The crystal structure of a family GH25 lysozyme from Bacillus anthracis implies a neighboring-group catalytic mechanism with retention of anomeric configuration
Graphical abstract
Introduction
Lysozyme is a generic term given to describe hydrolytic enzymes which cleave the β-1,4-glycosidic bond between N-acetylmuramic acid (NAM) and N-acetylglucosamine (NAG) and in the carbohydrate backbone (1) of bacterial peptidoglycan.
There is an increasing interest in harnessing the lytic properties of these enzymes as antimicrobial agents due to their exquisite efficiency1 and specificity against medical relevant pathogens such as Streptococcus pneumoniae,2Bacillus anthracis,3 and Enterococcus faecium.4 In nature, the NAM–NAG bond is cleaved by a structurally diverse set of enzymes that can be classified using five prototypes derived from the >100 glycoside hydrolase families defined by CAZY5 (recently reviewed in a historical context6): hen egg-white lysozyme (HEWL; GH22), goose egg-white lysozyme (GEWL, GH23), bacteriophage T4 lysozyme (T4L; GH24), Sphingomonas flagellar protein (FlgJ GH73),7 and GH25 enzymes exemplified by Chalaropsis lysozymes.8, 9 The first three of these lysozyme types share some common structural features albeit with low sequence similarities. These GH22-24 enzymes consist mainly of a constant core of two helices and a three-stranded β-sheet that accommodates the substrates in the inter-domain cleft.8 An additional family GH108 is likely to emerge as a sixth structural prototype,9 although it remains largely biochemically uncharacterized. There are also several families of peptidoglycan lytic transglycosylases (reviewed by Blackburn and Clarke in Ref. 10) that will not be discussed further here.
The GH25 lysozymes, however, are structurally unrelated to the GH22-24, GH73, and GH108 lysozyme folds and instead these enzymes display a modified β-barrel-like fold that, like the classical ‘TIM-barrel’, is composed of a eight-stranded β-barrel, but which is flanked by five (as opposed to the normal eight) α-helices.11 The characterized lysozymes from this family exhibit both β-1,4-N-acetyl- and β-1,4-N,6-O-diacetylmuramidase activities12, 13 and their evolutionary origin is diverse comprising bacterial, viral (mainly from phage), and eukaryotic representatives. So far three members of this family of enzymes have been structurally characterized, that of the Streptomyces coelicolor enzyme ‘cellosyl’,11 the bacteriophage lysine PlyB,14 and Clp-1 lysozyme from a S. pneumoniae phage15, 16 with the latter structure also obtained in complex with fragments of peptidoglycan analogues.16
At the catalytic level, however, a serious drawback with mechanistic analysis of GH25 enzymes is the continuing lack of an appropriate substrate with which to determine the stereochemical course of hydrolysis given that, unlike hen egg-white lysozyme, for example, the enzymes are not active on NAG homopolymer ‘chitooligosaccharide’ substrates and have only been found to be active on the peptidoglycan found in intact bacterial cells. Thus, proposals as to mechanism have simply been inferred from the disposition of active center groups.15 Briefly summarized, it is widely assumed that GH25 enzymes act with inversion of anomeric configuration which is a proposal based solely on the relative spacing of two conserved carboxylates in the enzyme active center that are deemed ‘too distant’ to be consistent with a classical retention mechanism via a covalent glycosyl-enzyme intermediate. Here we will argue, based upon our 1.4 Å crystal structure of a B. anthracis GH25 enzyme BaGH25c (presented here for the first time) that these proposals are most likely incorrect. Whilst mechanistic clarification must await synthesis of a suitable substrate, we would propose, based upon the conserved active center similarity with hexosaminidases from families GH18, GH20, GH56, GH84, and GH85, that GH25 enzymes act, as with all these related families, with net retention of anomeric configuration. In the absence of any experimental evidence to the contrary, we suggest that GH25 enzymes harness a neighboring-group participation mechanism that has unambiguously been shown for the other enzyme families whose catalytic centers are highly similar to GH25.
Section snippets
Results and discussion
The gene encoding the B. anthracis GH25 enzyme, BaGH25c, was expressed in Escherichia coli. The exact role of this protein in B. anthracis has not been described, but it is likely that this molecule modulates the chemical alteration of peptidoglycan during bacterial cell growth and division rather than being a prophage-encoded sequence. The gene is chromosomal, not adjacent to known prophage encoding genes and the protein sequence contains a signal secretion peptide—a feature not seen with
Cloning, expression, and purification of the BaGH25c
The BaGH25c gene (UniProt:Q81YN8) was amplified by PCR from B. anthracis str. Ames35 genomic DNA using the forward primer CACCACCACCACATGGATAGGTATGAAATAAAAGGTGTAGAT and reverse primer GAGGAGAAGGCGCGTTAATCTTTCATTCCATAATTCTCAAACTCTTCCTCATTC. The gene was then cloned into pET28a for expression purposes with an N-terminal His6 tag. The expression construct was transformed into BL21(DE3) cells and cultures were grown at 37 °C until O.D.600 of 0.4. The incubation temperature was then decreased to 30 °C
Acknowledgments
We gratefully acknowledge the financial support from the Royal Society and the Biotechnology and Biological Sciences Research Council (BBSRC). EJT is a Royal Society-University Research Fellow and GJD is a Royal Society-Wolfson Research Merit Award recipient.
