Determinants contributing to estrogen-regulated expression of SK3
Section snippets
Materials and methods
Reverse transcription-PCR. Reverse transcriptions were performed as described [19]. For amplifications to identify the CAP site, the PCR was performed with the following primers: reverse primer from exon 2 (Fig. 1A, #5): AGCTGTACTTCCCTTGTGTGG, forward primers from 5′ to 3′ of the CAP site, 1: TGGCTAATAAGTGGGCTTGGC; 2: CTTGCCATATAACAGTGTCAG; 3: TGAGCCAGCGAGGAGTGAAGCTGAGT; and 4: ATACAATGCACACTCGAGTGGC. The reactions used Taq polymerase (Promega, Madison, WI), with 2 mM MgCl2, 1× Taq buffer
Identification of the rat SK3 transcriptional start site
Nucleotide sequence comparisons from multiple independent rSK3 cDNA clones implicated a region of genomic DNA that might contain the transcriptional start site for rSK3. Therefore, a 6 kb sequence of rat genomic DNA including this area was determined (GenBank Accession No. AC133222.1). Initial experiments to identify the start site for rSK3 transcription used rt-PCR with RNA extracted from L6 cells, which express SK3. The PCR was performed with a single 3′ oligonucleotide directed to a sequence
Discussion
The results presented here identify a transcriptional start site for SK3 expression, the minimal rSK3 promoter, and a 33 bp enhancer adjacent to the minimal promoter. The enhancer endows upon a heterologous minimal promoter the ability to achieve high levels of expression in L6 myotubes but not in Cos7 cells. However when Cos7 cells express ERα and are stimulated with E2, the 33 bp motif becomes a strong transcriptional enhancer. Remarkably, ERα expression and exposure to E2 activate the
Acknowledgements
We thank Chris Bond for critical discussions, technical assistance, and reading of the manuscript. We also thank Lori Vaskalis for graphics support. An American Heart Association Fellowship to PH a Tartar Trust Fellowship to D.J. and NIH grants to J.M. and J.P.A. supported this work.
References (47)
- et al.
The hypothalamic control of the menstrual cycle and the role of endogenous opioid peptides
Recent. Prog. Horm. Res.
(1984) - et al.
Effects of estrogen on skeletal myoblast growth
Biochem. Biophys. Res. Commun.
(1997) Revolutions in rapid amplification of cDNA ends: new strategies for polymerase chain reaction cloning of full-length cDNA ends
Anal. Biochem.
(1995)- et al.
Induction of CRE-mediated gene expression by stimuli that generate long-lasting LTP in area CA1 of the hippocampus
Neuron
(1996) - et al.
Myogenesis and MyoD down-regulate Sp1. A mechanism for the repression of GLUT1 during muscle cell differentiation
J. Biol. Chem.
(1997) - et al.
Isolation of cDNA encoding transcription factor Sp1 and functional analysis of the DNA binding domain
Cell
(1987) - et al.
Myogenic lineage determination and differentiation: evidence for a regulatory gene pathway
Cell
(1988) - et al.
Effects of estrogen on skeletal myoblast growth
Biochem. Biophys. Res. Commun.
(1997) - et al.
Ligand-, cell-, and estrogen receptor subtype (α/β)-dependent activation at GC-rich (Sp1) promoter elements
J. Biol. Chem.
(2000) - et al.
Inhibition of vascular endothelial growth factor expression in HEC1A endometrial cancer cells through interactions of estrogen receptor α and Sp3 proteins
J. Biol. Chem.
(2000)
Small-conductance, calcium-activated potassium channels from mammalian brain [see comments]
Science
A human intermediate conductance calcium-activated potassium channel
Proc. Natl. Acad. Sci. USA
hSK4, a member of a novel subfamily of calcium-activated potassium channels
Proc. Natl. Acad. Sci. USA
Mechanism of calcium gating in small-conductance calcium-activated potassium channels
Nature
Domains responsible for constitutive and Ca(2+)-dependent interactions between calmodulin and small conductance Ca(2+)-activated potassium channels
J. Neurosci.
Structure of the gating domain of a Ca2+-activated K+ channel complexed with Ca2+/calmodulin
Nature
Activation of Fos-like immunoreactivity in the medial preoptic area and limbic structures by maternal and social interactions in rats
Behav. Neurosci.
Neuroanatomical circuitry for mammalian maternal behavior
Ann. N. Y. Acad. Sci.
The noradrenergic inhibition of an apamin-sensitive, small-conductance Ca2+-activated K+ channel in hypothalamic γ-aminobutyric acid neurons: pharmacology, estrogen sensitivity, and relevance to the control of the reproductive axis
J. Pharmacol. Exp. Ther.
Distribution, neuronal colocalization, and 17β-E2 modulation of small conductance calcium-activated K(+) channel (SK3) mRNA in the guinea pig brain
Endocrinology
A comparative study of the luteinizing hormone releasing hormone (LHRH) neuronal networks in mammals
Biol. Reprod.
Evidence for oestrogen receptor α-immunoreactivity in gonadotrophin-releasing hormone-expressing neurones [see comments]
J. Neuroendocrinol.
Detection of estrogen receptor α and β messenger ribonucleic acids in adult gonadotropin-releasing hormone neurons
Endocrinology
Cited by (46)
Membrane-initiated estrogen signaling via Gq-coupled GPCR in the central nervous system
2019, SteroidsCitation Excerpt :These transcriptional events, often called the “classical” ER signaling pathway, are initiated by the formation of ERα and ERβ steroid binding–dependent hetero- or homodimers. These dimers translocate to the nucleus to bring about transcriptional activation through their interaction with the DNA binding site known as the estrogen response element (ERE) or with other DNA-bound transcription factors such as activator protein-1 (AP-1) and specificity protein-1 (SP-1) [4–8]. However, it has become clear that there also exists a rapid, membrane-initiated, E2-mediated actions independent of the classic nuclear signaling pathway.
Diverse actions of estradiol on anorexigenic and orexigenic hypothalamic arcuate neurons
2018, Hormones and BehaviorCitation Excerpt :However, there are many genes in the brain that are estrogen-responsive that do not appear to contain ERE sequences (Gruber et al., 2004; Malyala et al., 2004). There is compelling evidence that ERα and ERβ can regulate transcription of some of these “estrogen-responsive” genes by interacting with other DNA-bound transcription factors, such as specificity protein-1 (SP-1) and activator protein 1 (AP-1), rather than binding directly to DNA (Gruber et al., 2004; Jacobson et al., 2003; Paech et al., 1997). In contrast to ERα, the ligand-induced responses with ERβ at an AP-1 site illustrate the negative transcriptional regulation by estrogens and strong positive regulation by ER antagonists like ICI 164,384 (Paech et al., 1997).
Endothelial Small- and Intermediate-Conductance K Channels and Endothelium-Dependent Hyperpolarization as Drug Targets in Cardiovascular Disease
2016, Advances in PharmacologyCitation Excerpt :Regulation of KCa2.3 gene expression differs substantially from that of KCa3.1. A major factor in the control of gene transcription is reportedly 17β-estradiol and its interaction between estrogen receptor alpha and the transcription factor, specificity protein 1 (Sp1) (Jacobson, Pribnow, Herson, Maylie, & Adelman, 2003) that acts as an enhancer. Moreover, 17β-estradiol has been reported to augment KCa2.3 in the uterus of rats (Rahbek et al., 2014) and of mice (Pierce & England, 2010).
Membrane-initiated actions of estradiol that regulate reproduction, energy balance and body temperature
2012, Frontiers in Neuroendocrinology