Original ArticleChitosan-modified PLGA nanoparticles tagged with 5TR1 aptamer for in vivo tumor-targeted drug delivery
Graphical abstract
Introduction
Anthracyclines are the most effective anti-tumors among all classes of chemotherapeutic agents. Epirubicin (Epi) is a widely used anthracycline in breast cancer chemotherapy [1], [2]. Epi intercalates to DNA and inhibits topoisomerase II thereby leading to cell death [1], [3]. Even though chemotherapy is still the frontline treatment strategy for cancers, its side effects, including effects on normal cells and limited treatment duration or dosing, reduce clinical applications [4], [5]. Today, nanotechnology is paving the way to overcome the many barriers for efficient drug delivery [6]. A favorable approach to advance the selectivity and specificity of drugs for tumor cells is targeted drug delivery using nanoparticle functionalized with targeting ligands [4], [7], [8].
Choice of tumor marker and tumor-targeting ligand are important elements for targeted cancer therapy. Development of targeting ligands could reduce the off-target effects of drugs and cause them to be accumulated at the site of action [2]. The novel generation of targeting ligands is aptamers.
Aptamers are a class of nucleic acid-based ligands that fold into well-defined 3D structures to specifically bind to their targets [9], [10]. Low toxicity, slow degradation kinetics and notable stability in a wide range of pH, temperature and organic solvents without loss of activity make aptamers powerful candidates for pharmaceutical applications [11], [12], [13]. These ligands also play a critical role in the development of novel biosensors [14].
Overexpression of a specific maker on the cell surface is used to justify cell-specific targeted drug delivery [15]. Mucin 1 (MUC1) is a cell surface glycoprotein with extensive glycosylated extracellular domain [16]. Striking overexpression of the MUC1 receptor on the surface of tumor cells suggested that 5TR1 (Apt), anti-MUC1 aptamer would be suitable for tumor targeting [17], [18].
The development of targeted drug delivery systems with nanoparticles is expected to have a big impact on the clinical approaches in tumor chemotherapy [19], [20]. So far, a few aptamer-based targeted nanosystems have been introduced for treatment of breast and colon cancers. However, great attempts are being devoted to develop targeted delivery systems with better function and characteristic. One of these targeted delivery systems for treatment of breast and colon cancers has been introduced previously by our group. In this work, an aptamer-based dendrimer nanostructure was presented for targeted delivery of Epi to cancer cells [21]. The dendrimer structure was composed of several DNA building blocks. Although the developed delivery system showed good function in treatment of cancer cells in vitro and in vivo, the design of DNA origamis like this structure is complicated, and because of the presence of several DNA building blocks, they have a high cost. Thus here, we developed a targeted delivery system which did not have these shortcomings and has a simple design, low cost, more Epi loading and lower drug release in peripheral circulation.
Drug delivery systems using biodegradable and biocompatible nanoparticles, which have been approved by the Food and Drug Administration (FDA), like poly (lactic-co-glycolic acid) (PLGA), are of interest as they can be easily extended to clinical trials [5], [22], [23]. PLGA is a copolymer of poly lactic acid (PLA) and poly glycolic acid (PGA), and its breakdown products are hydrophilic, diffusible and rapidly metabolized in the human body [24]. Nevertheless, the short residence time of this nanosystem represents a major limitation of PLGA for achieving effective drug targeting to the site of action [6], [25]. Thus, to maximize the therapeutic effects of these carriers, they should bypass the phagocytic effects via surface coating of PLGA with hydrophilic polymers such as chitosan (CS) [6]. Chitosan is a biodegradable and biocompatible cationic polymer with relatively low immunogenicity. Because of its unique properties, chitosan has been widely used as a vehicle in drug delivery systems [26], [27], [28]. Also, the presence of primary amino groups on the chitosan polymer backbone could facilitate its attachment to other chemical reagents [24].
The present study is aimed at developing a targeted delivery system using modified PLGA nanoparticles with the chitosan and MUC1 aptamer. MCF7 and CHO cell lines were chosen to evaluate the effects of the designed delivery system in vitro. Consequently, using mice bearing C26 colon carcinoma, we assessed therapeutic efficacy of fabricated NPs with or without aptamers.
Section snippets
Materials
The MUC1 aptamer (5TR1) (GAAGTGAAAATGACAGAACACAACA) was obtained from Bioneer (South Korea). MCF7 (C135, breast cancer cell) and CHO (C111, Chinese hamster ovary cell) cell lines were purchased from Pasteur Institute of Iran, and C26 cells (murine colon carcinoma cell) were obtained from Cell Lines Service (Eppelheim, Germany) and cultured in RPMI 1640 and 10% fetal bovine serum (Gibco, Gaithersburg, USA). DNase RNase-free water was purchased from Sigma. Epirubicin (Epi), chitosan (CS, medium
Characterization of the nanoparticle
FTIR spectroscopy was used to demonstrate the presence of CS on the surface of PLGA. Fig. 1 shows the FTIR spectra of PLGA, CS and PLGA-CS. The spectra of PLGA (Fig. 1a) contained a strong peak at 1091 cm−1 for COC stretching, at 1760 cm−1 for CO and around 3500 cm−1 for OH stretching. Also, the presence of peaks around the 1490 cm−1 could be assigned to the CH stretching in methyl groups and between 2800 and 3000 cm−1 corresponding to CH, CH2 and CH3 stretching vibrations. A characteristic
Discussion
Even though chemotherapy is still the frontline treatment strategy for cancers, its side effects, including effects on normal cells and limited treatment duration or dosing, reduce clinical applications.
