Alternative splicing of a Drosophila GABA receptor subunit gene identifies determinants of agonist potency
Section snippets
Cloning of a Drosophila GABA receptor subunit complementary DNA
A Drosophila embryonic (12–24 h) cDNA library in pNB406 was divided into aliquots of clones which were screened for Rdl-encoded cDNAs using the polymerase chain reaction (PCR). Thirty-five cycles of PCR (1 min at 94°C, 1 min at 60°C, 2 min at 72°C) were performed with 50 pmol of each oligonucleotide primer (forward: ATGAGTGATTCAAAAATGGACAAGC; reverse: TCGTGGACCTTGAATCTCACCT) and with Taq DNA polymerase (Promega). The chosen primers would not distinguish between cDNAs encoding the splice variants of
An Rdl splice variant product (RDLad) with altered affinity for GABA
A clone of plasmid pDRA was isolated from an embryonic cDNA library6 and included a 1818 nucleotide open reading frame. This open reading frame was 97.3% identical with cDNA encoding the Drosophila GABA receptor subunit RDLac15 and contained three putative start codons within the first 35 bases. A 222-bp region containing multiple stop codons in all three reading frames was located 5′ to the 1818 bp open reading frame.
The nucleotide sequence of the cDNA in pDRA differed from that of RDLac only
Discussion
There is mounting evidence that subunits encoded by insect Rdl genes underly the characteristic pharmacology of the bicuculline-insensitive GABA receptors that predominate in insect nervous systems.24 cRNAs exhibiting a high identity (>80%) with those encoding Drosophila RDL subunits, have been cloned from a variety of insect species belonging to three orders26., 34., 45., 46. and are widely distributed in insect CNS. Although the intron-exon structures of Rdl genes from insect species other
Conclusion
The present study demonstrates that a naturally occurring substitution of residues in the extracellular region of Drosophila GABA receptors underlies moderate changes in the potency of the natural agonist, GABA, and may therefore serve a physiological role. The region containing these changes aligns with determinants of agonist potency on nAChRs. It is therefore possible that this region may also affect either the agonist responses of vertebrate GABA receptors, or the kinetics of channel
Acknowledgements
The authors are grateful to Drs H. A. Baylis and M. L. Hutton for advice on cDNA cloning. Support for AMH included a Medical Research Council Research Studentship, a grant from Dupont Agricultural Products and a short-term award from The Babraham Institute. SDB acknowledges the support of The Babraham Institute. The Support of the Medical Research Council and the Biotechnology and Biological Research Council of the UK is gratefully acknowledged by DBS.
References (50)
- et al.
Actions of agonists and convulsant site antagonists on a Drosophila melanogaster GABA receptor (Rd1) homo-oligomer expressed in Xenopus oocytes
Neurosci. Lett.
(1994) Transmitter timecourse in the synaptic cleft: its central synaptic function
Trends Neurosci.
(1996)- et al.
Agonist binding site of Torpedo electric tissue nicotinic acetylcholine receptor: a negatively charged region of the δ subunit within 0.9 nm of the α subunit binding site disulphide
J. biol. Chem.
(1995) - et al.
A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity
Analyt. Biochem.
(1983) - et al.
Neuronal nicotinic receptors: molecular organization and regulations
Neuropharmacology
(1995) - et al.
Molecular biology of insect neuronal GABA receptors
Trends Neurosci.
(1997) Cis- and trans-4-aminocrotonic acid as GABA analogues of restricted conformation
Trends pharmac. Sci.
(1996)- et al.
Identification of the site of mutation within the M2 region of the GABA receptor of the cyclodiene-resistant German cockroach
Comp. Biochem. Physiol. Pharmacol. Toxicol. Endocrinol.
(1994) - et al.
Towards a structural basis of the function of nicotinic acetylcholine receptors and their cousins
Neuron
(1995) - et al.
Expression of a Drosophila GABA receptor in a Baculovirus-insect cell system—functional expression of insecticide susceptible and resitant GABA receptors from the cyclodiene resistant gene Rd1
Fedn Eur. biochem. Socs Lett.
(1993)
Allosteric nicotinic receptors, human pathologies
J. Physiol., Paris
DNA sequence and site of mutation of the GABA receptor of cyclodiene-resistant red flour beetle, Tribolium castaneum
Comp. Biochem. Physiol. Biochem. Molec. Biol.
Bridging the cleft at GABA synapses in the brain
Trends Neurosci.