References (44)
- et al.
Biochem. Biophys. Res. Commun.
(2009) - et al.
J. Mol. Biol.
(2007) - et al.
J. Biol. Chem.
(2001) - et al.
J. Biol. Chem.
(1978) - et al.
J. Mol. Biol.
(2007) - et al.
Structure
(2003) - et al.
J. Biol. Chem.
(2007) - et al.
Structure
(1995) - et al.
Curr. Opin. Chem. Biol.
(2008) - et al.
Structure
(2000)
J. Biol. Chem.
J. Mol. Biol.
J. Biol. Chem.
J. Biol. Chem.
Methods Enzymol.
Proc. Natl. Acad. Sci. U.S.A.
Infect Immun.
Nature
J. Bacteriol.
Nucleic Acids Res.
Biochem. J.
Nat. Struct. Biol.
Cited by (30)
On the catalytic mechanism of bacteriophage endolysins: Opportunities for engineering
2020, Biochimica et Biophysica Acta - Proteins and ProteomicsCitation Excerpt :Arguments for both an inversion mechanism [24] and a retention mechanism [25], have been put forward. Unfortunately, it has been difficult to determine the stereochemical outcomes of cleavage of the five characterised N-acetylmuramidase GH25 (PF01183) endolysins (Table 1), as they are only active on bacterial peptidoglycan and do not catalyse the cleavage of substrate analogues, which are more tractable from the perspective of enzymatic studies [25]. Although this is a barrier to understanding the mechanism in detail, it highlights that these enzymes have a high-degree of substrate specificity.
Safety evaluation of a novel muramidase for feed application
2017, Regulatory Toxicology and PharmacologyCitation Excerpt :Fleming first described muramidase in 1922 (Fleming, 1922) to be present in human nasal secretions. Muramidases are ubiquitous enzymes mostly found in animal secretions like saliva, tiers, milk (Jollès and Jollès, 1967), in microorganisms (Morgavi et al., 1994; Martinez-Fleites et al., 2009; Ai-Riyami et al., 2016) and in plants (Sytwala et al., 2015; Audy et al., 1988; Manikandan et al., 2015). One hen egg contains around 100 mg of muramidase as natural constituent in the albumen (Vidal et al., 2005; Stevens, 1991).
Structural studies suggest a peptidoglycan hydrolase function for the Mycobacterium tuberculosis Tat-secreted protein Rv2525c
2014, Journal of Structural BiologyCitation Excerpt :While the glutamate residue in the DxE motif is structurally conserved in all GH25 hydrolases for which structures are available so far (Fig. 1B), another exception to the conservation of the aspartate is found in the B. stearothermophilus hydrolase (PDB: 1sfs; Fig. 1B), as well as in all actinobacterial homologues of Rv2525c (Suppl. Fig. S2A). This raises questions about the universality of the catalytic mechanism proposed for the GH25 family (Martinez-Fleites et al., 2009). Although our attempts to detect a peptidoglycan hydrolase activity on either mycobacterial cells or purified peptidoglycan fragments were unsuccessful (Supplementary material and Suppl. Figs. S3,S4), it is worth noting that no thorough kinetic analysis of GH25 enzymes has been reported so far, primarily due to the lack of suitable in vitro substrates (Martinez-Fleites et al., 2009).
Bacteriocin protein BacL<inf>1</inf> of enterococcus faecalis is a peptidoglycan D-isoglutamyl-L-lysine endopeptidase
2013, Journal of Biological ChemistryEnzymatic synthesis of new C-6-acylated derivatives of NAG-thiazoline and evaluation of their inhibitor activities towards fungal β-N- acetylhexosaminidase
2013, Journal of Molecular Catalysis B: EnzymaticCitation Excerpt :The function, biochemical properties and structure of β-N-acetylhexosaminidases from humans have been subjects of intensive research, as both types of enzymes are important in different physiological processes and their dysfunction or absence causes severe neurodegenerative disorders [19–21]. Moreover, both classes share the substrate-assisted catalytic mechanism [22]; and also the architecture of their active site is similar [23]. Thus, the search for the inhibitors specific for one of the two enzyme groups is a challenging task, as the highly selective inhibitors are necessary tools for the study of the functions of the respective enzymes in vivo, as well as for the development of therapeutics with minimal side effects [22,24].
Structure of the glycosyltransferase EryCIII in complex with its activating P450 homologue EryCII
2012, Journal of Molecular BiologyCitation Excerpt :A number of GTs involved in natural product biosynthesis have been structurally characterized, including GtfB, which transfers glucose from UDP-glucose to the aglycone of the glycopeptide vancomycin;4 the deoxyaminohexose transferases GtfA and GtfD from, respectively, the pathways to chloreremomycin and vancomycin;5,6 and a productive chimeric glycopeptide GT.7 Other structures solved include AviGT4 in avilamycin A biosynthesis,8 UrdGT2 in urdamycin A biosynthesis9 and CalG3 in calicheamicin biosynthesis.10 Also, the structures of two other GTs involved in antibiotic export and resistance have been reported.11