Previously, it was proved that in comparison with free Epi, liposomal formulation of Epi exhibited the lowest induction of body weight loss and also has a better survival rate output of mice [33].
However, while liposomal formulations of Epi are versatile, they cannot provide a sustained release
Conclusion
The present study developed a nanoparticulate drug delivery system functionalized with 5TR1 aptamer as the targeting ligand for anti-tumor drug delivery. The aptamer was electrostatically coupled to the surface of an Epi-PLGA-CS nanoparticle. The conjugation of aptamer was confirmed by increase in particle size and decrease in zeta potential of targeted NP.
As confirmed by a competition study in both cellular drug uptake and in vitro cytotoxicity, the 5TR1-MUC1 interaction facilitated the
Declaration of interest
All authors declare that they have no conflicts of interest. The authors have no other relevant affiliations or financial involvement with any organization or entity with a financial interest in or financial conflict with the subject matter or materials discussed in the manuscript apart from those disclosed.
Acknowledgements
Financial support of this study was provided by Mashhad University of Medical Sciences.
References (42)
- et al.
Epirubicin: is it like doxorubicin in breast cancer? A clinical review
Breast
(2012) - et al.
Long circulating chitosan/PEG blended PLGA nanoparticle for tumor drug delivery
Eur. J. Pharmacol.
(2011) - et al.
Self-assemble gene delivery system for molecular targeting using nucleic acid aptamer
Gene
(2012) - et al.
Nanotechnology and aptamers: applications in drug delivery
Trends Biotechnol.
(2008) - et al.
Oligonucleotide aptamers: new tools for targeted cancer therapy
Mol. Therapy—Nucleic Acids
(2014) - et al.
Aptamer-conjugated nanomaterials and their applications
Adv. Drug Deliv. Rev.
(2011) - et al.
Preparation and evaluation of polyethylenimine-functionalized carbon nanotubes tagged with 5TR1 aptamer for targeted delivery of Bcl-xL shRNA into breast cancer cells
Colloids Surf. B Biointerfaces
(2016) - et al.
Double targeting and aptamer-assisted controlled release delivery of epirubicin to cancer cells by aptamers-based dendrimer in vitro and in vivo
Eur. J. Pharm. Biopharm.
(2016) - et al.
Microscopic and spectroscopic evaluation of novel PLGA–chitosan nanoplexes as an ocular delivery system
Colloids Surf. B Biointerfaces
(2011) - et al.
Investigation on novel chitosan nanoparticle–aptamer complexes targeting TGF-β receptor II
Int. J. Pharm.
(2013)
Targeting delivery of tocopherol and doxorubicin grafted-chitosan polymeric micelles for cancer therapy: in vitro and in vivo evaluation
Colloids Surf. B Biointerfaces
Optimization of epirubicin nanoparticles using experimental design for enhanced intravesical drug delivery
Int. J. Pharm.
In vitro and in vivo evaluation of therapy targeting epithelial-cell adhesion-molecule aptamers for non-small cell lung cancer
J. Control Release
Size, surface charge, and shape determine therapeutic effects of nanoparticles on brain and retinal diseases
Nanomedicine Nanotechnol. Biol. Med.
Aptamer-functionalized PEG-PLGA nanoparticles for enhanced anti-glioma drug delivery
Biomaterials
Polyethylenimine-functionalized carbon nanotubes tagged with AS1411 aptamer for combination gene and drug delivery into human gastric cancer cells
Int. J. Pharm.
Epirubicin-loaded superparamagnetic iron-oxide nanoparticles for transdermal delivery: cancer therapy by circumventing the skin barrier
Small
Adjuvant chemotherapy for early breast cancer: optimal use of epirubicin
Oncologist
AS1411 aptamer tagged PLGA-lecithin-PEG nanoparticles for tumor cell targeting and drug delivery
Biotechnol. Bioeng.
Targeted delivery of a cisplatin prodrug for safer and more effective prostate cancer therapy in vivo
Proc. Natl. Acad. Sci. U. S. A.
Review article on gene therapy
Int. J. Genet.
Cited by (117)
Nucleolin-targeted cationic nanoparticle for delivery of survivin shRNA against colorectal cancer in vitro and in vivo
2024, European Polymer JournalAptamers combined with immune checkpoints for cancer detection and targeted therapy: A review
2024, International Journal of Biological MacromoleculesBeetroot extract@chitosan nanocomposite as a promising approach towards cancer therapy
2024, International Journal of Biological MacromoleculesA review of chitosan in gene therapy: Developments and challenges
2024, Carbohydrate PolymersBiomedical applications of aptamer-modified chitosan nanomaterials: An updated review
2023, International Journal of Biological Macromolecules