GABA receptors of insects
Adv. Insect Physiol.
Functional domains of GABAA receptors
Trends Neurosci.
Cloning & sequencing of the cyclodiene insecticide resistance gene from the yellow fever mosquito Aedes aegypti
Fedn Eur. biochem. Socs Lett.
GABAA receptors need two homologous domains of the β subunit for activation by GABA but not pentobarbital
Nature
Homomeric p1 GABR channels: activation properties and domains
Receptors and Channels
Assembly of GABAA receptor subunits: a1β, and a1β1γ2s subunits produce unique ion channels with dissimilar single channel properties
J. Neurosci.
Immunocytochemistry of a novel GABA receptor subunit Rdl in Drosophila melanogaster
Invert. Neurosci.
Interaction of positive allosteric modulators with human and Drosophila recombinant GABA receptors expressed in Xenopus laevis oocytes
Br. J. Pharmac.
Functional cDNA libraries from Drosophila embryos
J. Molec. Biol.
Plasticity in fast synaptic inhibition of adult oxytocin neurons caused by a switch in GABA (A) receptor subunit expression
Neuron
Cloning and functional expression of a Drosophila γ-aminobutyric acid receptor
Proc. natn. Acad. Sci. USA
Negatively charged amino acid residues in the nicotinic receptor δ subunit that contribute to the binding of acetylcholine
Proc. natn. Acad. Sci. USA
Cited by (46)
Molecular Targets of Neurotoxic Insecticides in Apis mellifera
2022, European Journal of Organic ChemistryThe novel isoxazoline ectoparasiticide fluralaner: Selective inhibition of arthropod γ-aminobutyric acid- and l-glutamate-gated chloride channels and insecticidal/acaricidal activity
2014, Insect Biochemistry and Molecular BiologyCitation Excerpt :To investigate effects of the dieldrin resistance mutation A285 ➔ S285, the CfRDL-A285-encoding version of cfrdl was generated, which proved to be functional in Xenopus oocytes (Fig. 5B). Since the vast majority of historic RDL studies in insects have been performed with the D. melanogaster channel (Buckingham et al., 2005), the genes encoding the best-studied ac-splice variant (ffrench-Constant et al., 1991; Hosie et al., 2001) in its dieldrin-sensitive and -resistant dmrdl forms (A302, S302) were included in this study and functionally characterized, to allow better comparisons and connections to results published earlier by others. In a second step of our study, transgenic stable and clonal cell lines were generated for the three parasite RDL gene forms rmrdl, cfrdl-A285 and cfrdl-S285, for the two D. melanogaster gene versions dmrdl-A302 and dmrdl-S302, as well as the tick rmglucl.
Expression pattern and function of alternative splice variants of glutamate-gated chloride channel in the housefly Musca domestica
2014, Insect Biochemistry and Molecular BiologyCitation Excerpt :The Drosophila GABACl subunit gene Rdl also undergoes pre-mRNA splicing and editing. The changes by these processes cause differences in the sensitivity of the receptor to GABA and GABACl blockers (Buckingham et al., 2005; Es-Salah et al., 2008; ffrench-Constant and Rocheleau, 1993; Hosie et al., 2001; Jones et al., 2009). The macrocyclic lactone ivermectin B1a is a positive allosteric modulator of GluCls (Ozoe, 2013).
γ-Aminobutyrate- and Glutamate-gated Chloride Channels as Targets of Insecticides
2013, Advances in Insect PhysiologyCitation Excerpt :Transcripts with the b/c combination were the most abundant in Drosophila embryos, while those with the a/d combination were the least abundant. As the region encoded by exons 3 and 6 lies in the N-terminal region of the RDL subunit, where the agonist binding site is located, alternative splicing affects the sensitivity of the GABA receptors containing the RDL subunit to agonists (Hosie and Sattelle, 1996b; Hosie et al., 2001). Drosophila RDL apparently undergoes RNA editing at four sites to generate four amino acid changes: R122G in the N-terminal region, I283V in TM1, N294D in the TM1–TM2 linker, and M360V in the TM3–TM4 linker.
The ligand-gated chloride channel gene family of Drosophila melanogaster
2010, Pesticide Biochemistry and Physiology
- †
Present address: Department of Pharmacology, School of Pharmacy, University of London, 29–39 Brunswick Square, London WC1N 1AX, UK
- ‡
Present address: Bamfield Marine Biology Station, Bamfield, B.C. VOR 1B0, Canada