[36] - Direct Stimulation of Bruton's Tyrosine Kinase by G Protein α Subunits
Introduction
Heterotrimeric G proteins transduce signals from cell surface receptors to downstream effectors to control a wide variety of cellular responses.1,2 One class of effectors for G proteins is tyrosine kinases.3,4 The first tyrosine kinase effector discovered for Gαq protein is Bruton's tyrosine kinase (Btk).3 Btk family tyrosine kinases include Btk, Tec, Itk/Tsk, Bmx/Etk, and Txk/Rlk.5 These tyrosine kinases are characterized by an amino-terminal pleckstrin homology (PH) domain followed by a Tec homology (TH) domain [composed of a Btk motif (BM) and a proline-rich (PR) region], a Src homology 3 (SH3) domain, an SH2 domain, and a COOH-terminal kinase domain (Fig. 1). They are expressed in a variety of cells and tissues including hematopoietic, epithelial, and endothelial cells and they are involved in cell growth, differentiation, apoptosis, and other cellular signaling processes.6 Defects in Btk are responsible for X chromosome-linked agammaglobulinemia (XLA) in humans and X chromosome-linked immunodeficiency (XID) in mice.6 Combined deletion of Itk and Rlk in mice caused marked defects in T cell receptor-mediated responses including proliferation, cytokine production, apoptosis, and adaptive immune responses.7 The Drosophila Btk homolog is required for adult survival and male genital formation.8 We have shown that the kinase activity of Btk can be directly stimulated by Gαq and Gα12.3,4 Here we describe the in vitro assay for monitoring the regulation of Btk by G protein α subunits.
Section snippets
Purification of Recombinant Btk Protein from Escherichia coli
For pusrification, we generated a hexahistidine (His6) -tagged Btk by subcloning a human Btk cDNA into pET21a plasmid vector. A plasmid DNA harboring human Btk cDNA, pApuro-hBtk,9 was used as template for polymerase chain reaction (PCR) with the following oligonucleotide primers: 5′ oligonucleotide primer ATACGGATCCATGGCCGCAGTGATTCTG and 3′ oligonucleotide primer CTAGCTCGAGGGATTCTTCATCCATGAC. The PCR product (∼1.9 kb) was subcloned into the BamHI and XhoI sites of pET21a vector (Novagen,
Sodium Dodecyl Sulfate-Polyacrylamide Gel Electrophoresis Separation
The kinase reactions are heat inactivated for 5 min at 95°, and then loaded onto an SDS–polyacrylamide gel. Because the substrate is only 13 amino acids long, a high-percentage gel must be used. A 20% (w/v) gel (20 × 20 cm) has been found to provide adequate separation of peptide and free [γ-32P]ATP. The gel is run until the sample dye is within 1 inch of the bottom. After cutting the gel right above the sample dye, the bottom gel piece that contains free [γ-32P]ATP is properly discarded. The
G-Protein Regulation of Tyrosine Kinases
Although the detailed activation mechanisms of Btk by Gαq and Gα12 are not known, possible activation models have been proposed. Gαq binds directly to Btk to a region composed of a Tec homology (TH) domain and a Src homology 3 (SH3) domain (Fig. 1).14 Mutations of Btk that disrupt its ability to bind Gαq also eliminated Btk stimulation by Gαq, suggesting that this interaction is important for Btk activation. Remarkably, the structure of this TH–SH3 fragment of the Btk family of tyrosine kinases
Acknowledgments
Our research is supported by grants from the National Institutes of Health, the American Cancer Society, the American Heart Association, and the Irma Hirschl Trust.
References (18)
- et al.
Immunity
(1996) - et al.
J. Biol. Chem.
(1997) Annu. Rev. Biochem.
(1987)- et al.
Physiol. Rev.
(1999) - et al.
Nature (London)
(1997) - et al.
Nature (London)
(1998) - et al.
Annu. Rev. Immunol.
(1997) - et al.
Annu. Rev. Immunol.
(1996) - et al.
Science
(1999)