and picrotoxinin than was MdGluClC channels. Heteromeric channels containing different subunit variants were more sensitive to picrotoxinin than were homomeric channels. Heteromeric channels were more sensitive to fipronil than were homomeric MdGluClC channels but not than homomeric MdGluClA and B channels. These results suggest that functionally indistinguishable but pharmacologically distinct GluCls are expressed in a spatially and temporally distinct manner in the housefly.
γ-Aminobutyrate- and Glutamate-gated Chloride Channels as Targets of Insecticides
2013, Advances in Insect Physiology
Citation Excerpt :
Transcripts with the b/c combination were the most abundant in Drosophila embryos, while those with the a/d combination were the least abundant. As the region encoded by exons 3 and 6 lies in the N-terminal region of the RDL subunit, where the agonist binding site is located, alternative splicing affects the sensitivity of the GABA receptors containing the RDL subunit to agonists (Hosie and Sattelle, 1996b; Hosie et al., 2001). Drosophila RDL apparently undergoes RNA editing at four sites to generate four amino acid changes: R122G in the N-terminal region, I283V in TM1, N294D in the TM1–TM2 linker, and M360V in the TM3–TM4 linker.
γ-Aminobutyrate (GABA)- and glutamate-gated chloride channels (GABACls and GluCls) are members of the Cys-loop receptor channel family. Both channels are widely distributed in the nervous system of invertebrates and function as neurotransmitter receptors to mediate inhibitory synaptic transmission. These receptor channels are important targets for widely used insecticides and parasiticides. Diverse noncompetitive antagonists, including the phenylpyrazole insecticide fipronil, inhibit inhibitory neurotransmission by binding to a site deep within the pentameric channel. Macrocyclic lactones, such as the insecticide/parasiticide avermectin, activate GluCls by irreversibly binding to the subunit interfaces. Recent genome sequencing and molecular biology studies have revealed a diversity of subunit isoforms arising from the duplication, alternative splicing, and RNA editing of the genes encoding these channels in various insect species, which may lead to physiological and pharmacological diversification of the receptor channels. Fipronil resistance due to target-site insensitivity in GABACls is a growing concern in several insect pest species. Nevertheless, identification of new chemistry and multiple potential binding sites for agonists, antagonists, and modulators in these channels suggests potential for developing novel pest control chemicals.
The ligand-gated chloride channel gene family of Drosophila melanogaster
2010, Pesticide Biochemistry and Physiology
The antagonism of cellular excitability in insects is mediated by a family of ionotropic receptors, the ligand-gated chloride channels. In insects these inhibitory receptors include synaptic GABA and histamine receptors, functionally analogous to vertebrate GABA and glycine receptors, and glutamate receptors that appear to be unique to invertebrates. The ligand-gated chloride channel family in insects includes two well-validated targets for insect control agents: GABA receptors, which are the targets for a structural variety of small-molecule insecticides (polychlorocycloalkanes such as dieldrin and phenylpyrazoles such as fipronil) that have been used widely in agriculture; and glutamate receptors, which are the targets of macrocyclic lactone natural products (the avermectins) that have yielded not only commercial insecticides but also anthelminthic agents (i.e., ivermectin) employed in animal and human health. The availability of the complete genome sequence of the insect model system Drosophila melanogaster has permitted the identification of all of the genes encoding proteins with structural similarity to known ligand-gated chloride channel subunits (ligand-gated chloride channel homologs or LCCHs). Here, we review the present status of knowledge of the structure and function of the proteins encoded by this compact gene family. The 12 LCCH genes of D. melanogaster exhibit a surprising degree of structural diversity, which is further enhanced for some subunits by a variety of post-transcriptional and post-translational modifications. Although the structures of the gene products encoded by this small gene family are now well characterized, surprisingly little is known of the biological functions of the majority of them and the structures of most native receptors remain unknown.
Novel alternative splicing of GABA receptor RDL exon 9 from Laodelphax striatellus modulates agonist potency
2021, Insect Science

View all citing articles on Scopus

^†: Present address: Department of Pharmacology, School of Pharmacy, University of London, 29–39 Brunswick Square, London WC1N 1AX, UK

^‡: Present address: Bamfield Marine Biology Station, Bamfield, B.C. VOR 1B0, Canada

View full text

Alternative splicing of a Drosophila GABA receptor subunit gene identifies determinants of agonist potency

Abstract

Section snippets

Cloning of a Drosophila GABA receptor subunit complementary DNA

An Rdl splice variant product (RDLad) with altered affinity for GABA

Discussion

Conclusion

Acknowledgements

Neurosci. Lett.

Trends Neurosci.

J. biol. Chem.

Analyt. Biochem.

Neuropharmacology

Trends Neurosci.

Trends pharmac. Sci.

Comp. Biochem. Physiol. Pharmacol. Toxicol. Endocrinol.

Neuron

Fedn Eur. biochem. Socs Lett.

J. Physiol., Paris

Comp. Biochem. Physiol. Biochem. Molec. Biol.

Trends Neurosci.

Adv. Insect Physiol.

Trends Neurosci.

Fedn Eur. biochem. Socs Lett.

GABAA receptors need two homologous domains of the β subunit for activation by GABA but not pentobarbital

Nature

Homomeric p1 GABR channels: activation properties and domains

Receptors and Channels

Assembly of GABAA receptor subunits: a1β, and a1β1γ2s subunits produce unique ion channels with dissimilar single channel properties

J. Neurosci.

Immunocytochemistry of a novel GABA receptor subunit Rdl in Drosophila melanogaster

Invert. Neurosci.

Interaction of positive allosteric modulators with human and Drosophila recombinant GABA receptors expressed in Xenopus laevis oocytes

Br. J. Pharmac.

Functional cDNA libraries from Drosophila embryos

J. Molec. Biol.

Plasticity in fast synaptic inhibition of adult oxytocin neurons caused by a switch in GABA (A) receptor subunit expression

Neuron

Cloning and functional expression of a Drosophila γ-aminobutyric acid receptor

Proc. natn. Acad. Sci. USA

Negatively charged amino acid residues in the nicotinic receptor δ subunit that contribute to the binding of acetylcholine

Proc. natn. Acad. Sci. USA

An Rdl splice variant product (RDL_ad) with altered affinity for GABA

GABA_A receptors need two homologous domains of the β subunit for activation by GABA but not pentobarbital

Assembly of GABA_A receptor subunits: a1β, and a1β1γ2s subunits produce unique ion channels with dissimilar single channel properties