Contributions to Progress and Promise of Epigenetics for Diagnosis and Therapy in CancerWEE1 is a validated target of the microRNA miR-17-92 cluster in leukemia
Section snippets
Prediction of miRNA target genes
Prediction algorithms including TargetScan (www.targetscan.org), MicroCosm Targets (www.ebi.ac.uk/enright-srv/microcosm/htdocs/targets/v5), PicTar (pictar.mdc-berlin.de), and miBridge (sitemaker.umich.edu/mibridge/target_predictions) were used to predict potential biological targets of the miR-17-92 cluster.
Cloning of luciferase reporter constructs
The 3′ untranslated region (UTR) of WEE1 (nucleotides 2418–3356 of NM_003390.3) was amplified from human genomic DNA using the forward primer 5′ATGTTACACCAGCCTTTCCAGGGT3′ and the reverse
WEE1 is a predicted target of multiple miRNAs within the miR-17-92 cluster
Bioinformatic algorithms for miRNA target gene prediction were used to predict potential targets of miR-17, miR-18a, miR-19a, miR-20a, miR-19b, and miR-92a. For each miRNA of the cluster, a list was compiled of the 30 target genes with the highest total context scores from TargetScan, the 20 target genes with the lowest P values from MicroCosm Targets, the 20 target genes with the highest PicTar scores from PicTar, and all predicted target genes from miBridge. Both MicroCosm Targets and
Discussion
Identifying targets of the miR-17-92 cluster is important for increased understanding of the complex gene expression pathways that are dysregulated in leukemia. Previous studies have experimentally validated a range of gene targets of the miR-17-92 cluster in various systems. The individual miRNAs of this cluster have been shown to promote cell proliferation by downregulating p21 (17) and Pten (18), suppress apoptosis by downregulating E2Fs (19) and Bim (20), and induce angiogenesis in solid
Acknowledgments
The MSCV-PIG, miR-17 MSCV-PIG, miR-17-19b MSCV-PIG, and miR-17-92 MSCV-PIG plasmids were a kind gift from Dr. Jianjun Chen at the University of Chicago. This work was supported by the National Institutes of Health grant HL087188 (NJZ-L).
References (29)
microRNAs: tiny regulators with great potential
Cell
(2001)miRiad roles for the miR-17-92 cluster in development and disease
Cell
(2008)Triggering the all-or-nothing switch into mitosis
Trends Cell Biol
(2001)- et al.
Analysis of relative gene expression data using real-time quantitative PCR and the 2(-delta delta C(T)) method
Methods
(2001) - et al.
Prediction of mammalian microRNA targets
Cell
(2003) - et al.
Dicer ablation affects antibody diversity and cell survival in the B lymphocyte lineage
Cell
(2008) - et al.
Methods to analyze microRNA-mediated control of mRNA translation
Meth Enzymol
(2007) - et al.
Expression profiling of microRNA using real-time quantitative PCR, how to use it and what is available
Methods
(2010) - et al.
The miR-17-92 cluster expands multipotent hematopoietic progenitors whereas imbalanced expression of its individual oncogenic miRNAs promotes leukemia in mice
Blood
(2012) - et al.
MicroRNAs and small interfering RNAs can inhibit mRNA expression by similar mechanisms
Proc Natl Acad Sci U S A
(2003)
An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans
Science
Identification and characterization of a novel gene, C13orf25, as a target for 13q31-q32 amplification in malignant lymphoma
Cancer Res
A microRNA polycistron as a potential human oncogene
Nature
Augmentation of tumor angiogenesis by a myc-activated microRNA cluster
Nat Genet
Cited by (23)
miRNAs Role in Wilms tumor pathogenesis: Signaling pathways interplay
2024, Pathology Research and PracticeEnhancement of chemosensitivity by WEE1 inhibition in EGFR-TKIs resistant non-small cell lung cancer
2019, Biomedicine and PharmacotherapyCitation Excerpt :EGFR can activate KLF2 [22], and the inhibition of EGFR would increase WEE1 expression. Besides, many factors were involved in WEE1 expression, such as microRNA miR-17-92 (binding to the 3′UTR of WEE1) [23]. Chromatin remodeling factor CHD5 was also reported to bind to the promoter of WEE1 and repress its expression [24].
Good or not good: Role of miR-18a in cancer biology
2020, Reports of Practical Oncology and RadiotherapyCitation Excerpt :Tumor growth and proliferation. Generally, miR-18a induces cell proliferation, for example by regulating WEE1, a cell cycle inhibitor.94 However, in colorectal cancer, the increased expression of miR-18a results in decreased proliferation and migration of tumor cells and increases their apoptosis.
Regulation of the Cell Cycle by ncRNAs Affects the Efficiency of CDK4/6 Inhibition
2023, International Journal of Molecular Sciences
- 1
Present address: Division of Hematology/Oncology, Department of Medicine, Northwestern University, 303 East Superior Street, Chicago, IL, USA.